|
|
||||||||
Gastrointestinal Unit and Center for the Study of Inflammatory Bowel Disease, Department of Medicine, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114
| |
ABSTRACT |
|---|
|
|
|---|
Epithelial cell
kinase (Eck) is a member of a large family of receptor tyrosine kinases
whose functions remain largely unknown. Expression and regulation of
Eck and its cognate ligand B61 were analyzed in the human colonic
adenocarcinoma cell line Caco-2. Immunocytochemical staining
demonstrated coexpression of Eck and B61 in the same cells, suggestive
of an autocrine loop. Eck levels were maximal in preconfluent cells. In
contrast, B61 levels were barely detectable in preconfluent cells and
increased progressively after the cells reached confluence. Caco-2
cells cultured in the presence of added B61 showed a significant
reduction in the levels of dipeptidyl peptidase and sucrase-isomaltase
mRNA, markers of Caco-2 cell differentiation. Cytokines
interleukin-1
(IL-1
), basic fibroblast growth factor, IL-2,
epidermal growth factor, and transforming growth factor-
modulated
steady-state levels of Eck and B61 mRNA and regulated Eck activation as
assessed by tyrosine phosphorylation. Functionally,
stimulation of Eck by B61 resulted in increased proliferation, enhanced
barrier function, and enhanced restitution of injured epithelial
monolayers. These results suggest that the Eck-B61 interaction, a
target of regulatory peptides, plays a role in intestinal epithelial
cell development, migration, and barrier function, contributing to
homeostasis and preservation of continuity of the epithelial barrier.
growth factors; cytokines; receptors; differentiation
| |
INTRODUCTION |
|---|
|
|
|---|
THE INTESTINAL EPITHELIUM is a highly dynamic cell population that undergoes rapid turnover throughout adult life in close coordination with structural and functional differentiation. The complex functions of epithelial cells are regulated through a variety of mechanisms. Most importantly, growth and phenotypic characteristics of cells are modulated by a wide range of peptides that bind to cell surface receptor protein tyrosine kinases (RPTKs).
Several families of tyrosine kinases have been well characterized and found to have significant roles in the regulation of epithelial cell populations. These include the epidermal growth factor (EGF) receptor, fibroblast growth factor (FGF) receptor, and platelet-derived growth factor receptor families, named for their respective prototype member receptor tyrosine kinases (36).
Recently, a "new" family of RPTKs has been identified with distinctive expression patterns in the nervous system and in early vertebrate development (25, 31). This so-called Eph/Eck family of RPTKs appears to be the largest subfamily of RPTKs, with at least 13 distinct members identified to date. Eph, the prototype receptor, is encoded by a gene that was first identified in the etl-1 erythropoietin-producing hepatoma cell line (16). Although the majority of the Eph family members were identified in neural tissue, this family also includes members, most notably epithelial cell kinase (Eck), that appear to be expressed selectively by epithelial cell populations of the lung, kidney, skin, and ovaries (13, 21).
Eph family members are type I transmembrane glycoproteins. Their catalytic domains display amino acid sequence similarity to both nonreceptor and transmembrane tyrosine kinases (14). The extracellular domain of this subfamily contains a single immunoglobulin-like domain and two fibronectin type III repeats and has 19 or 20 highly conserved cysteine residues.
Although the Eph/Eck receptors were initially identified as
"orphan" receptors, a protein designated B61 has been found to serve as a ligand for Eck (1). The B61 protein was originally identified as a cytokine-inducible cDNA of unknown function produced by
endothelial cells (17). B61 was reported to be the product of an
early-response gene, activated by mediators of inflammation including
tumor necrosis factor-
, interleukin 1
(IL-1
), and lipopolysaccharide. This ligand has been independently identified by
other investigators and designated EFL-1 (8) or LERK-1 (ligands for the
Eph-related kinases) (2). B61 has been found anchored to the plasma
membrane by a glycosylphosphatidylinositol linkage (3) and also in
soluble form (1).
Intestinal epithelial cells express several RPTKs (27), including receptors for EGF and related ligands (34), insulin-like growth factors (20), and FGFs (24). These ligands modulate proliferative activity in intestinal epithelial populations. In addition, intestinal epithelial cells can respond to several cytokines initially recognized to be important in lymphocyte development. Receptors for IL-1, IL-2, IL-4, IL-6, IL-7, IL-9, and IL-15 have also been found on these cells (6, 29, 32, 33). On ligand binding, these latter receptors associate with and activate intracellular nonreceptor kinases.
Despite the demonstration that several RPTKs modulate intestinal epithelial cells, overall understanding of the full range of ligands and receptors that effect exquisite control of these cell populations remains incomplete. Furthermore, it is likely that regulatory molecules produced by other cell types may be important within the intestinal epithelial cell population. In the studies described here, expression and activity of the RPTK Eck and its ligand were assessed in a human intestinal epithelial cell line. In addition, studies were undertaken to assess the interrelationship between Eck and its cognate ligand with the complex network of cytokines and growth factors as well as the functional effects of Eck in intestinal epithelial cells. The present data suggest that the RPTK Eck may be a focal point of complex signaling pathways, linking responses to diverse growth factors and cytokines that regulate differentiation and epithelial cell barrier function.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cytokines and antibodies.
Human recombinant acidic FGF, basic FGF (bFGF), IL-1
, and porcine
platelet transforming growth factor-
1 (TGF-
1) were obtained from
R&D Systems (Minneapolis, MN); human recombinant EGF, IL-2, and
interferon-
from Collaborative Biochemical Products (Bedford, MA);
and IL-7 and IL-15 from Genzyme (Cambridge, MA). B61 and anti-B61 were
generously provided by Dr. R. Lindberg (Amgen, Thousand Oaks, CA; Ref.
1). The anti-B61 polyclonal antiserum was generated using bacterially
expressed human B61 as the antigen (1), and antibodies were affinity
purified using recombinant B61 purified from Chinese hamster ovary cell
culture supernatants. Anti-Eck monoclonal antibodies were obtained by
using the recombinant human Eck extracellular domain (Eck-X; Ref. 1)
and were provided by Dr. R. Lindberg. Affinity-purified rabbit
polyclonal antibodies to a TrpE-Eck-carboxy terminal fusion protein
(21) were used for immunoblotting and immunoprecipitation.
Cell lines and tissue specimens. Caco-2 cells were obtained from the American Type Culture Collection (Rockville, MD) and were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 20% heat-inactivated fetal bovine serum (FBS), 4 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. Cells were grown on six-well plates, on 60- or 100-mm dishes for RNA extraction, protein extraction, or wound assays (see Caco-2 monolayer wound repair), on glass coverslips for immunofluorescence, and on Transwell filters (see Assessment of intestinal epithelial monolayer barrier function) for assessment of epithelial cell barrier function.
Cellular localization of Eck and B61.
Caco-2 cells growing on coverslips were fixed and permeabilized with
acetone at
20°C. After being washed in phosphate-buffered saline (PBS), the coverslips were incubated for 30 min at room temperature in 10% normal goat serum and then incubated for 1 h
simultaneously with anti-Eck (mouse monoclonal) and anti-B61 (rabbit)
antibodies prepared in 10% normal goat serum in PBS. The coverslips
were washed extensively in PBS and then incubated for 1 h at room
temperature with a mixture of rhodamine-conjugated goat anti-rabbit
(1:100) and fluorescein-conjugated goat anti-mouse (1:200) antibodies.
The coverslips were washed extensively with PBS, mounted in Vectashield
(Vector Laboratories, Burlingame, CA), and viewed on an Olympus
microscope equipped with epifluorescence optics. All photographs
represent identical exposures and photographic processing conditions.
Expression of Eck and B61 mRNA. Total RNA from cell lines and tissue specimens was prepared by guanidinium isothiocyanate extraction and cesium chloride ultracentrifugation (4). Ten micrograms of total RNA were separated on 2.2 M formaldehyde-1.2% agarose gels. RNA was transferred to nylon transfer membranes (MSI, Westboro, MA) and ultraviolet crosslinked using a Stratalinker (Stratagene, La Jolla, CA).
Primers for Eck were prepared from the extracellular coding region of the published sequence of the human Eck cDNA (21). A 486-base pair (bp) cDNA fragment of human Eck was produced by polymerase chain reaction (PCR) using the following primers: forward 5' TGGGTGTACCGAGGAGAGG 3' and reverse 5' AGTGCATACGGGGCTCTTCA 3'. A PCR product of the predicted size was purified from agarose gels by electroelution and cloned into PCR-Script SK(+) (Stratagene) according to the manufacturer's instructions. The sequence of the PCR product was confirmed by DNA sequencing. The probe for human B61 was similarly generated by PCR. Primers for B61 were prepared from the carboxy terminal domain of the published sequence of the human B61 cDNA (17). A 501-bp fragment was produced using the following primers: forward 5' ACACCTTTCACCCTGGGCAA 3' and reverse 5' GAGGTGAAGGTGGGGATGG 3'. A PCR product of the predicted size was cloned into PCR-Script SK(+) according to the manufacturer's instructions, and the sequence was confirmed by standard techniques. Both inserts were released from their plasmids by a double digestion with BamH I and Not I. The fragments were electroeluted from agarose gels and used as probes for human B61 and human Eck. The sucrase-isomaltase (SI) probe was kindly provided by Dr. P. Traber, and the dipeptidyl peptidase IV (DPP) probe was a generous gift from Dr. D. Darmoul. Probes were labeled with the Ready to Go kit (Pharmacia, Piscataway, NJ) according to the manufacturer's instructions using [
-32P]dCTP
(specific activity >3,000 Ci/mmol; DuPont NEN, Boston, MA). Membranes
were prehybridized (30 min) and hybridized (90 min) using QuikHyb
solution (Stratagene) at 68°C. The specific activities for the
probe DNAs were ~106
counts · min
1 · ng
1.
After hybridization, the membranes were washed twice for 20 min each in
2× standard saline citrate (SSC; 1× SSC is 0.15 M NaCl and
0.015 M sodium citrate, pH 7.0)-0.1% sodium dodecyl sulfate (SDS) at
37°C and then once in 2× SSC-0.1% SDS at 55°C for 20 min. Hybridization with the human glyceraldehyde-3-phosphate
dehydrogenase-specific cDNA probe
(Pst
I-Xba I 780-bp fragment of plasmid
pHcGAP, no. 57090, ATCC) served as control for mRNA loading.
Stimulation of Eck phosphorylation. In experiments to determine the effects of cytokine stimulation on Eck, Caco-2 cells were cultured in six-well tissue culture plates (Falcon, Becton Dickinson, Lincoln Park, NJ). After reaching confluence, cells were cultured for 10 additional days and then were washed three times with PBS and incubated for 24 h with serum-free DMEM. Cells were washed twice with serum-free DMEM and then incubated in the presence or absence of cytokines and antibodies for 10 min. Cells were rinsed with PBS and then lysed with 1 ml of lysis buffer [20 mM tris(hydroxymethyl)aminomethane (Tris) · HCl, pH 7.8, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 100 µM sodium orthovanadate, 10 mM NaF, 10 µg/ml each of aprotinin, leupeptin, and pepstatin, and 2 mM phenylmethylsulfonyl fluoride (PMSF)]. Eck was immunoprecipitated with rabbit anti-Eck. Immune complexes were collected on protein A Sepharose beads (Pharmacia) and washed five times with lysis buffer. SDS sample buffer was added, and the beads were boiled for 5 min. Proteins were separated by SDS-polyacrylamide gel electrophoresis on 7.5% polyacrylamide gels and transferred at 10°C for 2 h at 50 V to polyvinylidene difluoride membranes (Millipore, Bedford, MA) using transfer buffer consisting of 192 mM glycine and 25 mM Tris. Nonspecific binding was blocked with Tris-buffered saline plus Tween-20 (TTBS; 10 mM Tris · HCl, pH 7.6, 150 mM NaCl, and 0.05% Tween 20) containing bovine serum albumin (BSA, 1%) for 2 h at room temperature. The membrane was then incubated with mouse monoclonal antiphosphotyrosine antibody (4G10, 1 µg/ml; Upstate Biotechnology, Lake Placid, NY) overnight at 4°C. The membrane was washed three times with TTBS and then incubated with sheep anti-mouse immunoglobulin G-horseradish peroxidase conjugate (1:10,000 dilution; Amersham Life Science, Arlington Heights, IL) in TTBS for 1 h at room temperature. After four washes with TTBS, bands were visualized with the enhanced chemiluminescence system (Amersham) as described by the manufacturer. To reprobe, we incubated the membrane for 30 min at 50°C in 62.5 mM Tris · HCl, pH 6.8, 2% SDS, and 100 mM 2-mercaptoethanol. The membrane was then washed extensively.
Cell proliferation. Caco-2 cells were seeded at 104 cells per well in 24-well plates and grown for 48 h in complete medium. Wells were then washed twice with PBS and grown for 48 h in medium containing 0.1% FBS. Medium was removed, and wells were washed with PBS and incubated with 0.01, 0.1, or 1.0 µg/ml B61 in medium containing 0.1% FBS for 48 h. During the final 4 h, 1 µCi of [3H]thymidine was added per well. Incorporated [3H]thymidine was precipitated with 5% trichloroacetic acid and counted in a scintillation counter. [3H]thymidine incorporation in B61-treated cultures was expressed as a percentage of [3H]thymidine incorporation in control cultures.
Assessment of intestinal epithelial monolayer barrier function.
In vitro barrier function was evaluated as the ability of intestinal
epithelial cell monolayers grown in Transwell culture to prevent the
inert compound mannitol from penetrating from the apical to the
basolateral chamber (18). Caco-2 cells were grown to confluence in
serum-containing medium on Transwell filters in 24-well plates
(Corning-Costar, Cambridge, MA, filter pore size 3.0 µm) with an
apical volume of 120 µl and a basolateral volume of 700 µl and then
washed and maintained for 18 h in serum-free medium. B61 (500 ng/ml),
BSA (1 µg/ml), EGF (200 ng/ml), or TGF-
(5 ng/ml) was added to the
basal compartments. In selected experiments, epithelial barrier
function was also assessed in the presence and absence of a standard
injurious agent (18, 19). To induce injury to the monolayers, we added
oleic acid (8 mM final concn) and taurocholic acid (12 mM final concn)
to the apical compartments 1.5 h after the factors were added. After 1 h,
D-[1-3H(N)]mannitol
(DuPont NEN) was added apically to each Transwell at a final activity
of 0.02 µCi/µl. Two hours after the addition of
[3H]mannitol, 15-µl
aliquots were collected from both the apical and basolateral
compartments and the radioactive content was determined by liquid
scintillation counting. Mannitol penetration (in %) was calculated as
the percentage of
[3H]mannitol
(corrected for total volume) in the basolateral (lower) compartment in
relation to the total amount of
[3H]mannitol added to
the apical (upper) compartment. Permeability experiments were carried
out in triplicate.
Caco-2 monolayer wound repair. Before use, reference lines were drawn horizontally across the outer bottom of a six-well plate. Caco-2 cells were seeded into the wells and grown to confluence, then starved in serum-free medium for 24 h. Using a sterile plastic pipette tip, we made linear "wounds" by scoring the wells perpendicular to the lines on the bottom of the well. Using the lines on the bottom of the well as reference points, we measured the size of the wounds with a micrometer at predetermined locations. The closure of the wounds could be reliably measured microscopically at ×40 over time, and the speed of the wound closure could be calculated.
Statistics. Data are expressed as means ± SE. Statistical significance between different groups was evaluated using Wilcoxon's test (23).
| |
RESULTS |
|---|
|
|
|---|
Eck and B61 mRNA are present in normal human colon and colon cancer. The Eck RPTK and its ligand have been identified within tissues containing epithelial populations. Eck and B61 mRNA were readily detectable in biopsy samples from pairs of human colon cancer and normal colonic tissue (Fig. 1). The demonstration of Eck and B61 mRNA in human colonic biopsy specimens prompted studies to determine the functional role of the Eck receptor-ligand complex in the regulation of intestinal epithelial cells.
|
Eck and B61 proteins are colocalized in intestinal epithelial cell lines. After the observation that both Eck and B61 mRNA were found in relative abundance in human colonic tissue biopsies, immunofluorescence was performed on Caco-2 cells to assess the distribution of the Eck receptor and its ligand in the cell monolayer. As shown in Fig. 2, Eck and B61 were frequently present within the same cells. Each exhibited a distinctive pattern of subcellular localization. When cells were examined in the same focal plane, Eck appeared to be present predominantly in areas of cell-cell contact (Fig. 2A). In contrast, B61 localized to areas slightly removed from the contact zone (Fig. 2B).
|
Caco-2 cells express Eck and B61 mRNA. Caco-2 cells, a line derived from a human colon cancer, spontaneously differentiate ~2 wk after reaching confluence (15). In initial studies, expression of mRNA transcripts for Eck and B61 was assessed by Northern blot analysis. The comparative expression of B61 and Eck does not appear to be simply reciprocal. As demonstrated in Fig. 3, high levels of Eck were present in subconfluent Caco-2 cells (days 4 and 6 in culture). As the cells reached confluence (~day 7), these levels progressively decreased. In contrast, B61 mRNA was present at low levels in Caco-2 cells before confluence but increased steadily once the cells reached confluence. Eck mRNA levels transiently peak between days 4 and 8 postconfluence, during which time B61 levels remain constant. Similarly, although B61 mRNA increases between 8 and 10 days postconfluence, Eck mRNA levels remain steady. However, after extended periods in culture (>10 days) Eck mRNA levels fall, whereas B61 levels increase. In summary, the results shown in Fig. 3 suggest that B61 is interrelated with Eck expression. As B61 mRNA levels rise, Eck mRNA levels decrease.
|
B61 and EGF modulate Caco-2 cell differentiation. Caco-2 cells provide a relevant model for studying characteristics and mechanisms of epithelial cell differentiation in vitro. Enterocyte differentiation is associated with expression of a wide variety of enzymes including disaccharidases, aminopeptidase N, DPP, cytochrome P-450IIB1, as well as fatty acid-binding proteins (15, 30, 35). Caco-2 cells express these differentiation-associated genes in conjunction with the acquisition of morphological features of differentiated enterocytes, e.g., microvilli on the apical surface.
To examine the effect of B61 and EGF on Caco-2 cell differentiation, cells were cultured for 21 days in the presence or absence of exogenously added soluble B61 or EGF. At varying intervals, RNA was collected from these cells and the mRNA levels of SI and DPP were determined by Northern blot. Treatment with B61 (Fig. 4A) or EGF (Fig. 4B) altered the normal pattern of expression of these differentiation markers. Although expression of SI could be detected in untreated cells 10 days after the cells became confluent, it was undetectable in B61-treated cells and barely detectable in EGF-treated cells (Fig. 4, A and B). Expression of DPP, another marker of enterocyte differentiation, was also inhibited by both B61 and EGF treatment (data not shown). Inhibition was most pronounced after 14 days in culture. Thus stimulation with B61 or EGF resulted in the altered expression of the enterocyte markers SI and DPP, suppressing expression of signs of differentiation in Caco-2 cells.
|
Eck and B61 mRNAs are regulated by diverse cytokines.
Recent observations have suggested that cytokines may play key roles in
regulating intestinal epithelial cell function. To understand the
interactions between immune modulatory cytokines and RPTKs, the effects
of cytokines on the expression of Eck and B61 were assessed in Caco-2
cells maintained in a confluent state for 7 days and cultured in
serum-free medium for 16 h before the addition of cytokines and growth
factors. Eck and B61 transcripts were detectable in unstimulated Caco-2
cells. As demonstrated in Fig. 5, Eck and
B61 mRNA expression was significantly regulated by several cytokines.
IL-2, IL-1
, and the growth factor EGF stimulated rapid expression of
Eck mRNA. Peak Eck mRNA accumulation was achieved within 2 h of
stimulation and then gradually returned to unstimulated levels by 8 h
and remained at unstimulated levels at 24 h. In contrast, B61 mRNA
levels were initially downregulated within 2 h in response to EGF,
IL-2, and IL-1
. This was followed by a delayed increase in B61
expression observed at 8 h after addition of these factors.
|
and bFGF, factors that have
been previously shown to enhance intestinal epithelial restitution (5,
9, 10), led to a biphasic response in B61 expression. After the
addition of these factors, B61 expression was downregulated within 2 h
(Fig. 5). Culture with these factors for 24 h produced transcript
levels equal to (TGF-
) or greater than (bFGF) those seen in
unstimulated cells. In parallel, TGF-
caused slight downregulation
and bFGF resulted in gradual upregulation of Eck. These findings
suggest that expression of both B61 and Eck is regulated by cytokines.
Phosphorylation of Eck is modulated by cytokines.
To further define the interrelationship between cytokine regulation of
intestinal epithelial cells and the functional activation of Eck, the
effects of cytokine stimulation on Eck phosphorylation were examined.
Caco-2 cells that had been maintained in a confluent state for 7 days
were incubated in serum-free medium for 16 h and then stimulated with
cytokines and growth factors. Eck was immunoprecipitated from lysates
prepared from unstimulated and stimulated cells. Exogenous B61 led to
increased levels of Eck phosphorylation (Fig.
6A,
lane
2, and Fig.
6B,
lane
2). As shown in Fig.
6A, a 10-min stimulation of Caco-2
cells with IL-2 (100 µ/ml; Fig. 6A,
lane
3) slightly increased Eck
phosphorylation, whereas EGF (100 ng/ml; Fig.
6A,
lane
4) and IL-15 (100 ng/ml; Fig.
6C,
lane
2) led to marked phosphorylation of
Eck. In all experiments, Eck was constitutively
phosphorylated in unstimulated cells. Eck often appears as a doublet.
After a 20-min stimulation with IL-15, Eck phosphorylation levels
decreased but remained above the levels seen in unstimulated cells
(Fig. 6C,
lane
3). In contrast to the effects of
B61, IL-2, IL-15, and EGF, TGF-
treatment (Fig.
6B,
lane
3) suppressed Eck phosphorylation to levels below those found in unstimulated cells (Fig.
6B,
lane 1). In aggregate, these results
suggest that tyrosine phosphorylation indicative of Eck activation is
regulated by diverse cytokines.
|
Cell proliferation. Many RPTKs mediate proliferative responses in cells. To determine whether the Eck receptor regulated proliferation of Caco-2 cells, the effects of soluble B61 addition were assessed. Results of a representative experiment are shown in Fig. 7. Exogenous B61 (0.1 and 1.0 µg/ml) increased uptake of [3H]thymidine (P = 0.007 and 0.004, respectively, relative to control, untreated cells), although a lower concentration (0.01 µg/ml) had no effect.
|
B61 promotes intestinal epithelial barrier function. To date there have been no reports on the function of the Eck-B61 interaction in epithelial cells. In an endothelial cell system B61 promoted angiogenesis in vivo and chemoattraction of endothelial cells in vitro (26). An essential role of mucosal epithelial cells is to function as a barrier (28). Previous studies confirmed that many cytokines lead to modulation of epithelial migration and barrier function (5, 7, 9, 22). With the demonstration that the same spectrum of peptides modulating barrier function also regulated Eck phosphorylation, the role of Eck stimulation in this critical functional property was evaluated. To assess the effects of B61 on epithelial barrier function, penetration of the inert marker [3H]mannitol through confluent monolayers of Caco-2 cells was evaluated.
Permeability studies were performed with Caco-2 cells as shown in Fig. 8A. When B61 was added to the basolateral compartment, the permeability was substantially lower than in untreated monolayers, reflecting enhanced barrier function (0.32 ± 0.09 vs. 0.65 ± 0.35%; P = 0.018).
|
B61 promotes Caco-2 monolayer restitution.
The role of B61 was examined in an in vitro wound healing/restitution
assay using Caco-2 cells. This assay recapitulates "restitution," a process that is critical for the initial healing of the epithelial barrier in the gastrointestinal tract. The migration of the cell monolayer after wounding was measured in response to stimulation with
exogenously added B61 or EGF and TGF-
, peptide growth factors known
to enhance intestinal epithelial restitution (9). Results shown in Fig.
9 indicate that B61 stimulated Caco-2 cell
restitution at 48 h after wounding compared with untreated cells (219.3 ± 23.1 vs. 165.2 ± 19.7; P = 0.01). In this assay, the magnitude of the response to B61 was similar
to that observed with TGF-
, a factor previously found to play a
pivotal role in promoting wound healing.
|
| |
DISCUSSION |
|---|
|
|
|---|
The surface epithelia of the small and large intestine are highly regulated by a network of peptides, including those conventionally designated as growth factors and those identified as cytokines. In this study, Caco-2 cells were used to evaluate the functional importance of the receptor Eck and its ligand B61 in modulating intestinal epithelial cell functions. We show that the Eck-B61 interaction may play an important role during intestinal epithelial cell growth and differentiation.
The normal adult colonic epithelium expresses both B61 and its receptor Eck. In the present study, the model intestinal epithelial cell line Caco-2 was found to coexpress both the ligand B61 and its receptor Eck. Colocalization of Eck and B61 in the same cell as demonstrated by immunocytochemistry is suggestive of an autocrine loop. This inference is further supported by the finding that Eck was constitutively phosphorylated in Caco-2 cells (Fig. 6), presumably by in situ B61 stimulation. In the present studies, B61 added to subconfluent Caco-2 cells elicited a proliferative response. The effect of exogenous B61 appears to depend on the conditions and cell line used. B61 increased growth rates of two melanoma cell lines (12) but had no effect on the growth rate of normal melanocytes. B61 also has been reported to have no effect on the mitogenesis of cultured endothelial cells (26).
Peptide growth factors with divergent effects on proliferation,
exemplified by EGF and TGF-
, were found to regulate Eck at the
levels of both transcription and receptor activation. EGF treatment led
to increased steady-state levels of Eck mRNA and also resulted in
increased phosphorylation of Eck. In contrast, Eck mRNA levels were
reduced in response to TGF-
stimulation and there was marked
reduction of Eck phosphorylation in response to this factor.
Recent studies have demonstrated that intestinal epithelial cells
express receptors for several regulatory peptides collectively designated as cytokines that were previously thought to have a range of
activities largely confined to the immune system. Human intestinal
epithelial cell lines and isolated primary intestinal epithelial cells
express functional transcripts for IL-2, IL-4, IL-7, IL-9, and IL-15
that share the
c-subunit in their receptor complexes (6, 29). The
cytokine ligands of these receptors are secreted by a wide variety of
cell populations, especially cellular components of the immune and
inflammatory responses. Thus stimulation by growth factors results in
counterbalancing effects on Eck, supporting the hypothesis that Eck may
serve as a focal point through which diverse regulatory molecules
modulate intestinal epithelial cells.
The colon cancer-derived cell line Caco-2 has been widely utilized as an enterocyte model because of its ability to recapitulate enterocyte differentiation after achieving confluence in vitro (30). This is exemplified by expression of SI in association with the acquisition of the morphological features of the enterocyte phenotype, e.g., apical microvilli. The expression of SI has often been used as a marker of cellular differentiation in this cell line (35). Addition of B61 suppressed expression of SI in a manner similar to that observed for EGF, a factor that promotes continued proliferation precluding differentiation. These findings suggest that B61 inhibits the differentiation of Caco-2 cells, keeping them in a proliferative competent state.
In addition to their effects on Eck, cytokines regulate the state of
this receptor through concomitant effects on the expression of its
ligand B61, thus modulating autocrine and juxtacrine Eck stimulation.
It is notable that in the epithelial cell line used in the present
study, IL-1
treatment resulted in a decrease in B61 mRNA levels.
This contrasts with the previously reported response of endothelial
cells to IL-1
(11), in which B61 mRNA levels were very rapidly
upregulated after stimulation with IL-1
. This observation
demonstrates that B61 may be variably regulated among different cell
types.
Most importantly, the present studies suggest that activation of Eck can substantially enhance the integrity of intestinal epithelial monolayers. In addition to performing secretory and absorptive functions, the intestinal epithelium forms a continuous barrier at the mucosal surface. Maintaining this barrier is essential to prevent the penetration of the complex mixtures of bacteria, their products, and other luminal substances. The present studies provide the first evidence that Eck receptor pathways may function to decrease permeability through paracellular pathways with the demonstration that B61 treatment reduces apical-to-basolateral penetration of inert markers through intestinal epithelial monolayers. Furthermore, activation of Eck by B61 also facilitates repair of the epithelial barrier after injury using in vitro models. Previous studies have indicated that healing after injury of the mucosal surface is accomplished by rapid migration and spreading of epithelial cells from the wound edge, a process designated restitution. Enhanced proliferation caused by B61 treatment could also contribute to this observation.
Past work in this laboratory and elsewhere has demonstrated that the same cytokines that modulate expression and activation of Eck facilitate epithelial migration and wound repair, mechanisms that reestablish continuity of the epithelium after injury. These cytokines are produced by lamina propria and epithelial cells after injury, resulting in activation of immune and inflammatory responses. Eck activation is a common feature of regulatory peptides, promoting restitution as a concerted response to mucosal damage. With the observation that Eck activation leads to further tightening of barrier function of even intact monolayers, presumably by modulating tight junctions, delineation of the pathways through which this is achieved should provide insight into the physiological regulation of cell-cell junctions and the mechanisms of mucosal repair.
| |
ACKNOWLEDGEMENTS |
|---|
The anti-Eck antibodies were generously provided by Dr. R. Lindberg, Amgen.
| |
FOOTNOTES |
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-41552 and DK-43351 (D. K. Podolsky) and DK-51003 (H.-C. Reinecker) and by a Crohn's and Colitis Foundation of America research grant to H.-C. Reinecker.
Address for reprint requests: D. K. Podolsky, Gastrointestinal Unit, Massachusetts General Hosp., Jackson 715, Boston, MA 02114.
Received 17 October 1996; accepted in final form 19 June 1997.
| |
REFERENCES |
|---|
|
|
|---|
1.
Bartley, T. D.,
R. W. Hunt,
A. A. Welcher,
W. J. Boyle,
V. P. Parker,
R. A. Lindberg,
H. S. Lu,
A. M. Colombero,
R. L. Elliott,
B. A. Guthrie,
P. L. Holst,
J. D. Skrine,
R. J. Toso,
M. Zhang,
E. Fernandez,
G. Trail,
B. Varnum,
Y. Yarden,
T. Hunter,
and
G. M. Fox.
B61 is a ligand for the ECK receptor protein-tyrosine kinase.
Nature
368:
558-560,
1994[Medline].
2.
Beckmann, M. P.,
D. P. Cerretti,
P. Baum,
T. Vandenbos,
L. James,
T. Farrah,
C. Kozlosky,
T. Hollingsworth,
H. Shilling,
E. Maraskovsky,
F. A. Fletcher,
V. Lhotak,
T. Pawson,
and
S. D. Lyman.
Molecular characterization of a family of ligands for Eph-related tyrosine kinase receptors.
EMBO J.
13:
3757-3762,
1994[Medline].
3.
Cheng, H.-J.,
and
J. G. Flanagan.
Identification and cloning of ELF-1, a developmentally expressed ligand for the Mek4 and Sek receptor tyrosine kinases.
Cell
79:
157-168,
1994[Medline].
4.
Chirgwin, J. M.,
A. E. Przybyla,
R. J. MacDonald,
and
W. J. Rutter.
Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease.
Biochemistry
18:
5294-5299,
1979[Medline].
5.
Ciacci, C.,
S. E. Lind,
and
D. K. Podolsky.
Transforming growth factor
regulation of migration in wounded rat intestinal epithelial monolayers.
Gastroenterology
105:
93-101,
1993[Medline].
6.
Ciacci, C.,
Y. R. Mahida,
A. Dignass,
M. Koizumi,
and
D. K. Podolsky.
Functional interleukin-2 receptors on intestinal epithelial cells.
J. Clin. Invest.
92:
527-532,
1993.
7.
Colgan, S. P.,
M. B. Resnick,
C. A. Parkos,
C. Delp-Archer,
D. McGuirk,
A. E. Bacarra,
P. F. Weller,
and
J. L. Madara.
IL-4 directly modulates function of a model human intestinal epithelium.
J. Immunol.
153:
2122-2129,
1994[Abstract].
8.
Davis, S.,
N. W. Gale,
T. H. Aldrich,
P. C. Maisonpierre,
V. Lhotak,
T. Pawson,
M. Goldfarb,
and
G. D. Yancopoulos.
Ligands for EPH-related receptor tyrosine kinases that require membrane attachement or clustering for activity.
Science
266:
816-819,
1994
9.
Dignass, A. U.,
and
D. K. Podolsky.
Cytokine modulation of intestinal epithelial cell restitution: central role of transforming growth factor
.
Gastroenterology
103:
1323-1332,
1993.
10.
Dignass, A. U.,
S. Tsunikawa,
and
D. K. Podolsky.
Fibroblast growth factors modulate intestinal epithelial cell growth and migration.
Gastroenterology
106:
1254-1262,
1994[Medline].
11.
Dixit, V. M.,
S. Green,
V. Sarma,
L. B. Holzman,
F. W. Wolf,
K. O'Rourke,
P. A. Ward,
E. V. Prochownik,
and
R. M. Marks.
Tumor necrosis factor-
induction of novel gene products in human endothelial cells including a macrophage-specific chemotoxin.
J. Biol. Chem.
265:
2973-2978,
1990
12.
Easty, D. J.,
B. A. Guthrie,
K. Maung,
C. J. Farr,
R. A. Lindberg,
R. J. Toso,
M. Herlyn,
and
D. C. Bennett.
Protein B61 as a new growth factor: expression of B61 and up-regulation of its receptor epithelial cell kinase during melanoma progression.
Cancer Res.
55:
2528-2532,
1995
13.
Fox, G. M.,
P. L. Holst,
H. T. Chute,
R. A. Lindberg,
A. M. Janssen,
R. Basu,
and
A. A. Welcher.
cDNA cloning and tissue distribution of five human EPH-like receptor protein-tyrosine kinases.
Oncogene
10:
897-905,
1995[Medline].
14.
Hanks, S. K.,
and
A. M. Quinn.
Protein kinase catalytic domain sequence database: identification of conserved features of primary structure and classification of family members.
Methods Enzymol.
200:
38-81,
1991[Medline].
15.
Hauri, H.-P.,
E. E. Sterchi,
D. Bienz,
J. A. M. Fransen,
and
A. Marxer.
Expression and intracellular transport of microvillus membrane hydrolases in human intestinal epithelial cells.
J. Cell Biol.
101:
838-851,
1985
16.
Hirai, H.,
Y. Maru,
K. Hagiwara,
J. Nishida,
and
F. Takaku.
A novel putative tyrosine kinase receptor encoded by the eph gene.
Science
38:
1717-1720,
1987.
17.
Holzman, L. B.,
R. M. Marks,
and
V. M. Dixit.
A novel immediate-early response gene in endothelium is induced by cytokines and encodes a secreted protein.
Mol. Cell. Biol.
10:
5830-5838,
1990
18.
Ishikawa, S.,
G. Cepinskas,
D. Specian,
M. Itoh,
and
P. R. Kvietys.
Epidermal growth factor attenuates jejunal mucosal injury induced by oleic acid: role of mucus.
Am. J. Physiol.
267 (Gastrointest. Liver Physiol. 30):
G1067-G1077,
1994
19.
Kindon, H.,
C. Pothoulakis,
L. Thim,
K. Lynch-Devaney,
and
D. K. Podolsky.
Trefoil peptide protection of intestinal epithelial barrier function: cooperative interaction with mucin glycoprotein.
Gastroenterology
109:
516-523,
1995[Medline].
20.
Laburthe, M.,
C. Rouyer-Fessard,
and
S. Gammeltoft.
Receptors for insulin-like growth factors I and II in rat gastrointestinal epithelium.
Am. J. Physiol.
254 (Gastrointest. Liver Physiol. 17):
G457-G462,
1988
21.
Lindberg, R. A.,
and
T. Hunter.
cDNA cloning and characterization of eck, an epithelial cell receptor protein-tyrosine kinase in the eph/elk family of protein kinases.
Mol. Cell. Biol.
10:
6316-6324,
1990
22.
Madara, J. L.,
and
J. Stafford.
Interferon-
directly affects barrier function of cultured intestinal epithelial monolayers.
J. Clin. Invest.
83:
724-732,
1989.
23.
Mendenhall, W.
(Editor).
Introduction to Probability and Statistics. Boston, MA: PWS, 1987, p. 727-780.
24.
Murgue, B.,
S. Tsunekawa,
I. Rosenberg,
M. deBeaumont,
and
D. K. Podolsky.
Identification of a novel variant form of fibroblast growth factor receptor 3 (FGFR3 IIIb) in human colonic epithelium.
Cancer Res.
54:
5206-5211,
1994
25.
Pandey, A.,
R. A. Lindberg,
and
V. M. Dixit.
Receptor orphans find a family.
Curr. Biol.
5:
986-989,
1995[Medline].
26.
Pandey, A.,
H. Shao,
R. M. Marks,
P. J. Polverini,
and
V. M. Dixit.
Role of B61, the ligand for the Eck receptor tyrosine kinase in TNF-
induced angiogenesis.
Science
268:
567-569,
1995
27.
Podolsky, D. K.
Peptide growth factors in the gastrointestinal tract.
In: Physiology of the Gastrotintestinal Tract (3rd ed.), edited by L. R. Johnson. New York: Raven, 1994, p. 129-168.
28.
Powell, D. W.
Barrier function of epithelia.
Am. J. Physiol.
241 (Gastrointest. Liver Physiol. 4):
G275-G288,
1981
29.
Reinecker, H.-C.,
and
D. K. Podolsky.
Human intestinal epithelial cells express functional cytokine receptors sharing the common
c chain of the interleukin 2 receptor.
Proc. Natl. Acad. Sci. USA
92:
8353-8357,
1995
30.
Rousset, M.,
M. Laburthe,
M. Pinto,
G. Chevalier,
C. Rouyer-Fessard,
E. Dussaulx,
G. Trugnan,
N. Boige,
J. L. Brun,
and
A. Zweibaum.
Enterocytic differentiation and glucose utilization in the human colon tumor cell line Caco-2: modulation by forskolin.
J. Cell. Physiol.
123:
377-385,
1985[Medline].
31.
Ruiz, J. C.,
and
E. J. Robertson.
The expression of the receptor-protein tyrosine kinase gene, eck, is highly restricted during early mouse development.
Mech. Dev.
46:
87-100,
1994[Medline].
32.
Shirota, K.,
L. LeDuy,
S. Y. Yuan,
and
S. Jothy.
Interleukin-6 and its receptor are expressed in human intestinal epithelial cells.
Virchows Arch.
58:
303-308,
1990.
33.
Sutherland, D. B.,
G. W. Varilek,
and
G. A. Neil.
Identification and characterization of the rat intestinal epithelial cell (IEC-18) interleukin-1 receptor.
Am. J. Physiol.
266 (Cell Physiol. 35):
C1198-C1203,
1994
34.
Thompson, J. F.
Specific receptor for epidermal growth factor in rat intestinal microvillus membranes.
Am. J. Physiol.
254 (Gastrointest. Liver Physiol. 17):
G429-G435,
1988
35.
Van Beers, E. H.,
R. H. Al,
E. H. H. M. Rings,
A. W. C. Einerhand,
J. Dekker,
and
H. A. Buller.
Lactase and sucrase-isomaltase gene expression during Caco-2 cell differentiation.
Biochem. J.
308:
769-775,
1995.
36.
Van der Geer, P.,
T. Hunter,
and
R. A. Lindberg.
Receptor protein-tyrosine kinases and their signal transduction pathways.
Annu. Rev. Cell Biol.
10:
251-337,
1994.
This article has been cited by other articles:
![]() |
C. Baldwin, Z. W. Chen, A. Bedirian, N. Yokota, S. H. Nasr, H. Rabb, and S. Lemay Upregulation of EphA2 during in vivo and in vitro renal ischemia-reperfusion injury: role of Src kinases Am J Physiol Renal Physiol, November 1, 2006; 291(5): F960 - F971. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. I. Ivanov, A. A. Steiner, A. C. Scheck, and A. A. Romanovsky Expression of Eph receptors and their ligands, ephrins, during lipopolysaccharide fever in rats Physiol Genomics, April 14, 2005; 21(2): 152 - 160. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Walker-Daniels, A. R. Hess, M. J.C. Hendrix, and M. S. Kinch Differential Regulation of EphA2 in Normal and Malignant Cells Am. J. Pathol., April 1, 2003; 162(4): 1037 - 1042. [Full Text] [PDF] |
||||
![]() |
M. S. Kinch, M.-B. Moore, and D. H. Harpole Jr. Predictive Value of the EphA2 Receptor Tyrosine Kinase in Lung Cancer Recurrence and Survival Clin. Cancer Res., February 1, 2003; 9(2): 613 - 618. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Walker-Daniels, D. J. Riese II, and M. S. Kinch c-Cbl-Dependent EphA2 Protein Degradation Is Induced by Ligand Binding Mol. Cancer Res., November 1, 2002; 1(1): 79 - 87. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Carles-Kinch, K. E. Kilpatrick, J. C. Stewart, and M. S. Kinch Antibody Targeting of the EphA2 Tyrosine Kinase Inhibits Malignant Cell Behavior Cancer Res., May 1, 2002; 62(10): 2840 - 2847. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Hess, E. A. Seftor, L. M. G. Gardner, K. Carles-Kinch, G. B. Schneider, R. E. B. Seftor, M. S. Kinch, and M. J. C. Hendrix Molecular Regulation of Tumor Cell Vasculogenic Mimicry by Tyrosine Phosphorylation: Role of Epithelial Cell Kinase (Eck/EphA2) Cancer Res., April 1, 2001; 61(8): 3250 - 3255. [Abstract] [Full Text] |
||||
![]() |
D. P. Zelinski, N. D. Zantek, J. C. Stewart, A. R. Irizarry, and M. S. Kinch EphA2 Overexpression Causes Tumorigenesis of Mammary Epithelial Cells Cancer Res., March 1, 2001; 61(5): 2301 - 2306. [Abstract] [Full Text] |
||||
![]() |
D. S. Han, F. Li, L. Holt, K. Connolly, M. Hubert, R. Miceli, Z. Okoye, G. Santiago, K. Windle, E. Wong, et al. Keratinocyte growth factor-2 (FGF-10) promotes healing of experimental small intestinal ulceration in rats Am J Physiol Gastrointest Liver Physiol, November 1, 2000; 279(5): G1011 - G1022. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. H. Cho, D. L. Nicolae, R. Ramos, C. T. Fields, K. Rabenau, S. Corradino, S. R. Brant, R. Espinosa, M. LeBeau, S. B. Hanauer, et al. Linkage and linkage disequilibrium in chromosome band 1p36 in American Chaldeans with inflammatory bowel disease Hum. Mol. Genet., May 22, 2000; 9(9): 1425 - 1432. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Eckmann, J. R. Smith, M. P. Housley, M. B. Dwinell, and M. F. Kagnoff Analysis by High Density cDNA Arrays of Altered Gene Expression in Human Intestinal Epithelial Cells in Response to Infection with the Invasive Enteric Bacteria Salmonella J. Biol. Chem., May 5, 2000; 275(19): 14084 - 14094. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. D. Zantek, M. Azimi, M. Fedor-Chaiken, B. Wang, R. Brackenbury, and M. S. Kinch E-Cadherin Regulates the Function of the EphA2 Receptor Tyrosine Kinase Cell Growth Differ., September 1, 1999; 10(9): 629 - 638. [Abstract] [Full Text] |
||||
![]() |
D. K. Podolsky V. Innate mechanisms of mucosal defense and repair: the best offense is a good defense Am J Physiol Gastrointest Liver Physiol, September 1, 1999; 277(3): G495 - G499. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Nishiyama, T. Sakaguchi, T. Kinugasa, X. Gu, R. P. MacDermott, D. K. Podolsky, and H.-C. Reinecker Interleukin-2 Receptor beta Subunit-dependent and -independent Regulation of Intestinal Epithelial Tight Junctions J. Biol. Chem., September 14, 2001; 276(38): 35571 - 35580. [Abstract] |