Vol. 274, Issue 1, G157-G169, January 1998
Expression and transport properties of the human ileal and
renal sodium-dependent bile acid transporter
Ann L.
Craddock,
Martha W.
Love,
Rebecca W.
Daniel,
Lyndon C.
Kirby,
Holly C.
Walters,
Melissa H.
Wong, and
Paul A.
Dawson
Department of Internal Medicine, Division of Gastroenterology,
Bowman Gray School of Medicine, Wake Forest University,
Winston-Salem, North Carolina 27157
 |
ABSTRACT |
The enterohepatic
circulation of bile acids is maintained by
Na+-dependent transport
mechanisms. To better understand these processes, a full-length human
ileal Na+-bile acid cotransporter
cDNA was identified using rapid amplification of cDNA ends and genomic
cloning techniques. Using Northern blot analysis to determine its
tissue expression, we readily detected the ileal
Na+-bile acid cotransporter mRNA
in terminal ileum and kidney. Direct cloning and mapping
of the transcriptional start sites confirmed that the kidney cDNA was
identical to the ileal Na+-bile
acid cotransporter. In transiently transfected COS cells, ileal
Na+-bile acid
cotransporter-mediated taurocholate uptake was strictly Na+ dependent and chloride
independent. Analysis of the substrate specificity in transfected COS
or CHO cells showed that both conjugated and unconjugated bile acids
are efficiently transported. When the inhibition constants for other
potential substrates such as estrone-3-sulfate were determined, the
ileal Na+-bile acid cotransporter
exhibited a narrower substrate specificity than the related liver
Na+-bile acid cotransporter.
Whereas the multispecific liver
Na+-bile acid cotransporter may
participate in hepatic clearance of organic anion metabolites and
xenobiotics, the ileal and renal Na+-bile acid cotransporter
retains a narrow specificity for reclamation of bile acids.
ileal transport; hepatic transport; bile acids; taurocholate; ursodeoxycholate; sulfated bile acids
 |
INTRODUCTION |
BILE ACIDS ARE SYNTHESIZED from cholesterol in the
liver and secreted into the small intestine, where they facilitate the absorption of fat-soluble vitamins and cholesterol (6). The majority of
bile acids are efficiently reabsorbed from the intestine and returned
to the liver via the portal venous circulation. At the liver, bile
acids are extracted and resecreted into bile (7). A fraction
(10-50% depending on the bile acid species) of the absorbed bile
acids escapes hepatic uptake from the portal blood and spills over into
the systemic circulation. The binding of bile acids to plasma proteins
prevents their glomerular filtration and minimizes urinary excretion.
In addition, bile acids in the glomerular filtrate are actively
reabsorbed from the renal tubules and returned to the liver for uptake
(27, 31). Thus the amount of bile acid filtered through the glomerulus
exceeds urinary excretion, and this process may contribute to the
increased concentration of bile acids found in peripheral blood during
obstructive liver disease (18).
Active uptake of bile acids from both the ileum and kidney is mediated
by an Na+-gradient driven
transporter located on the epithelial apical membrane (6, 31). As in
the ileum, bile acid transport in the renal proximal tubules is thought
to act as a salvage mechanism to conserve bile acids. The relationship
between the hepatic, ileal, and renal
Na+-bile acid cotransport systems
has only recently been resolved with the cloning of the bile acid
carriers from those tissues (4). The liver and ileal
Na+-bile acid cotransporters are
related gene products that share 35% sequence identity and are
predicted to be structurally similar (13, 32). In contrast, the ileal
and renal carriers appeared to be products of the same gene based on
Northern blotting studies in the hamster (32) and rat (22). This
finding was subsequently confirmed in a study of the ontogeny of ileal
and renal bile acid transport that demonstrated the expression of both
ileal Na+-bile acid cotransporter
mRNA and protein in rat kidney (3).
We have previously cloned a partial cDNA encompassing the entire coding
region for the human ileal
Na+-bile acid cotransporter (33)
and analyzed inherited mutations associated with primary bile acid
malabsorption (14). Whereas the ileal
Na+-bile acid cotransporter has
been cloned from a number of different species (4), a full-length clone
has not been described. This is due in part to the large size of the
message, ~4.0 kb in the hamster (32) and 5.0 kb in the rat (22),
which far exceeds the 1,047-nucleotide coding region. In addition,
although previous studies in rodents have shown ileal
Na+-bile acid cotransporter mRNA
expression in the ileum, kidney, cecum, and colon (22, 32) and liver
Na+-bile acid cotransporter mRNA
expression in liver and kidney (13), there is no information on the
tissue expression of these carriers in humans. In this study, we
describe the cloning of the full-length human ileal
Na+-bile acid cotransporter cDNA
and compare its human tissue expression with the related liver
Na+-bile acid cotransporter NTCP
(13).
The transport kinetics and specificity of
Na+-bile acid cotransport have
been examined in everted gut sacs, isolated ileal enterocytes, and
ileal brush-border membranes from a variety of species (6, 11, 30).
However, there is a paucity of information on the human ileal
Na+-bile acid cotransporter (1,
10). The identification of the Na+-bile acid cotransporters from
human liver (13) and ileum (33) makes it possible to determine their
transport properties in the absence of other potential bile acid
carriers by expression in transfected cells. In this study, the ion
dependence and substrate specificity of the ileal and renal
Na+-bile acid cotransporter were
analyzed in transiently transfected COS and stably transfected CHO
cells. In contrast to the multispecific liver
Na+-bile acid cotransporter (13),
these studies indicate that the ileal and renal
Na+-bile acid cotransporter
retains a narrow substrate specificity for the reclamation of bile
acids.
 |
MATERIALS AND METHODS |
Materials. Human ileum (obtained
within 10 cm of the ileocecal valve), cecum, and kidney tissue samples
were obtained from surgical specimens excised as a result of colon
carcinoma, inflammatory bowel disease, or kidney carcinoma. Only normal
tissues, as identified by the attending pathologist, were used for RNA
isolation. Human liver (obtained from liver donors) was kindly provided
by Dr. Benjamin Shneider (Department of Pediatrics, Mount Sinai School of Medicine). Tissues were frozen in liquid
N2 and stored at
70°C until use.
[3H]taurocholic acid
(2.0-3.47 Ci/mmol),
[2,4-3H]cholate (27.5 Ci/mmol),
[6,7-3H]estrone
sulfate (47.9-49.0 Ci/mmol),
[carboxyl-14C]chenodeoxycholic
acid (48.6 mCi/mmol), and
[1-14C]glycine ethyl
ester hydrochloride (43.3 mCi/mmol) were purchased from NEN Research
Products (Wilmington, DE). Chenodeoxycholic acid, ursodeoxycholic acid,
and unlabeled bile acid glycine conjugates used as standards during
thin-layer chromatography analysis were purchased from Calbiochem (La
Jolla, CA). Other unlabeled bile acids were purchased from Sigma
Chemical (St. Louis, MO). Bilirubin ditaurate conjugate was purchased
from Calbiochem. Triethylamine, N-ethoxycarbonyl-2-ethoxy-1,2-dihydroquinoline,
and glycine ethyl ester hydrochloride were purchased from Aldrich
Chemical (Milwaukee, WI). The
14C-labeled glycine conjugates of
chenodeoxycholic acid, deoxycholic acid, and ursodeoxycholic acid were
prepared as described (25). Purity of the final products was determined
by thin-layer chromatography using a solvent system composed of
chloroform/methanol/acetic acid (80:5:5). Chenodeoxycholate-3-sulfate
and
[14C]chenodeoxycholate-3-sulfate
were kindly provided by Dr. Leon Lack (Department of Pharmacology, Duke
University). Cyclosporin A was provided by Dr. Eugene Heise (Department
of Microbiology, Bowman Gray School of Medicine).
General methods. Total cellular RNA
was isolated by the guanidinium isothiocyanate-CsCl centrifugation
procedure. Poly(A) RNA was isolated using oligo(dT)-cellulose spin
columns from Pharmacia-LKB Biotechnology (Piscataway, NJ). For Northern
blot analysis, poly(A) RNA was fractionated on 1.2% (wt/vol) agarose
gels containing 2.2 M formaldehyde and transferred to Nytran (0.45 µm; Schleicher & Schuell, Keene, NH).
32P-labeled M13 or random
hexamer-primed DNA probes for Northern blot hybridization
(random-primed DNA labeling kit; Boehringer Mannheim, Indianapolis, IN)
were synthesized using 3,000 Ci/mmol [
-32P]dCTP
(Amersham, Arlington Heights, IL).
Genomic cloning and identification of human ileal
Na+-bile
acid cotransporter cDNA ends.
The construction of a human ileal
gt10 cDNA library and isolation of
a 1,490-nucleotide partial ileal
Na+-bile acid cotransporter cDNA
has been described previously (33). This cDNA encompasses nucleotides
480 to 1970 of the 3,779-nucleotide ileal
Na+-bile acid cotransporter mRNA
and included the entire 1,047-nucleotide coding region as well as 118 and 325 nucleotides of the 5'- and 3'-untranslated regions,
respectively. For expression of the human ileal
Na+-bile acid cotransporter in
transfected cells, an EcoR I fragment encompassing nucleotides 480 to 1733 and including the entire coding
region was cloned into the EcoR I site
of pCMV5 (33). The construct was verified by dideoxynucleotide
sequencing.
A human placental genomic DNA library in
EMBL3 (catalog no. HL1067j;
Clontech; Palo Alto, CA) was screened as described (33). A single
positive clone,
HG8, was identified after screening 2 × 105 bacteriophages. After
restriction enzyme digestion and Southern blot analysis, fragments
corresponding to exon and flanking sequences were subcloned into
pBluescript for DNA sequencing. These results showed that
HG8
encompassed only the 3' half of the human ileal Na+-bile acid cotransporter gene
(14, 33). To identify the 3' end of the human ileal
Na+-bile acid cotransporter cDNA,
we employed the rapid amplification of cDNA ends (RACE) procedure.
Reverse transcription was performed with 3 µg of human ileal poly(A)
RNA and an oligo(dT) adapter primer, 5'-
AAGGATCCGTCGACATC(T)17-3',
in a volume of 20 µl using a cDNA synthesis kit (Superscript kit;
Life Technologies, Grand Island, NY). Sequence from
HG8 was used to
synthesize the oligonucleotide HIBAT 52 (5'-TCACTGCCTCATAGAGTCTATTTC-3'; nucleotides 3036 to 3059)
for the subsequent amplification reactions. For the polymerase chain
reaction (PCR) amplification (50 µl; 30 cycles of 94°C for 45 s,
55°C for 45 s, and 72°C for 2 min), the reactions contained 1 µl of cDNA, 0.5 µM primers (HIBAT 52 and Universal Adapter primer, 5'-AAGGATCCGTCGACATC-3'), 0.2 mM dNTPs, 1.5 mM
MgCl2, and 0.5 U of
Taq polymerase. Following PCR
amplification, the 3' RACE products were isolated from a 1.2%
(wt/vol) agarose gel, treated with T4 DNA polymerase, phosphorylated
with T4 polynucleotide kinase, and ligated into
Sma I-digested pBluescript II KS.
Individual clones were identified by colony hybridization using a
32P-labeled
Pst
I-Xba I fragment from the
HG8 clone
that extended from nucleotides 2963 to 3839 downstream of the
transcription start site. Fourteen clones that were positive by colony
hybridization were selected for sequencing by the dideoxynucleotide
method.
To identify the 5' end of the human ileal
Na+-bile acid cotransporter cDNA,
a fragment of genomic DNA encompassing the putative transcription start
site was isolated from a P1 library (14). Oligonucleotides for primer
extension analysis were designed using this sequence. For primer
extension analysis, HIBAT 34 (5' GGTTGAGTTAAGCAACGTTT 3';
nucleotides 511 to 530) or HIBAT 67 (5' GAGCCACGTTAATGTTTAATGTCC 3'; nucleotides 251 to 271) were labeled at the 5' end
using [
-32P]ATP and
T4 polynucleotide kinase, annealed to human ileal or renal poly(A) RNA,
and extended using a modified Moloney murine leukemia virus reverse
transcriptase (SuperScript II RNase
H
; Life Technologies). The
primer extension products were resolved on a 6% acrylamide gel
containing 7 M urea. The ends of the products were localized by
simultaneous electrophoresis of a dideoxynucleotide sequencing reaction
using HIBAT 34.
cDNA cloning from human kidney RNA.
First-strand cDNA was synthesized from human kidney RNA using a cDNA
synthesis kit (SuperScript kit; Life Technologies). A pair of
oligonucleotide primers 5' GCTTCTGTGGACTTGGCCT 3'
(nucleotides 560 to 578) and 5' CGTAATTTGGAACTCGTCTG 3'
(nucleotides 1663 to 1682) located 20 nucleotides upstream of the
initiator methionine and 16 nucleotides downstream of the stop codon,
respectively, were used for PCR amplification of human kidney cDNA at
an annealing temperature of 45°C. As a control for contamination,
parallel PCR amplifications were performed in the presence of a mock
cDNA synthesis reaction containing all the reaction components except
reverse transcriptase. Following PCR amplification, an appropriate size
product (1,122 base pairs) was obtained only from the complete cDNA
synthesis reactions. This product was isolated from a 0.8% (wt/vol)
agarose gel and subcloned into a pT7Blue T vector (Novagen). The insert
was sequenced by the dideoxynucleotide method using human ileal
Na+-bile acid cotransporter
sequence-specific or pT7Blue T vector-specific primers.
Construction of pCMV-human liver bile acid transporter
(NTCP) plasmid. A human liver
Na+-bile acid cotransporter (the
Na+-taurocholate cotransporting
polypeptide, NTCP; Ref. 13) expression plasmid was constructed as
follows. First-strand cDNA was synthesized from human liver poly(A) RNA
using a cDNA synthesis kit (SuperScript kit; Life Technologies). A pair
of oligonucleotide primers, 5' AGGAGGATGGAGGCCCACAACGCGTCT
3' and 5' GCTAGGCTGTGCAAGGGGAGCAGTCCT 3',
corresponding to human liver
Na+-bile acid cotransporter
nucleotides 77 to 103 and 1133 to 1107 (13) was used for PCR with human
liver cDNA at an annealing temperature of 72°C. Following PCR
amplification, an appropriate size product (1,056 base pairs) was
isolated from a 0.8% (wt/vol) agarose gel. The fragment was treated
with T4 DNA polymerase, phosphorylated with T4 polynucleotide kinase,
and ligated into Sma I-digested pCMV5.
Individual clones were screened by COS cell transfection. Clones that
expressed taurocholate uptake activity were sequenced on both strands
by the dideoxynucleotide method.
Cell culture and transfection. COS-1
cells were maintained in monolayer culture at 37°C in an atmosphere
of 5% CO2 in
medium A [Dulbecco's modified
Eagle's medium (DMEM) containing 4,500 mg/l
D-glucose, 10% (vol/vol) fetal
calf serum, 100 U/ml penicillin, and 100 µg/ml
streptomycin; Life Technologies]. CHO-K1 cells were obtained from
the American Type Culture Collection (Rockville, MD) and
maintained in medium B, which
consisted of a 1:1 (vol/vol) mixture of DMEM containing 4,500 mg/l D-glucose and Ham's F-12 medium, 10% (vol/vol) fetal calf serum, 100 U/ml penicillin, and 100 µg/ml streptomycin (Life Technologies). For bile acid uptake assays,
COS or CHO cells were incubated in medium
C, which consisted of a Hanks' balanced salt solution
containing 137 mM NaCl (33) or the indicated concentrations of cations
and anions.
Stable overexpression of the human ileal
Na+-bile acid cotransporter was
achieved by cotransfecting CHO-K1 cells with pCMV5-human ileal
Na+-bile acid cotransporter and
pSV3Neo using the calcium
phosphate precipitation procedure (16) and selecting for resistant
colonies in medium B containing 700 µg/ml of G-418. CHO-K1 cells were seeded at 2.5 × 105 cells per 100-mm dish on
day 0. On day
1, cells were cotransfected with 0.5 µg/dish of
pSV3Neo and 9.5 µg/dish of
pCMV5-human ileal Na+-bile acid
cotransporter expression plasmid. After selection for 14 days, 114 individual colonies were picked, expanded in 24-well plates, and
screened for
[3H]taurocholate
uptake. The cells expressing the highest taurocholate uptake activity
were further isolated through three rounds of dilution cloning. In each
round, cells from each well were replated at ~1 cell/well in three
24-well culture plates, expanded, transferred to duplicate plates, and
assayed for taurocholate uptake activity. The final CHO cell clones
were maintained in medium B containing 350 µg/ml G-418.
Analysis of human ileal
Na+-bile
acid cotransporter protein.
CHO cell clones expressing the human ileal
Na+-bile acid cotransporter were
cultured as described above. After incubation for 20 h in
medium B containing 10 mM sodium
butyrate, the cell monolayers were washed with ice-cold
phosphate-buffered saline (PBS) and scraped in 1 ml of ice- cold PBS
containing 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 mM EDTA, 10 µg/ml pepstatin, 10 µg/ml aprotonin, and 10 µg/ml leupeptin. The
cells were pelleted at 10,000 g at 4°C and stored at
70°C. Cell extracts were prepared by
lysing the cell pellets in 25 mM tris(hydroxymethyl)aminomethane (Tris) hydrochloride, pH 7.4, 300 mM NaCl, 1 mM
CaCl2, 1% Triton X-100, 1 mM
PMSF, 10 µg/ml pepstatin, 10 µg/ml aprotonin, 10 µg/ml leupeptin, and 10 mM EDTA by repeated aspiration through a 25-gauge needle. The
samples were centrifuged at 10,000 g
for 2 min at 4°C, and aliquots of cell supernatants were stored at
70°C. For immunoblotting studies, the cell extracts were
brought to 3% sodium dodecyl sulfate (SDS), 5% glycerol, 30 mM
Tris · HCl, pH 7.4, 10 mM EDTA, and 100 mM
dithiothreitol; the samples were boiled for 5 min and then alkylated by
incubation with 330 mM iodoacetamide at 37°C for 30 min. The
samples were resolved by SDS-polyacrylamide gel electrophoresis on 10%
acrylamide gels and subjected to immunoblotting as previously described
(33) using rabbit anti-ileal
Na+-bile acid cotransporter
peptide antibody. The rabbit antibody was visualized using a
horseradish peroxidase-conjugated goat anti-rabbit antibody and an
enhanced chemiluminescence detection system (ECL; Amersham
International, Buckinghamshire, UK).
Bile acid uptake assays. For
transfection, the plasmids were isolated using the Wizard Maxiprep DNA
purification procedure (Promega, Madison, WI). On day
0, 1.5 × 106
COS cells per 100-mm dish were plated in medium
A. On day 1, COS cells
were transfected with 5 µg of either pCMV5-human ileal Na+-bile acid cotransporter,
pCMV5-human liver Na+-bile acid
cotransporter, or pCMV2-
-galactosidase DNA by the DEAE-dextran
method (33). On day 2, the transfected
cells were trypsinized, pooled, and replated in 24-well culture plates
at 7 × 104 cells/well in
medium A. On day
4, the cells were incubated at 37°C for 10 min in
the indicated media containing radiolabeled bile acid in the presence
or absence of competitor. After incubation, the medium was removed, and
each cell monolayer was washed three times with ice-cold PBS plus 0.2%
(wt/vol) bovine serum albumin and 1 mM taurocholate and once with
ice-cold PBS alone. The cell monolayer was dissolved in 0.1 N NaOH, and
aliquots were taken to determine cell-associated protein and
radioactivity. CHO cells were plated on day
0 at 3.8 × 105 cells per 35-mm dish in
medium B. On day
1, the cells were refed medium
B containing 10 mM sodium butyrate. After 20 h, the
dishes were washed and incubated in duplicate with Hanks' balanced
salt solution containing 137 mM NaCl and the indicated concentration of
3H-labeled solute for 10 s at
37°C. The cell monolayers were processed as described for the COS
cells. Uptake values were corrected for the background at each
concentration of solute by subtracting the uptake values from parallel
assays performed in the absence of
Na+ or uptake values from parallel
dishes of parental CHO-K1 cells. Kinetic parameters for taurocholate
uptake were derived using a computer-based least-squares fit of
individual data points. Substrate saturation curves were analyzed using
Hanes-Woolf plots (21). Inhibition of
Na+-dependent taurocholate uptake
by various substrates was evaluated kinetically by Dixon and
Cornish-Bowden plot analysis.
 |
RESULTS |
Analysis of the human ileal
Na+-bile
acid cotransporter cDNA.
The full-length sequence for the human ileal
Na+-bile acid cotransporter cDNA
was derived from cDNA and genomic DNA cloning and is shown
schematically in Fig.
1A. The
polyadenylation signal and poly(A) tail were identified using 3'
RACE; the translation termination codon is followed by a long
3'-untranslated region of 2,134 nucleotides. The assignment of
the 3' end was confirmed by Northern blot analysis. No transcript
was detected in ileal or kidney RNA after hybridization of a
32P-labeled
Xba
I-Sac I fragment that extended from
nucleotides 3840 to 4357 downstream of the transcription start site;
however, a 4.0-kb transcript was readily detected using a
32P-labeled
Pst
I-Xba I fragment that extended from
nucleotides 2963 to 3839 downstream of the transcription start site
(data not shown).

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 1.
Human ileal Na+-bile acid
cotransporter sequence. A: schematic
diagram of 3,779-nucleotide (nt) human ileal
Na+-bile acid cotransporter cDNA.
The initiator methionine is preceded by a 261- or 598-nucleotide
5'-untranslated region (stippled bar). The 348-amino acid (AA)
coding sequence (open bar) is followed by a 2,134-nucleotide
3'-untranslated region (striped bar) that extends to the poly(A)
tail. B: nucleotide sequence of the
5'-untranslated region of the human ileal
Na+-bile acid cotransporter gene.
Transcription initiation sites are denoted by small arrows.
Head-to-tail repeats in the longer transcript are indicated by large
arrows. ATG codons upstream of the initiator methionine are
underscored. The full-length human ileal
Na+-bile acid cotransporter
sequence has been deposited in the GenBank/EMBL data bank with
accession no. U10417.
|
|
The transcriptional start sites were identified by primer extension
analysis. Figure
2A
(lane 4) shows the results of a
primer extension analysis performed using a 20-nucleotide primer
located 68 nucleotides upstream of the initiator methionine. Two
prominent primer products (194 and ~529 nucleotides in length) that
extended from HIBAT 34 to positions 261 and ~600 nucleotides upstream
of the initiator methionine were obtained. To confirm the presence of
the upstream start site, the primer extension was repeated using a
24-nucleotide primer located 325 nucleotides upstream of the initiator
methionine (Fig. 2A,
lane 2). The major product was a
closely spaced doublet (267 and 273 nucleotides in length) that
extended from HIBAT 67 to positions located 598 and 592 nucleotides upstream of the initiator methionine (Fig.
2A, lane
2). The transcription start sites at position +1 and
+338 are separated by two highly conserved head-to-tail repeats of 127 and 129 nucleotides, respectively (Fig.
1B).

View larger version (69K):
[in this window]
[in a new window]

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 2.
Primer extension analysis of transcription initiation sites of human
ileal Na+-bile acid cotransporter
gene. A: positions of start sites,
oligonucleotide primers, and repeat sequences are shown schematically
at top. Transcription start sites are
located at positions 1 and
338; the initiator methionine is
located at position 599. Large arrows
indicate repeat sequences. Small arrows (67 and 34) indicate
oligonucleotides used for primer extension analysis. ATG, codon for the
initiator methionine; open bar, coding region.
32P-labeled oligonucleotides HIBAT
67 (lanes 1 and
2) or HIBAT 34 (lanes 3 and
4) were annealed to 5 µg of tRNA
(lanes 1 and
3) or human ileal poly(A) RNA
(lanes 2 and
4) and extended using a modified
Moloney murine leukemia virus reverse transcriptase. Primer extension
products were resolved on a 6% acrylamide gel containing 7 M urea.
Dried gel was exposed to Amersham Hyperfilm for 20 h at 70°C
with an intensifying screen. Ends of the products were localized by
simultaneous electrophoresis of a dideoxynucleotide sequencing reaction
using HIBAT 34. * Primer extension products terminating at
position +1 that were detected with HIBAT 34 and HIBAT 67. B:
32P-labeled oligonucleotide HIBAT
34 was annealed to 5 µg of tRNA (lane
1), 5 µg of liver poly(A) RNA
(lane 2), 15 µg of kidney poly(A)
RNA (lane 3), or 5 µg of ileal
poly(A) RNA (lane 4) and extended
using a modified Moloney murine leukemia virus reverse transcriptase.
Primer extension products were resolved on a 6% acrylamide gel
containing 7 M urea. Dried gel was exposed to Amersham Hyperfilm for 20 h at 70°C with an intensifying screen. M, molecular weight
markers.
|
|
Tissue expression of the human ileal
Na+-bile
acid cotransporter.
Northern blot analysis of the ileal
Na+-bile acid cotransporter mRNA
in hamster (32) and rat (22) revealed single major transcripts of
~4.0 and 5.0 kb, respectively. To determine the size of the human
ileal Na+-bile acid cotransporter
message, Northern blot analysis was performed with human ileal poly(A)
RNA. As shown in Fig.
3A, a
4.0-kb transcript was detected in human ileum. This transcript size is
in close agreement with the composite size of the human ileal
Na+-bile acid cotransporter cDNA
as determined using a combination of RACE, cDNA, and genomic DNA
cloning [3,779 nucleotides without the poly(A) tail]. The
different transcripts arising from the two transcriptional start sites
could not be readily distinguished under these Northern blotting
conditions because of the large size of the full-length transcript.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 3.
Northern blot analysis of human mRNA.
A: 5 µg of poly(A) RNA from human
liver, cecum, and ileum were resolved on a 1.2% (wt/vol) agarose gel
containing 2.2 M formaldehyde, transferred to Nytran (Schleicher & Schuell), and fixed by ultraviolet irradiation.
Top: filter was hybridized with two
single-stranded 32P-labeled human
ileal Na+-bile acid cotransporter
probes (2 × 106 cpm/ml) in a
50% (vol/vol) formamide solution at 42°C for 16 h. Filter was
washed in 0.2× SSC (1× SSC is 0.15 M NaCl and 0.015 M
sodium citrate, pH 7.0) containing 0.1% (wt/vol) SDS at 60°C for 1 h and exposed to Amersham Hyperfilm with an intensifying screen for 120 h at 70°C. Bottom: filter
was stripped and hybridized with
32P-labeled human
glyceraldehyde-3-phosphate dehydrogenase single-stranded probe (1 × 106 cpm/ml).
B: Northern blot hybridization of a
human multiple tissue Northern blot (Clontech). Two micrograms of
poly(A) RNA from the indicated normal human tissues were resolved on a
1.2% (wt/vol) agarose gel containing 2.2 M formaldehyde, transferred
to a charge-modified nylon membrane, and fixed by ultraviolet
irradiation. Top: filter was
hybridized for 16 h in a 50% (vol/vol) formamide solution at 42°C
with a uniformly 32P-labeled human
ileal bile acid transporter cDNA probe (2.5 × 106 cpm/ml). Filter was washed in
0.2× SSC containing 0.1% (wt/vol) SDS at 60°C for 1 h and
exposed to Amersham Hyperfilm with an intensifying screen for 64 h at
70°C. Bottom: filter was
stripped and hybridized with a uniformly
32P-labeled human
glyceraldehyde-3-phosphate dehydrogenase single stranded probe (1.5 × 106 cpm/ml).
C: multiple tissue Northern blot was
probed with a random hexamer primed
32P-labeled human liver
Na+-bile acid cotransporter probe
(1 × 106 cpm/ml). Filter was
washed in 0.2× SSC containing 0.1% (wt/vol) SDS at 60°C for
30 min and exposed to Amersham Hyperfilm with an intensifying screen
for 14 h at 70°C.
|
|
Na+-dependent bile acid uptake has
also been demonstrated in brush-border membranes of the kidney (31) and
the sinusoidal membranes of the liver (13). To examine the
tissue-specific expression of the human ileal
Na+-bile acid transporter,
Northern blot analysis was performed. A 4.0-kb transcript was readily
detected in human kidney, but absent from liver, heart, brain,
placenta, lung, skeletal muscle, and pancreas (Fig.
3B). In addition, no hybridization
was detected after Northern blot analysis of poly(A) RNA from human
spleen, thymus, prostate, testis, ovary, and peripheral blood
leukocytes (data not shown). A very faint hybridization signal for the
ileal Na+-bile acid cotransporter
was detectable in the cecum upon longer exposure (data not shown) and
was confirmed by reverse transcriptase-PCR analysis (data not shown).
Stripping and reprobing the blots with a probe for
glyceraldehyde-3-phosphate dehydrogenase confirmed the presence of the
RNA on the blots.
In contrast to the human ileal
Na+-bile acid cotransporter cDNA,
the human liver Na+-bile acid
cotransporter did not hybridize to a transcript in kidney (Fig.
3C) or ileum (data not shown).
High-stringency Northern blot analysis using a human liver
Na+-bile acid cotransporter cDNA
revealed a 1.8-kb transcript in liver and a 1.1-kb transcript in
placenta (Fig. 3C). Strong
hybridization of the ileal but not the liver
Na+-bile acid cotransporter cDNA
to a 4.0-kb transcript in ileum and kidney as well as the previous
localization of a single gene for the ileal
Na+-bile acid cotransporter to
human chromosome 13q33 (14) suggest that the ileal
Na+-bile acid cotransporter and
the previously reported renal
Na+-bile acid cotransporter
activity (27, 31) are encoded by the same gene. To directly address
this question, an Na+-bile acid
cotransporter cDNA clone was isolated from human kidney total cDNA
using a reverse transcriptase-PCR cloning strategy. The sequence of the
kidney cDNA clone was identical to the human ileal
Na+-bile acid cotransporter (data
not shown). To determine whether the kidney
Na+-bile acid cotransporter mRNA
used the same transcriptional start sites as the human ileal message,
primer extension analysis was performed with human kidney RNA. As shown
in Fig. 2B, two prominent primer
extended products were obtained that comigrated with those obtained
from human ileum. These results indicate that the ileal Na+-bile acid cotransporter gene
also encodes a renal Na+-bile acid
cotransporter and confirm the results from a previous characterization
of the properties and ontogeny of the rat renal Na+-bile acid cotransporter (3).
Ion dependence of taurocholate
transport. A critical property of the ileal bile acid
transporter is the dependence on an external Na+ gradient (30). To extend our
understanding of the Na+-bile acid
cotransport process, we examined the cation and anion dependence of the
transporter. pCMV5-human ileal
Na+-bile acid
cotransporter-transfected COS cells were incubated in a modified
Hanks' buffer containing 5 µM
[3H]taurocholate for
10 min at 37°C. Preliminary studies showed that uptake of
[3H]taurocholate by
ileal Na+-bile acid
cotransporter-transfected COS cells was linear for up to 15 min at
37°C (data not shown). When 137 mM
Na+ was replaced by
K+,
Li+,
Rb+,
Cs+, choline, or
tetraethylammonium, taurocholate uptake was reduced at least 30-fold
with no significant difference between various cations (Table
1). In contrast to the strict
Na+ requirement, the ileal bile
acid transporter does not exhibit a specific anion dependence. In
addition to chloride ion, bicarbonate, bromide, and sulfate were able
to support taurocholate uptake (Table 2).
View this table:
[in this window]
[in a new window]
|
Table 1.
Cation dependence of taurocholate uptake by human ileal
Na+-bile acid cotransporter-transfected COS cells
|
|
View this table:
[in this window]
[in a new window]
|
Table 2.
Anion dependence of taurocholate uptake by human ileal
Na+-bile acid cotransporter-transfected COS cells
|
|
Figure 4 shows the uptake of taurocholate by human ileal
Na+-bile acid
cotransporter-transfected COS cells as a function of Na+ concentration. Uptake
increased as a sigmoidal function of
Na+ concentration from 10 to 137 mM. Maximal taurocholate uptake was observed above 30 mM
Na+ and was half-maximally
stimulated at an Na+ concentration
of 20 mM. This is similar to the value of 23 mM Na+ previously measured in human
ileal brush-border membrane vesicles (1). When the data were analyzed
by plotting taurocholate uptake vs. taurocholate
uptake/[Na]n, where
n is equal to the activator:substrate
stoichiometry (26), the correlation coefficients for this analysis were
as follows: n = 1, 0.487;
n = 2, 0.937;
n = 3, 0.848; and
n = 4, 0.791. The lack of linearity of
the plot for n = 1 suggests the
involvement of more than one Na+
per taurocholate transport event. The
inset in Fig. 4 shows a plot of
taurocholate uptake vs. taurocholate
uptake/[Na]2.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 4.
Effect of Na+ concentration on
taurocholate uptake by human ileal
Na+-bile acid
cotransporter-transfected COS cells. On day
0, COS cells were seeded (1.5 × 106 cells/100-mm dish) in DMEM and
transfected the following day with pCMV5-human ileal
Na+-bile acid cotransporter or
pCMV2- -galactosidase DNA (5 µg) by the DEAE-dextran method. On
day 2, each group of transfected cells
was treated with trypsin, pooled, and replated in 24-well culture
plates at 7 × 104
cells/well. On day 5, cells were
incubated at 37°C for 15 min in Hanks' balanced salt solution
containing 50 µM
[3H]taurocholate (0.52 Ci/mmol) and the indicated concentration of NaCl (choline chloride was
included as osmotic replacement for NaCl). Medium was then removed, and
each cell monolayer was washed and processed to determine protein and
cell-associated
[3H]taurocholate.
Values for taurocholate uptake are means ± SD of triplicate
measurements. Inset: plot of
V/[Na+]2
vs. V, where V = [3H]taurocholate
uptake in
pmol · min 1 · mg
protein 1.
|
|
Specificity of uptake. To examine the
substrate specificity of the human ileal
Na+-bile acid cotransporter,
direct uptake experiments were performed using radiolabeled bile acids.
As shown previously for taurocholate (33), the human ileal
Na+-bile acid cotransporter
mediated the uptake of the unconjugated bile acid cholate, as well as
glycine conjugates of deoxycholate, chenodeoxycholate, and
ursodeoxycholate (Fig.
5).
The apparent Michaelis constant
(Km) values for
uptake in transfected COS cells are listed in Table
3.
Cis-inhibition experiments were also
performed to include additional nonradioactive substrates.
The transport activity of human ileal
Na+-bile acid
cotransporter-transfected COS cells was analyzed at several
concentrations of
[3H]taurocholate and
unlabeled competitor to derive an apparent inhibition constant
(Ki).
The results of a representative experiment for tauroursodeoxycholate
are shown in Fig. 6. The apparent
Ki values are
listed in Table 4. The human ileal
Na+-bile acid cotransporter
exhibited a higher affinity for the dihydroxy bile acids,
chenodeoxycholate and deoxycholate, than for the trihydroxy bile acid,
taurocholate.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 5.
Bile acid uptake activity of human ileal
Na+-bile acid cotransporter in
transfected COS cells. COS cells were transfected with pCMV5-human
ileal Na+-bile acid cotransporter
or pCMV2- -galactosidase DNA (5 µg) and assayed for uptake in
presence of the indicated concentration of
[3H]cholate (1.0 Ci/mmol; A),
[14C]glycodeoxycholate
([14C]GDCA, 43.3 mCi/mmol; B),
[14C]glycochenodeoxycholate
([14C]GCDCA, 48.6 mCi/mmol, C), or
[14C]glycoursodeoxycholate
([14C]GUDCA, 40.2 mCi/mmol; D). After 10 min at
37°C, medium was removed, and each cell monolayer was washed and
processed to determine protein and cell-associated radioactivity.
Uptake values were corrected for nonspecific uptake by mock
(pCMV2- -galactosidase) transfected cells and are means of duplicate
measurements. Insets: Eadie-Hofstee
analysis of uptake data.
|
|

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 6.
Inhibition of taurocholate uptake by human ileal
Na+-bile acid
cotransporter-transfected COS cells.
A: COS cells were transfected with
pCMV5-human ileal Na+-bile acid
cotransporter or pCMV2- -galactosidase DNA (5 µg) and assayed for
uptake at 5, 10, and 25 µM
[3H]taurocholate (0.76 Ci/mmol) in absence or presence of 10, 50, or 100 µM
tauroursodeoxycholate (TUDC). After 10 min at 37°C, medium was
removed, and each cell monolayer was washed and processed to determine
protein and cell-associated radioactivity. Uptake values were corrected
for nonspecific uptake in mock (pCMV2- -galactosidase) transfected
cells and are means ± SD of triplicate measurements.
B: inhibition of taurocholate uptake
was evaluated by Dixon plot analysis where concentration of inhibitor
(tauroursodeoxycholic acid) is plotted vs. reciprocal of uptake
velocity
(min · mg 1 · pmol
taurocholate 1) for
different fixed concentrations of substrate.
|
|
To extend our understanding of the substrate specificity of the human
ileal and renal Na+-bile acid
cotransporter, cis-inhibition studies
were also performed with a variety of other organic anions. The
apparent Ki was
determined by assaying
[3H]taurocholate
uptake at various concentrations of substrate and inhibitor; the
kinetic types of inhibition were evaluated by complementary Dixon/Cornish-Bowden plot analysis and Lineweaver-Burk plot
analysis. A comparison of the inhibition of taurocholate uptake in
transfected COS cells at a 20-fold excess of competitor is shown in
Fig. 7. Cyclosporin A was a potent inhibitor (inhibition
type: noncompetitive) of taurocholate uptake, whereas
bromosulfophthalein (inhibition type, noncompetitive) and
chenodeoxycholate-3-sulfate (inhibition type, competitive) were
relatively poor inhibitors. In contrast, a number of other organic
anions and amphipathic molecules showed little inhibition. These
included olsalazine, 17
-estradiol-3-sulfate, estrone-3-sulfate,
taurodehydrocholate, and bilirubin ditaurate conjugate. In general, the
human ileal Na+-bile acid
cotransporter was inhibited by fewer organic anions than previously
determined for the liver Na+-bile
acid cotransporter (34). For example, bromosulfophthalein and
17
-estradiol-3-sulfate are potent inhibitors of the rat liver Na+-bile acid cotransporter with
apparent Ki
values of 12 and 28 µM, respectively. In contrast,
bromosulfophthalein was a weak inhibitor (apparent
Ki = 144 µM)
and 17
-estradiol-3-sulfate and estrone-3-sulfate were extremely poor
inhibitors of the ileal Na+-bile
acid cotransporter.
To directly examine these substrate specificity differences,
[3H]estrone-3-sulfate
transport was analyzed in human liver or ileal Na+-bile acid
cotransporter-transfected COS cells. As shown in Fig. 8,
both the human ileal and liver
Na+-bile acid cotransporters
expressed saturable taurocholate uptake activity with apparent
Km and
Vmax values of
(ileal) 18 µM and 48 pmol · min
1 · mg
protein
1 and (liver) 10 µM and 333 pmol · min
1 · mg
protein
1, respectively. The
differences in the apparent
Vmax for
taurocholate transport between the liver and ileal
Na+-bile acid cotransporter
expression plasmids may reflect transfection efficiency or possibly
differences in the substrate turnover number of the two transporters.
In the same transfected COS cells, the transport of
[3H]estrone-3-sulfate
by the human liver Na+-bile acid
cotransporter-transfected cells was also saturable, with an apparent
Km of 60 µM and
Vmax of 111 pmol · min
1 · mg
protein
1. Thus in COS cells
from the same pooled transfection, the human liver
Na+-bile acid cotransporter
exhibited a sixfold decreased affinity and a threefold lower maximal
transport rate for estrone-3-sulfate compared with taurocholate. In
contrast, uptake of estrone-3-sulfate by human ileal
Na+-bile acid
cotransporter-transfected COS cells was indistinguishable from the
mock-transfected cell background.
The inability to measure uptake of low-affinity potential substrates
such as estrone-3-sulfate may represent detection problems as a result
of low uptake activities in the transiently transfected COS cells. To
overcome this problem, stably transfected CHO cell lines expressing the
human ileal Na+-bile acid
cotransporter were generated. As shown in Fig.
9A, the untreated and
sodium butyrate-induced stably transfected CHO cells express higher
levels of human ileal Na+-bile
acid cotransporter protein and activity. Prior incubation for 20 h with
10 mM sodium butyrate increased the taurocholate uptake activity
~60%, and taurocholate uptake was linear at least up to 1 min in
these cells. Eadie-Hofstee analysis of taurocholate uptake by the
stably transfected CHO cells (Fig.
9B) revealed a
Km value of 18 µM for taurocholate, similar to values determined in transiently
transfected COS cells. The overall taurocholate uptake activity was
substantially increased in the stably transfected CHO cells, with an
apparent Vmax
value of ~2,200
pmol · min
1 · mg
cell protein
1. However, as
shown in the transiently transfected COS cells (Fig. 9B), uptake of estrone-3-sulfate by
the human ileal Na+-bile acid
cotransporter expressing CHO cells was statistically indistinguishable
from the parental CHO-K1 cells (P > 0.05).
 |
DISCUSSION |
Analysis of the human ileal
Na+-bile
acid cotransporter cDNA.
In this study, we report the cloning of the full-length human ileal
Na+-bile acid cotransporter cDNA
and mapping of its 5' transcriptional start sites and 3'
end. Whereas a partial cDNA sequence (33) and gene structure (14) for
the human ileal Na+-bile acid
cotransporter has been identified, identification of the transcription
start sites and 3' end has not been described. The entire human
ileal Na+-bile acid cotransporter
cDNA sequence was elucidated using a combination of cDNA and genomic
DNA cloning, 3' RACE, and primer extension analysis. Analysis of
the 5' end of the human ileal Na+-bile acid cotransporter
message revealed two major transcriptional start sites located ~337
nucleotides apart. At this time it is not known whether this unusual
heterogeneity results from the use of multiple promoters.
The two start sites are separated by an intervening
head-to-tail dimer of highly conserved repeat sequences. The two
sequences, 127 and 129 nucleotides in length, respectively, are 91%
identical but do not show identity to any other sequences in the
current versions of several DNA sequence data bases. This repeat
sequence is a recent event in evolution and is not present in the mouse
ileal Na+-bile acid cotransporter
gene (Dawson, unpublished data). The effect of these sequences on ileal
Na+-bile acid cotransporter gene
transcription is not known. However, instability of this repeat
sequence could affect ileal
Na+-bile acid cotransporter
expression and lead to a phenotype such as primary bile acid
malabsorption (14). In addition, there are obvious translational
consequences associated with such widely separated transcription start
sites. The upstream start site generates a transcript with a
5'-untranslated region of 598 nucleotides that encodes 14 upstream AUG codons. In contrast, the downstream start site generates a
5'-untranslated region of 261 nucleotides with only 3 upstream
AUG codons. Since the translation scanning hypothesis (9) predicts that
an abundance of upstream AUG codons would inhibit translation from the
downstream authentic initiator methionine, the shorter transcript would
be preferentially translated. Conditions that selectively increase
transcription initiation at the downstream start site may lead to
increased ileal Na+-bile acid
cotransporter protein expression.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 7.
Transport specificity of human ileal
Na+-bile acid
cotransporter-transfected COS cells. COS cells were transfected with
pCMV5-human ileal Na+-bile acid
cotransporter or pCMV2- -galactosidase DNA (5 µg) and assayed for
uptake at 5, 10, and 25 µM
[3H]taurocholate (0.76 Ci/mmol) in absence or presence of 10, 50, or 100 µM competitor.
After 10 min at 37°C, medium was removed, and each cell monolayer
was washed and processed to determine protein and cell-associated
radioactivity. Inhibition of taurocholate uptake was evaluated by Dixon
and Cornish-Bowden plot analysis. Data for 5 µM
[3H]taurocholate and
100 µM competitor are shown as open bars. Uptake values were
corrected for nonspecific uptake in mock (pCMV2- -galactosidase)
transfected cells and are means ± SD of three
(1-8)
or one (9) independent COS cell
transfection. Differences from control uptake values for 5 µM
[3H]taurocholate and
100 µM competitor were evaluated using Student's
t-test
(** P < 0.001). Apparent
Ki values
calculated using different concentrations of
[3H]taurocholate and
competitor are shown in parentheses (NC, an apparent
Ki > 200 µM).
CDC-3-SO4,
chenodeoxycholate-3-sulfate; BSP, bromosulfophthalein.
|
|
The human ileal Na+-bile acid
cotransporter message contains a long 3'-untranslated region of
2,134 nucleotides and utilizes a single polyadenylation site. As noted
previously for the rat ileal
Na+-bile acid cotransporter cDNA,
the human ileal Na+-bile acid
cotransporter 3'-untranslated region contains a number of di- and
trinucleotide repeats as well as multiple copies of an ATTTA motif that
is associated with mRNA instability. These elements may be important in
explaining previously noted differences between ileal
Na+-bile acid cotransporter
steady-state mRNA levels and gene transcription rates in developing
ileum (3, 22).
Analysis of the human ileal
Na+-bile
acid cotransporter mRNA expression.
By Northern blot analysis, the ileal
Na+-bile acid cotransporter mRNA
has been found in hamster ileum, distal jejunum, and kidney (32) and in
rat ileum, kidney, cecum, and proximal colon (22). In this study of
mRNA expression in human tissues, a 4.0-kb transcript was also found in
ileum and kidney, whereas no hybridization was detected in pancreas,
brain, placenta, lung, skeletal muscle, and a variety of other human
tissues. A very weak signal was also detected in human cecum and
verified by reverse transcriptase-PCR analysis. Under similar
high-stringency Northern blotting conditions, human liver
Na+-bile acid cotransporter mRNA
was detected in liver, but not in kidney. This is the first report of a
Northern blot analysis of human liver
Na+-bile acid cotransporter
expression. The lack of liver
Na+-bile acid cotransporter mRNA
expression in kidney agrees with previous studies in the hamster (5)
but differs from studies in the rat where a faint signal was observed
(13). This may be due to species differences or the liver
Na+-bile acid cotransporter signal
may be below our level of detection. Interestingly, the liver
Na+-bile acid cotransporter cDNA
also hybridized to a smaller 1.1-kb transcript in placenta. Screening
of a human placental cDNA library identified a partial liver
Na+-bile acid cotransporter cDNA
consistent with the placental transcript arising from the same gene
(Walters and Dawson, unpublished results).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 8.
Taurocholate and estrone-3-sulfate uptake activity of human liver and
ileal Na+-bile acid cotransporters
in transfected COS cells. COS cells were transfected with pCMV5-human
ileal Na+-bile acid cotransporter
(A) or pCMV5-human liver
Na+-bile acid cotransporter DNA (5 µg) (B) and assayed for uptake in
presence of the indicated concentration of
[3H]taurocholate (0.76 Ci/mmol) or
[3H]estrone-3-sulfate
(1.0 Ci/mmol). After 10 min at 37°C, medium was removed, and each
cell monolayer was washed and processed to determine protein and
cell-associated radioactivity. Uptake values were corrected for
nonspecific uptake in parallel mock (pCMV2- -galactosidase)
transfected cells and are means of duplicate measurements. Apparent
Km values for
taurocholate uptake were 18 and 10 µM for human ileal and liver
transporters, respectively. Apparent
Km for
estrone-3-sulfate uptake by liver
Na+-bile acid cotransporter was 60 µM.
|
|
In humans, only 1-2 µmol of bile acids are excreted in the urine
per day, implying a highly efficient tubular reabsorption (23). Even in
patients with liver disease where plasma bile acid concentrations are
elevated, the 24 h urinary excretion of nonsulfated bile acids remains
significantly less than the quantity that undergoes glomerular
filtration (15, 18, 23, 24). This diminished urinary excretion was
explained in subsequent studies that identified an
Na+-dependent active bile acid
reabsorption process in the proximal renal tubules (27, 31). More
recently, a careful study of the ontogeny of rat ileal
Na+-bile acid cotransporter
activity, protein, mRNA, and gene transcription indicated that this
gene is also responsible for renal bile acid transport (3). In the
present study, we have confirmed and extended those results. Using a
reverse transcriptase-PCR cloning and sequencing strategy, we have
shown the coding region of the cross-hybridizing human
kidney cDNA to be identical to the ileal Na+-bile acid cotransporter.
Analysis of the 5' end of the kidney transcript revealed that the
same transcriptional start sites are utilized in adult ileum and
kidney. These results indicate that both the ileal and renal
Na+-bile acid cotransporters are
encoded by identical transcripts derived from the SLC10A2 gene. In
addition to the physiological implications, these results also have
therapeutic consequences. Recently, potent inhibitors of the ileal
Na+-bile acid cotransporter have
been developed as potential therapies for hypercholesterolemia (12,
29). Since the same transporter is also expressed in the kidney, these
inhibitors should also block renal reclamation of nonsulfated bile
acids and increase urinary bile acid output.
Ion dependence of taurocholate uptake.
Taurocholate uptake by human ileal
Na+-bile acid
cotransporter-transfected COS cells exhibited a strict requirement for
external Na+ (Table 1). This
distinguishes the ileal Na+-bile
acid cotransporter from other
Na+/solute transporters such as
the glucose or succinate transporters, where
Li+ will weakly support solute
uptake. The Na+-coupled transport
of some amino acids and neurotransmitters has been shown to require an
accompanying Cl
anion (8).
In contrast, the human ileal
Na+-bile acid cotransporter does
not exhibit a strict Cl
requirement for taurocholate uptake in transfected COS cells. These
findings extend the results of earlier studies that examined the
electrogenic nature of taurocholate uptake by ileal brush-border membrane vesicles (1, 30). In those studies, taurocholate uptake was
still observed after Cl
was
replaced with SCN
,
, or isethionate. These
results argue against a role for a cotransported anion in taurocholate
transport and rule out a specific requirement for the
Cl
anion. Analysis of
taurocholate transport as a function of
Na+ concentration revealed a
sigmoidal relationship suggesting an Na+:taurocholate stoichiometry
greater than 1:1. However, electrogenic Na+/taurocholate cotransport has
not been a universal finding in earlier studies (30). Ultimately, the
ability to overexpress the
Na+-bile acid cotransporters in
heterologous systems such as Xenopus oocytes and CHO cells will permit the use of sensitive voltage-clamp techniques to unambiguously resolve this question (28).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 9.
Taurocholate and estrone-3-sulfate uptake activity of human liver and
ileal Na+-bile acid cotransporters
in stably transfected CHO cells. A: on
day 1, stably transfected CHO cells
(line 94101) were refed medium B
containing 10 mM sodium butyrate (+Butyrate) or medium
B alone ( Butyrate) and incubated for 20 h. Cells
were washed with prewarmed phosphate-buffered saline, and incubated
with 300 µl of Hanks' balanced salt solution containing 50 µM
[3H]taurocholate (0.17 Ci/mmol) for the indicated times at 37°C. The time
0 point was processed immediately after adding Hanks'
media to the dishes. After the indicated incubation time, dishes were
washed and processed to determine protein and cell-associated
radioactivity. Uptake values were corrected for background due to
initial sticking to the cells and plates by subtracting
time 0 values.
Inset: cell extracts were prepared
from parallel dishes of CHO 94101 cells preincubated in absence
(lanes 1 and
3) or presence
(lanes 2 and
4) of sodium butyrate and subjected
to SDS-polyacrylamide gel electrophoresis on 10% acrylamide gels.
After transfer to nitrocellulose, blot was incubated with a 1:5,000
dilution of anti-ileal Na+-bile
acid cotransporter peptide antibody (22, 33). Primary antibody was
visualized using a 1:5,000 dilution of horseradish
peroxidase-conjugated donkey anti-rabbit (Amersham) and enhanced
chemiluminescence. Blot was exposed for 1 min to X-ray film. The
following amounts of cell lysate protein were loaded per lane:
lanes 1 and
2, 60 µg; lanes
3 and 4, 120 µg.
B: CHO-K1 or CHO-human ileal
Na+-bile acid cotransporter cells
were assayed for solute uptake in presence of the indicated
concentration of
[3H]taurocholate (0.76 Ci/mmol) or
[3H]estrone-3-sulfate
(1.0 Ci/mmol). After 10 s at 37°C, medium was removed, and each
cell monolayer was washed and processed to determine protein and
cell-associated radioactivity. Uptake values for the CHO-K1 and stably
transfected CHO cells are shown and are means of duplicate
measurements.
|
|
Specificity of bile acid transport.
Taurocholate uptake by the expressed human ileal
Na+-bile acid cotransporter was
saturable with an apparent
Km of ~13 µM.
This apparent Km
was similar to values reported using a human ileal mucosa technique and
human isolated brush-border membrane vesicles (1). In the studies of
transport specificity, the human ileal
Na+-bile acid cotransporter had a
higher affinity for the dihydroxy bile acids chenodeoxycholate and
deoxycholate than ursodeoxycholate or the trihydroxy bile acid,
cholate. Although there is a paucity of information on the specificity
of the human ileal bile acid transport system (10), these data
generally agree with earlier studies in the rat and guinea pig (29).
The ileal Na+-bile acid
cotransporter had a similar or slightly lower affinity for
tauroursodeoxycholate than taurocholate. In contrast, the liver
Na+-bile acid cotransporter
exhibited a much higher affinity (almost 3-fold) for
tauroursodeoxycholate than taurocholate (13). The relative affinities
of the other bile acids tested and the effect of conjugation on the
apparent Km were
similar between the human ileal and liver
Na+-bile acid cotransporters. For
the dihydroxy bile acids, chenodeoxycholate and deoxycholate, taurine
conjugation had little effect or slightly increased the apparent
Km. In contrast,
taurine conjugation lowered the apparent
Km for the more
hydrophilic bile acids cholate and ursodeoxycholate.
Sulfation is an important pathway in bile acid metabolism (7) and is
thought to promote the normal fecal excretion of lithocholate. In
cholestasis, hepatic or renal addition of a sulfate moiety to the 3
and 7
positions of bile acids increases renal excretion and
represents a major route for bile acid elimination (16, 24). In this
study, chenodeoxycholate-3-sulfate was shown to be a weak inhibitor of
taurocholate uptake by the human ileal and renal
Na+-bile acid cotransporter.
However, in direct uptake studies with Na+-bile acid
cotransporter-transfected COS cells,
[14C]chenodeoxycholate-3-sulfate
was not transported by the ileal bile acid transporter and was only
weakly transported by the liver bile acid transporter (data not shown).
This result agrees with earlier studies in guinea pig ileum (11) and
rat liver that suggested there was little or no
Na+-dependent transport of
chenodeoxycholate-3-sulfate. Thus at the molecular level, sulfation
increases fecal and urinary bile acid excretion by decreasing its
binding and blocking its transport by the ileal and renal
Na+-bile acid cotransporter. This
concept has been applied to increase the delivery of ursodeoxycholic
acid to the colon by administering ursodeoxycholic acid as the sulfate
conjugates (17).
Cyclosporin A has been shown to inhibit the rat ileal bile acid
transporter (19). However, those studies did not determine whether the
affected step was uptake across the apical brush-border membrane or
transcellular transport and efflux across the basolateral membrane of
the ileal enterocyte. In the present study, cyclosporin A was shown to
be a potent noncompetitive inhibitor of the ileal Na+-bile acid cotransporter. It is
not clear why a significantly higher dose of cyclosporin A was required
to inhibit glycocholate transport in everted gut sacs (50% transport
inhibition at 2.69 mM cyclosporin A) than in the transfected COS cells
(apparent Ki = 25 µM for inhibition of taurocholate uptake). This apparent Ki value (25 µM) is more similar to that determined for the liver Na+-bile acid cotransporter in
isolated rat hepatocytes and sinusoidal rat liver plasma membrane
vesicles (34).
Another potential inhibitor that was examined is olsalazine. Olsalazine
is a therapeutic agent for inflammatory bowel disease that is composed
of two 5-aminosalicylic acid molecules joined by an azo bond. At
millimolar concentrations, this agent has been shown to be a
noncompetitive inhibitor of
Na+-dependent bile acid transport
in rat ileum (2). In this study, olsalazine had little inhibitory
effect on taurocholate uptake by the human ileal
Na+-bile acid cotransporter at
concentrations below 1 mM and acted as only a weak noncompetitive
inhibitor at concentrations between 1 and 5 mM (the highest
concentration used; data not shown). Thus, although it is possible that
inhibition of ileal bile acid absorption by olsalazine contributes to
the diarrhea associated with this agent, the very high apparent
Ki argues that
mechanisms other than direct inhibition of bile acid uptake are also
involved.
Estrone-3-sulfate transport. A
comparison of the pattern of
cis-inhibition revealed a limited
overlap of substrate specificity between the liver and ileal
Na+-bile acid cotransporters. A
striking example is estrone-3-sulfate and 17
-estradiol-3-sulfate.
Preliminary reports (20) and this study indicate that estrone-3-sulfate
is also transported by the human liver
Na+-bile acid cotransporter. In
contrast, estrone-3-sulfate showed little ability to inhibit
taurocholate transport by human ileal Na+-bile acid cotransporter and
was not a substrate in direct uptake experiments.
In conclusion, these studies indicate that the ileal and renal
Na+-bile acid cotransporter has a
more limited substrate specificity compared with the multispecific
liver Na+-bile acid cotransporter.
Whereas the liver Na+-bile acid
cotransporter may have evolved to aid in the hepatic clearance of
steroid sulfates, organic anion metabolites, and xenobiotics (13), the
ileal and renal Na+-bile acid
cotransporter retained a narrow specificity for the reclamation of bile
acids. This narrow substrate specificity agrees with the physiological
location of the transporter in the enterohepatic circulation (6, 7). In
the lumen of the ileum or the renal proximal tubules, bile acids are
efficiently recovered, whereas many non-bile acid metabolites and
xenobiotics are destined for elimination in the feces or urine.
 |
ACKNOWLEDGEMENTS |
The nucleotide sequence reported in this study has been submitted
to the GenBank/EMBL Data Bank with accession no. U10417.
 |
FOOTNOTES |
This work was supported by the National Institute of Diabetes and
Digestive and Kidney Diseases (NIDDK) Grant DK-47987 and by an American
Gastroenterology Association/Janssen Pharmaceutical Research Scholar
Award to P. A. Dawson. P. A. Dawson is an American Heart Association
Established Investigator. R. W. Daniel was supported by National Heart,
Lung, and Blood Institute (NHLBI) Cardiovascular Pathology National
Service Training Award HL-07115. M. W. Love was supported by NHLBI
Cardiovascular Pathology National Service Training Award HL-07115. M. H. Wong is the recipient of NIDDK Predoctoral Fellowship DK-08718.
Present addresses: L. C. Kirby, Dept. of Physiology, East Carolina
Univ. School of Medicine, Greenville, NC 27834; R. W. Daniel, Dept. of
Internal Medicine, Division of Infectious Diseases, Bowman Gray School
of Medicine, Winston-Salem, NC 27157; M. H. Wong, Dept. of Molecular
Biology and Pharmacology, Washington Univ. School of Medicine, St.
Louis, MO 63110.
Address for reprint requests: P. A. Dawson, Dept. of Internal Medicine,
Division of Gastroenterology, Bowman Gray School of Medicine, Medical
Center Blvd., Winston-Salem, NC 27157.
Received 7 August 1997; accepted in final form 9 October 1997.
 |
REFERENCES |
1.
Barnard, J. A.,
and
F. K. Ghishan.
Taurocholate transport by human ileal brush border membrane vesicles.
Gastroenterology
93:
925-933,
1987[Medline].
2.
Chawla, A.,
P. I. Karl,
R. N. Reich,
G. Narasimhan,
G. A. Michaud,
S. E. Fisher,
and
B. L. Shneider.
Effect of olsalazine on sodium-dependent bile acid transport in rat ileum.
Dig. Dis. Sci.
40:
943-948,
1995[Medline].
3.
Christie, D.-M.,
P. A. Dawson,
S. Thevananther,
and
B. L. Shneider.
Comparative analysis of the ontogeny of a sodium-dependent bile acid transporter in rat kidney and ileum.
Am. J. Physiol.
271 (Gastrointest. Liver Physiol. 34):
G377-G385,
1996[Abstract/Free Full Text].
4.
Dawson, P. A.,
and
P. Oelkers.
Bile acid transporters.
Curr. Opin. Lipidol.
6:
109-114,
1995[Medline].
5.
Dawson, P. A.,
and
M. H. Wong.
The apical membrane bile acid transporter of the ileal enterocyte.
Proc. Falk Symp.
80:
197-204,
1995.
6.
Hofmann, A. F.
Intestinal absorption of bile acids and biliary constituents: the intestinal component of the enterohepatic circulation and the integrated system.
In: Physiology of the Gastrointestinal Tract, edited by L. R. Johnson. New York: Raven, 1994, p. 1845-1865.
7.
Hofmann, A. F.
Bile acids.
In: The Liver: Biology and Pathobiology, edited by I. M. Arias,
J. L. Boyer,
N. Fausto,
W. B. Jakoby,
D. A. Schachter,
and D. A. Shafritz. New York: Raven, 1994, p. 677-717.
8.
Johnstone, R.
Ion-coupled cotransport.
Curr. Opin. Cell Biol.
2:
735-741,
1990[Medline].
9.
Kozak, M.
The regulation of translation in eukaryotic systems.
Annu. Rev. Cell Biol.
8:
197-225,
1992.
10.
Krag, E.,
and
S. F. Phillips.
Active and passive bile acid absorption in man. Perfusion studies of the ileum and jejunum.
J. Clin. Invest.
53:
1686-1694,
1974.
11.
Lack, L.
Properties and biological significance of the ileal bile salt transport system.
Environ. Health Perspect.
33:
79-90,
1979[Medline].
12.
Lewis, M. C.,
L. E. Brieaddy,
and
C. Root.
Effect of 2164U90 on ileal bile acid absorption and serum cholesterol in rats and mice.
J. Lipid Res.
36:
1098-1105,
1995[Abstract].
13.
Meier, P. J.
Molecular mechanisms of hepatic bile salt transport from sinusoidal blood into bile.
Am. J. Physiol.
269 (Gastrointest. Liver Physiol. 32):
G801-G812,
1995[Abstract/Free Full Text].
14.
Oelkers, P.,
J. E. Heubi,
and
P. A. Dawson.
Primary bile acid malabsorption caused by mutations in the ileal sodium-dependent bile acid transporter gene (SLC10A2).
J. Clin. Invest.
99:
1880-1887,
1997[Medline].
15.
Raedsch, R.,
B. H. Lauterburg,
and
A. F. Hofmann.
Altered bile acid metabolism in primary biliary cirrhosis.
Dig. Dis. Sci.
26:
394-401,
1981[Medline].
16.
Ridgway, N. D.,
P. A. Dawson,
Y. K. Ho,
M. S. Brown,
and
J. L. Goldstein.
Translocation of oxysterol binding protein to Golgi apparatus triggered by ligand binding.
J. Cell Biol.
116:
307-319,
1992[Abstract/Free Full Text].
17.
Rodrigues, C. M. P.,
B. T. Kren,
C. J. Steer,
and
K. D. R. Setchell.
The site-specific delivery of ursodeoxycholic acid to the rat colon by sulfate conjugation.
Gastroenterology
109:
1835-1844,
1995[Medline].
18.
Rudman, D.,
and
F. E. Kendall.
Bile acid content of human serum. I. Serum bile acids in patients with hepatic disease.
J. Clin. Invest.
36:
530-537,
1957.
19.
Sauer, P.,
P. Kloters-Plachey,
and
A. Stiehl.
Inhibition of ileal bile acid transport by cyclosporin A in rat.
Eur. J. Clin. Invest.
25:
677-682,
1995[Medline].
20.
Schroeder, A.,
B. Hagenbuch,
B. Stieger,
R. Tynes,
C. D. Schteingart,
A. F. Hofmann,
and
P. J. Meier.
The rat hepatocyte Na+/taurocholate cotransporting polypeptide (Ntcp) mediates multispecific substrate transport in stably transfected chinese hamster ovary (CHO) cells (Abstract).
Gastroenterology
106:
979,
1994.
21.
Segal, I. H.
Enzyme Kinetics: Behavioral Analysis of Rapid Equilibrium and Steady-State Enzyme Systems. New York: Wiley, 1993, p. 1-957.
22.
Shneider, B. L.,
P. A. Dawson,
D.-M. Christie,
W. Hardikar,
M. H. Wong,
and
F. J. Suchy.
Cloning and molecular characterization of the ontogeny of a rat ileal sodium-dependent bile acid transporter.
J. Clin. Invest.
95:
745-754,
1995