|
|
||||||||
Department of Physiology, School of Medicine, University of Nevada, Reno, Nevada 89557
| |
ABSTRACT |
|---|
|
|
|---|
Kv2.2, homologous to the shab family of Drosophila voltage-gated K+ channels, was isolated from human and canine colonic circular smooth muscle-derived mRNA. Northern hybridization analysis performed on RNA prepared from tissues and RT-PCR performed on RNA isolated from dispersed and selected smooth muscle cells demonstrate that Kv2.2 is expressed in smooth muscle cells found in all regions of the canine gastrointestinal (GI) tract and in several vascular tissues. Injection of Kv2.2 mRNA into Xenopus oocytes resulted in the expression of a slowly activating K+ current (time to half maximum current, 97 ± 8.6 ms) mediated by 15 pS (symmetrical K+) single channels. The current was inhibited by tetraethylammonium (IC50 = 2.6 mM), 4-aminopyridine (IC50 = 1.5 mM at +20 mV), and quinine (IC50 = 13.7 µM) and was insensitive to charybdotoxin. Low concentrations of quinine (1 µM) were used to preferentially block the slow component of the delayed rectifier current in native colonic myocytes. These data suggest that Kv2.2 may contribute to this current in native GI smooth muscle cells.
colon; potassium channel; cloning; cDNA
| |
INTRODUCTION |
|---|
|
|
|---|
K+ channels of smooth muscle plasma membranes regulate contraction by setting the membrane potential, thus controlling the influx of Ca2+ through voltage-gated Ca2+ channels. Voltage-clamp studies of isolated myocytes have characterized K+ currents and identified two types of outwardly rectifying K+ channels: voltage-gated "delayed rectifier" channels that are insensitive to intracellular Ca2+, along with Ca2+- and voltage-activated channels (e.g., large-conductance Ca2+-activated K+ channels). Furthermore, the delayed rectifier current in canine colonic smooth muscle consists of three current components with characteristic voltage dependencies, kinetics, and pharmacology (4). In particular, IdK(f) is a fast-activating current blocked by micromolar concentrations of 4-aminopyridine (4-AP), IdK(s) is a slowly activating current blocked by tetraethylammonium (TEA), and IdK(n) is a TEA-sensitive current that inactivates at negative potentials.
Although some of the functions of these channel types have been elucidated by pharmacological and physiological studies of intact smooth muscle cells (2, 10, 12, 34), much important information about their roles in the control of smooth muscle function remains to be revealed. This is due in part to difficulties interpreting data from preparations expressing several different kinds of K+ channels. The difficulty is compounded when the dissection is approached at the single-channel level (18). An alternate approach to these questions is the application of molecular biological techniques that identify genes encoding different K+ channels and that produce cells expressing only one kind of K+ channel for electrophysiological study. We (14, 22) have used this approach and probed mRNA isolated from gastrointestinal (GI) and vascular smooth muscles with degenerate oligonucleotide primers designed to hybridize to conserved sequences surrounding the pore region of members of the Kv1-4 family of K+ channels. This has led to the cloning and expression of two delayed rectifier K+ channels [Kv1.2 (14) and Kv1.5 (22)]. Heterotetramers of the proteins encoded by these genes probably underlie IdK(f) in canine colonic smooth muscle (27).
In the present study, we describe the identification of transcripts
encoding a Kv2.2 channel in myocytes from several smooth muscles. This
family, related to the shab channels
in Drosophila, was first characterized
in mammalian brain by Hwang et al. (16), who found that Kv2.1 and Kv2.2
transcripts were differentially localized in the central nervous system
and that currents mediated by Kv2.2 activated relatively slowly and
were inhibited by TEA. Slow activation is apparently a unique feature
of Kv2 channels, as it has been observed in Kv2.1 (11) but not in other
Kv families. In contrast, the sensitivity of the Kv2.1 channels to 4-AP
varies among the members of the family: Frech et al. (11) found a high sensitivity, whereas Pak et al. (24) found that their channels were
virtually insensitive to this agent. We describe the
electrophysiological and pharmacological properties of Kv2.2 cloned
from human and canine colonic smooth muscle. We also
determine the transcriptional expression pattern of Kv2.2 and a
-subunit (
4)
found to couple to Kv2.2 (9), in isolated myocytes of several GI,
uterine, and vascular smooth muscles utilizing RT-PCR on mRNA prepared from isolated myocytes and Northern hybridization on mRNA prepared from
tissue. We suggest that Kv2.2 may underlie a component of delayed
rectifier current in many smooth muscles.
| |
METHODS |
|---|
|
|
|---|
Tissue dissection and mRNA preparation. Canine colonic circular and longitudinal muscles were dissected as previously described (3). Samples of human sigmoid colon were obtained from 23 volunteer patients during elective colon resections for nonobstructive neoplasms and provided to us by Byron McGregor (Department of Surgery, University of Nevada). Circular smooth muscle was prepared from human tissue as described previously (17). GI and other smooth muscle tissues were dissected free of fat and connective tissue under a dissecting microscope. Poly(A)+ RNA was prepared from dissected tissue using the Fast Track kit (Invitrogen, San Diego, CA), according to the manufacturer's instructions. Muscles from four to five animals (0.3-0.5 g) were pooled for each RNA preparation. Each sample of RNA was adjusted to the same concentration. Poly(A)+ RNA was also isolated from canine brain using this method.
Total RNA preparation from isolated myocytes.
Elongated smooth muscle cells were identified under magnification using
the same criteria as that used for electrophysiological examination.
These cells (50-60) were drawn up into a capillary pipette and
expelled into a 0.5-ml tube. Only spindle-shaped cells (length
20-500 µM; diameter 5-60 µM) were selected. The cells were snap frozen in liquid nitrogen and stored at
70°C until RNA preparation. RNA was prepared from isolated cells using a modification of the guanidinium thiocyanate procedure (7). Polyinosinic
acid (20 µg) was added as a carrier (35). Myocytes from the circular
and longitudinal muscle layers of tissues from several regions of the
GI tract and other smooth muscles were prepared, as previously
described (5).
cDNA isolation and nucleotide sequencing. Canine Kv2.2 (cKv2.2) and human Kv2.2 (hKv2.2) cDNAs were isolated with a modified RT-PCR method (30). First-strand cDNA was prepared from human and canine colonic circular smooth muscle-derived mRNA in a 60-µl reaction containing 100 ng of oligo(dT) primers or random oligonucleotides, 12 µl of 5× first-strand buffer (GIBCO-BRL, Gaithersburg, MD), 6 µl of 0.1 M dithiothreitol, 15 µl of 5 mM dNTPs (Invitrogen), 200 U of Moloney murine leukemia virus RT (GIBCO-BRL), 40 U of RNase inhibitor (Promega, Madison, WI), and 300 ng of poly(A)+ RNA. The reaction was incubated at room temperature for 10 min and at 42°C for 50 min, then heated to 70°C for 15 min, and cooled on ice for 10 min. We added 20 U of RNase H (Promega), and the reaction was further incubated for 20 min.
PCR was performed utilizing several overlapping primer oligonucleotides. Initially, degenerate primers designed to amplify the conserved pore region for the mammalian Kv2 family were used to determine if any Kv2 homologue was expressed in colonic myocytes. Once an amplification product corresponding to the Kv2.2 pore region was identified, oligo(dT) and specific primers designed to hybridize to sequence in the 3' untranslated region were used as 3' anchor-reverse primers in conjunction with several primers (in individual reactions) encoding regions of the rat Kv2.2 (rKv2.2) sequence (16) for the 5' forward primer. Nucleotide positions (nt) are relative to the cKv2.2 coding sequence. The primers used were as follows: primer 1, (pore forward) 5'-CTCCA(A,C)- GA(A,G)TCCAACAA(A,G)AG(C,T)GTGC-3' (nt 847-871); primer 2, (pore reverse) 5'-TTCAT(A,G)GA(A,C,T)ACGATGCT(G,T)CC(A,G)-3' (nt 1338-1358); primer 3, 5'-CCATGGCAGAAAAGGCACCTCCTGG-3' (nt
2-23);
primer
4,
5'-GGGAAGCTCCGAGACTGTAACACGC-3' (nt 184-208); primer
5,
5'-CCCAACTCATTGTAACTCCGCC-3' (nt 985-1007); and
primer 6,
5'-CCAGTGTCTATTTCAGTGAAGCTCC-3' (nt
2393-2417). In the 5' region of rKv2.2 sequence, an anchor
primer based on the sequence just upstream from the start codon was
utilized (primer
3). This primer was used in
conjunction with primers
2 and
5 (in individual reactions) encoding
conserved regions of Kv2.2 structure for the 3' reverse primer.
In the 3' region primer
5 was used as the anchor primer and
paired with primers
1, 3,
and 4.
PCR was performed in a reaction volume of 50 µl in buffer containing
2.3 mM MgCl2, 0.1 mM of each dNTP,
0.2 µM of each primer, and 0.5 U of
Taq polymerase (Promega). The reaction
was performed with an initial denaturation of 5 min followed by 33 cycles (94°C for 30 s; 55°C for 30 s; 72°C for 20 s) and a
final extension step of 10 min at 72°C in a thermal cycler (Coy).
Reaction products (3 µl) were electrophoresed through a 1%
agarose-40 mM Tris acetate, 2 mM EDTA gel and visualized with ethidium
bromide.
Amplification products were subcloned into the PCR II vector
(Invitrogen) using direct ligation in a 10-µl reaction containing 2 µl of the amplification products, 1 µl (10 ng) T/A vector DNA, 1 µl 10× ligation buffer (Invitrogen), and 4 U of T4 ligase
(Invitrogen). The ligation reaction was transformed into competent
Escherichia coli and spread onto
ampicillin plates. White colonies were picked (blue/white selection)
and analyzed for amplification product inserts. Subclones were analyzed
by nucleotide sequencing. Several were analyzed for each product
subcloned, and overlapping regions were examined for sequencing
accuracy. To determine transcriptional expression from isolated cells
derived from GI, vascular, and uterine smooth muscles, a primer pair
was designed from the deduced cKv2.2 nucleotide sequence. The region is
specific for Kv2.2 and corresponds to nt 184-1007
(primers
4 and
5), generating an 823-nt amplification product. Expression of the Kv2.2
-subunit
4 (9) was determined by RT-PCR
analysis using primers designed from the
4 sequence to be specific for
this cDNA (forward, ATGTCAAGAGGGTATGGTCTGATAT, nt 1-24 of the
coding sequence; reverse, CCAAGAGCGCATCTATTTCCACCAC, nt 701-724 of
the coding sequence). Expression of Kv8.1 was determined by RT-PCR
analysis using primers designed from the Kv8.1 sequence to be specific
for this cDNA (15) (forward, TCAACGTGGGCGGCAGCCGCTTCGT, nt
290-317 of the coding sequence; reverse,
CCTTCTTAAAGTCCAGCGTTTCGCT, nt 646-670 of the coding sequence).
For expression of the complete Kv2.2 open reading frame (ORF), two
clones that overlapped by 500 bp were joined by ligation at a common
BamH I site. This
construct was subcloned into a Xenopus oocyte expression vector (pSP64T) (19) (kindly provided by D. Melton,
Harvard University, Cambridge, MA) downstream from the SP6 promoter.
The plasmid was linearized with Kpn I,
and capped transcripts were synthesized in vitro with SP6 RNA
polymerase, as described previously (19). Transcripts were resuspended
in 10 mM Tris (pH 7.4), 1 mM EDTA at a final concentration of 1 µg/µl.
Northern analysis. RNA was size fractionated on 1.0% agarose-formaldehyde gels and transferred to Immobilon filters (33). Filters were baked and prehybridized in 50% formamide, 5× SSC (1× SSC is 0.15 M NaCl and 0.015 M sodium citrate, pH 7.0), 50 mM sodium phosphate, 5× Denhardt's solution, sonicated salmon sperm DNA (50 µg/ml), 0.1% SDS, and 10% dextran sulfate at 42°C overnight. Restriction endonuclease fragment (Bgl II) specific for Kv2.2 was prepared from the clone (nt 1-389), and the probe was labeled with 32P by using a random-primer technique (8). Hybridization was performed under the same conditions overnight. The filters were washed at high stringency (3 times in 2× SSC at room temperature for 5 min each, then twice for 30 min each in 0.2× SSC, 0.1% SDS at 65°C) to ensure specificity of labeling. Specific for a Chinese hamster ovary (CHO) cell mRNA expressed at equivalent levels in all tissue examined (13), a cDNA of CHO-B was used as an internal standard to verify that equal amounts of poly(A)+ RNA were applied. After hybridization, filters were exposed to intensifying screens and autoradiography was performed using a Bio-Rad Phosphorimager (Hercules, CA).
Oocyte injection and electrophysiological methods. Ovarian lobes were removed from anesthetized adult female Xenopus laevis frogs (Xenopus 1, Ann Arbor, MI) under sterile conditions. The lobes were then mechanically opened, and the oocyte follicular layer was removed by incubation with collagenase (1 mg/ml) in Ca2+-free ND96 (see below) solution at room temperature for 2-3 h. The oocytes were then collected, rinsed, and stored in ND96 solution containing (in mM) 2.5 pyruvate, 96 NaCl, 1.5 CaCl2, 2 KCl, 1 MgCl2, and 5 HEPES plus antibiotics (100 U/ml penicillin, 100 µg/ml streptomycin) at 19°C for up to 24 h before injection. Only stage V and VI oocytes were selected for injection. mRNA (1 µg/µl) was injected in a total volume of 50 nl, and the oocytes were stored for 2-4 days until assay.
Whole cell K+ currents were recorded using the double-electrode voltage-clamp technique (GeneClamp 500, Axon Instruments, Foster City, CA). Microelectrodes were filled with 3 M KCl and had resistances of 1-3 M
. Recordings were made
at room temperature in a solution containing (in mM) 96 NaCl, 2 KCl,
2.8 MgCl2, and 5 HEPES, pH 7.4. Ca2+ was omitted from the solution
to minimize the endogenous
Ca2+-activated chloride currents.
Single K+ channels were recorded
in inside-out patches obtained from oocytes after mechanical removal of
the vitelline membrane as described by Methfessel et al. (20). Currents
were recorded by an Axopatch-1D amplifier (Axon Instruments) and
filtered at 500 Hz before digitization. Patch pipettes were filled with
(in mM) 140 KCl, 0.1 GdCl3, and 10 HEPES, pH 7.2. The bath solution contained (in mM) 140 KCl, 0.1 GdCl3, 10 HEPES, and 1 EGTA, pH
7.2. To establish the selectivity of the channels, 140 mM KCl was
replaced with NaCl in some experiments. GdCl3 was included to inhibit
stretch-activated channels. In all voltage-clamp experiments, data
acquisition and analyses were done using pCLAMP software (Axon
Instruments). Data are expressed as means ± SE.
Native colonic myocytes were dispersed and patch-clamp recordings
performed as previously described (4). Bath solution contained (in mM)
140 NaCl, 5 KCl, 2 MnCl2, 1.2 MgCl2, 10 dextrose, 10 HEPES, and
5 Tris, pH 7.4. Pipette solution contained (in mM) 20 KCl, 110 potassium gluconate, 5 MgCl2, 2.5 K2ATP, 0.1 Na2GTP, 2.5 disodium creatine
phosphate, 5 HEPES, and 1 1,2-bis(2-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (pH 7.2).
In some experiments, 4-AP (5 mM), TEA (10 mM), and quinine (1 µM)
were added to the bath.
| |
RESULTS |
|---|
|
|
|---|
cDNA cloning and DNA sequence analysis. RT-PCR utilizing primers designed to generate several overlapping amplification products was used to construct the full ORF for the canine and human homologues of Kv2.2 cDNA. Several primer combinations resulted in amplification products overlapping in both the 5' and 3' orientations (see METHODS). Amplification products were separated on agarose gels and analyzed specifically for products of an unexpected size, which might indicate alternative splicing or homologous isoforms. Gels were also blotted and hybridized to previously isolated Kv2.2-specific amplification products as probes to detect low-level transcriptional expression of alternated forms of Kv2.2. None were detected for these amplifications. At least five individual subclones were completely sequenced for each of the overlapping products to ensure the fidelity of the RT-PCR reaction. We constructed a full-length ORF using two amplification products overlapping by 823 nt (3' primers 5 and 6; 5' primers 3 and 4). The complete amino acid sequence of the cKv2.2 and hKv2.2 clones is shown in Fig. 1. The sequence is aligned with the translated rat brain cDNA sequence (16). Nucleotide sequence homology and amino acid sequence identity of cKv2.2 is 84.9% and 91.7% with hKv2.2 and 82.9% and 88.3% with rKv2.2. The majority of sequence divergence occurs in the carboxy-terminal domain.
|
Northern hybridization of cKv2.2 in visceral and vascular smooth muscles. Poly(A)+ RNA was prepared from several dissected regions of the canine GI tract. Longitudinal and circular muscle layers were separated. Smooth muscle tissue from coronary artery (>300-µm-diameter vessels) was also analyzed to determine the distribution of this smooth muscle-derived K+ channel in a vascular smooth muscle. Canine brain tissue was also included to compare expression in the tissue source used for the initial cloning of Kv2.2 (16). A cDNA of CHO-B, specific for a CHO cell mRNA expressed at equivalent levels in all tissues examined (13), was used as an internal standard to verify that equal amounts of poly(A)+ RNA were applied. A specific probe for Kv2.2 was used for the hybridization. Figure 2A displays the autoradiogram resulting from the hybridization.
|
RT-PCR analysis of transcriptional expression of Kv2.2 in canine
smooth muscle cells.
To eliminate the possibility that detection of transcriptional
expression of Kv2.2 was due to expression in a minor cell population in
the smooth muscle (i.e., nerve, endothelial, interstitial cells), we
prepared RNA from isolated smooth muscle cells. Myocytes were dispersed
from several canine smooth muscles, including several regions of the GI
tract, uterus, and vascular muscles. Fifty to sixty cells were
identified based on criteria previously used for selection of cells for
electrophysiological studies (4). Only spindle-shaped
cells (length 20-500 µm; diameter 5-60 µm) were selected.
Total RNA was prepared from the selected cells, and specific primers,
designed to amplify an 823-nt product of cKv2.2, were used in the
RT-PCR reaction. Although colonic longitudinal muscle displayed
relatively little amplification product, product was detectable on
longer photographic exposure. The Kv2.2
4 auxiliary subunit expression
was determined by using oligonucleotides specific for this cDNA and
designed to amplify a 724-nt product. Expression of both Kv2.2 and
4 was detected in cells from
all of the smooth muscles tested (Fig.
2B). In contrast, Kv8.1, a Kv
channel found to be associated with Kv2.2 in neuronal tissues (15), was
not detected in any smooth muscle tested. The primers do amplify the appropriately sized product from canine brain (data not shown). PCR
performed on cDNA from an RT reaction in which no RT was included did
not generate any amplification product. This negative control tests
whether DNA contaminates the RNA prepared from the isolated cells. We
did not perform quantitative PCR on these samples and cannot report on
the relative levels of transcriptional expression in different smooth
muscle cells.
Kv2.2 whole cell current in Xenopus oocytes.
Oocytes injected with cRNA encoding hKv2.2 had large outward currents
activated by depolarizations to potentials positive to
20 mV.
There were no differences in the currents recorded from either cKv2.2
or hKv2.2. These currents were observed in >95% of oocytes injected
with cRNA but not in water-injected controls. Furthermore, they were
sensitive to K+ channel blockers
and mediated by K+-selective
single channels (see below). Accordingly, we attribute them to the
expression of injected Kv2.2 cRNA. Figure 3
summarizes the activation and steady-state inactivation properties of
this current. Currents were elicited by 400-ms step depolarizations from
80 mV (Fig. 3A). A
voltage-dependent conductance was activated at potentials positive to
20 mV. The midpoint of the conductance vs. voltage relationship
was +5 ± 6 mV (n = 9), and the
conductance increased e-fold per 12 ± 1.1 mV (n = 9). There was no
inactivation apparent during 400-ms depolarizations, and the
current-voltage relationship was constructed by averaging the currents
from eight oocytes and plotting the current at 400 ms as a function of
step potential (Fig. 3B).
|
10 to
+50 mV. Furthermore, at a test potential of +10 mV,
t1/2 from a
holding potential of
80 mV was 97 ± 8.6 ms
(n = 14).
Although there was no apparent inactivation over 400 ms, the Kv2.2
channels did inactivate during longer depolarizations. We measured the
voltage-dependent inactivation of the channels using 20-s conditioning
pulses to various potentials followed by 400-ms test steps to +20 mV
(Fig. 3C,
inset). Inspection of the currents
during the conditioning steps revealed that a very slow inactivation
process was still under way at the end of 20 s. Thus our results only
approximate the true steady-state inactivation. We found that
inactivation at the end of 20 s was well described by a Boltzmann
function
|
16.3
mV is the prepulse potential for half inactivation, and
Vs =
4.8
is the slope factor.
Pak et al. (24) found that the Kv2.1 channels encoded by
Drosophila and mouse genes had
different rates of recovery from inactivation so that
Drosophila channels were nearly
completely recovered after 1 s at
90 mV, whereas mouse channels
took longer than 10 s to recover. We investigated this process in
smooth muscle Kv2.2 channels using a similar protocol. In particular,
oocytes were held at
60 mV and stepped for 10 s to +20 mV, for 1 s to
60 mV, and then to +20 mV for a 1-s test pulse. In seven
oocytes tested with this protocol the current inactivated at the end of the conditioning pulse to 0.59 ± 0.02 of the peak current and the
current in the test pulse was 0.72 ± 0.03 of the peak current (Fig.
4A).
That is, similar to mammalian Kv2.1 currents, smooth muscle Kv2.2
currents showed little recovery from inactivation during a 1-s
repolarization to
60 mV. We investigated the time course of this
process in more detail by increasing the duration of the interval
between the conditioning and test steps up to 10 s (Fig.
4B). Test steps after recovery
intervals <2-s long elicited peak currents only slightly larger than
the current at the end of the conditioning step, suggesting that Kv2.2
channels show "cumulative inactivation" (1, 24). For longer
periods, recovery showed at least two phases, including a relatively
rapid phase during which about one-half of the inactivation was
removed. Full recovery took longer than 2 min.
|
Single-channel recordings from Kv2.2 expressed in oocytes.
We recorded single-channel currents from three inside-out patches
obtained from oocytes after mechanical removal of the vitelline membrane. Small conductance channels were observed in patches from
oocytes that had been kept for 3-10 days after injection with 50 ng of cRNA. Channel openings were rarely seen at potentials negative to
40 mV, but the likelihood of observing activity increased with
further depolarization. Currents were recorded under the condition of
symmetrical K+ gradient, and we
have selected the traces to show channel activity (Fig.
5A). In
this case, the current-voltage relationship was linear (see Fig.
5B), reversed at 0 mV, and had a
slope conductance of 15.3 ± 0.1 pS. Under an
asymmetrical K+ gradient (170 mM
bath/intracellular vs. 2 mM pipette/extracellular), the channel current
rectified in the outward direction. We fit the currents with the
Goldman-Hodgkin-Katz current equation and obtained similar
permeabilities (2.1 × 10
14 cm/s in symmetrical
K+ vs. 2.8 × 10
14 cm/s in asymmetrical
K+). Furthermore, the
extrapolated reversal potential in the asymmetrical condition was close
to the K+ equilibrium potential,
indicating that the channel was highly selective for
K+.
|
Pharmacological characterization of Kv2.2 expressed in oocytes.
In view of the differing pharmacological profiles of
IdK(s) and
IdK(f), it was of
interest to characterize the response of the Kv2.2 currents to 4-AP and
TEA. Figure 6,
A and
B, shows membrane currents elicited by
steps from
60 to +50 mV in control and in the presence of 0.1 and 1 mM concentrations of 4-AP and TEA. Inhibition of Kv2.2 currents
by 4-AP and TEA was dose dependent (Fig. 6, D and
E). Furthermore, block by 4-AP was
voltage dependent over the range +10 to +50 mV, being less effective at
more positive potentials as has been demonstrated previously for Kv1.2
(14). At +10 mV, the IC50 was 1.5 ± 0.1 mM (n = 10) for 4-AP and 2.6 ± 0.9 mM (n = 5) for TEA. In
addition we tested the effect of quinine, a known blocker of delayed
rectifier current. We previously found that quinine blocked Kv1.5
(IC50 = 365 µM) (22). As shown in Fig. 6, C and
F, quinine was a potent inhibitor of
Kv2.2 with an IC50 of 14 µM
(n = 10). Block by quinine was not
voltage dependent. Kv2.2 was not blocked by charybdotoxin (>300 nM)
or iberiotoxin (>300 nM).
|
Delayed rectifier currents recorded from native myocytes. Because of the potent inhibition of Kv2.2 with quinine, we examined the sensitivity of the delayed rectifier current in native colonic myocytes to quinine in combination with 4-AP and TEA. 4-AP (5 mM) significantly increased the t1/2 (23.5 ± 2.4 ms, n = 6) of the delayed rectifier current compared with control value (12.3 ± 1.6 ms) at +20 mV. However, TEA (10 mM) and quinine (1 µM) did not change t1/2 [11.5 ± 1.2 vs. 12.3 ± 1.0 ms, TEA (n = 5) vs. quinine (n = 6), respectively] (Fig. 7, A, B, and C). 4-AP reduced the delayed rectifier K+ current [35.1 ± 2.9%, n = 6, 413 ± 17 pA (control) vs. 286 ± 14 pA (4-AP)]. Application of quinine (10 µM) resulted in additional reduction of the current (56.5 ± 4.7%, n = 6, 179 ± 23 pA) in the presence of 4-AP (5 mM) (Fig. 7, D and F). However, application of quinine did not further reduce delayed rectifier current in the presence of TEA (10 mM) (57.1 ± 6.4% of inhibition, n = 7; 173 ± 28 pA) and did not show additional reduction before and after treatment of TEA (10 mM, 55.3 ± 5.1% of inhibition, n = 7; 171 ± 22 vs. 376 ± 41 pA of control) (Fig. 7, E and F). These data are consistent with quinine, at low concentration (10 µM), blocking the TEA-sensitive component of delayed rectifier current and blocking a slower activating current component.
|
| |
DISCUSSION |
|---|
|
|
|---|
Although the general importance of the plasmalemmal K+ conductance to smooth muscle function is well accepted, the specific roles of individual K+ channels are unclear and considerable effort is currently directed to the linking of K+ channels to function in a variety of smooth muscles. One approach to this problem is based on the characterization of the components of K+ current in smooth muscle myocytes and the molecular identification of the channels that mediate them. In the present study, we have identified a molecular component of the delayed rectifier current in GI smooth muscle cells, determined its transcriptional expression in several GI muscle types, and studied the properties of the channels expressed by Xenopus oocytes.
Because the goal of our study was the identification of
K+ channels in smooth muscle
myocytes, it was important to consider that smooth muscle tissues
contain several cell types that might contribute mRNA to the PCR
reaction used to detect expression of the
K+ channel gene. Accordingly, we
analyzed the distribution of Kv2.2 transcriptional expression by
Northern analysis and collected and amplified mRNA from myocytes
prepared using methods developed for electrophysiological studies (4,
21, 25, 34). Thus we know that the Kv2.2 expression
described here is at levels sufficient to be detected by Northern
hybridization and that Kv2.2 expression is localized to the smooth
muscle myocytes. Interestingly, we found Kv2.2 is expressed in GI,
vascular, and uterine smooth muscle myocytes, i.e., in all types
examined. We conclude that, similar to Kv1.5 (22), Kv2.2 is
ubiquitously expressed in smooth muscles. We note that we tested
myocyte preparations for the expression of Kv2.1 using primers designed
to distinguish between Kv2.1 and Kv2.2 but failed to find evidence for
the expression of Kv2.1 mRNA (data not shown). The expression of other,
as yet unidentified, Kv2 family members in these cells is not excluded
by this result. Recently, an auxiliary
-subunit
(
4) has been identified that couples specifically to Kv2.2 and enhances its expression level in
Xenopus oocytes (9). Using primers
specific for this cDNA, we have demonstrated the transcriptional
expression of
4 in GI and
vascular smooth muscles. However, expression of Kv8.1, a new Kv channel
with interesting regulatory properties toward the Kv2 family (15, 29),
has not been detected in canine smooth muscles.
We find that Kv2.2 channels are activated at potentials positive to
about
20 mV as are Kv2.2 channels from rat brain (16) and Kv2.1
channels (11, 31). This behavior is somewhat different from the
mShab (Kv2.1) channels that are
activated at more negative potentials (23). For all of these channels,
the rate of activation is slow compared with that of members of the Kv1
family. In particular, we reported that smooth muscle cKv1.2 and cKv1.5
channels have t1/2 values of
7.6 and 5.5 ms, respectively (14, 22), similar to other Kv1 channels.
In contrast, the smooth muscle Kv2.2 channel described here has a
t1/2 of 97 ms (at
+10 mV). This is similar to the behavior of Kv2.1 channels found by Frech et al. (11), faster than the channels described by Pak et al.
(24), but slower than the activation of rat brain Kv2.2 (16). We also
studied the single channels encoded by the smooth muscle Kv2.2 and
found that they were selective for
K+, were opened by depolarization,
and that they had a single-channel conductance of 15.3 pS. This is
similar to that reported by Fink et al. (9) for the Kv2.2 clone
characterized by Hwang et al. (16) and similar to Kv1.2 and Kv1.5
smooth muscle K+ channels, which
have single-channel conductances of 14 and 9.8 pS, respectively (14,
22), making these channels underlying the delayed rectifier current
difficult to dissect in native cells at the single-channel level.
The development of voltage-dependent inactivation of smooth muscle Kv2.2 qualitatively resembled that found for Kv2.1 channels (11, 31) in that a large fraction of the current is inactivated over many seconds. Interestingly, we found that the recovery from inactivation was very slow and followed a complex time course. That is, about one-half of the inactivation was reversed over 10 s, whereas full recovery of the current took longer than 2 min. In contrast, Pak et al. (24) found that recovery from inactivation by Drosophila Kv2.1 (fShab) channels was very fast (time constant of 0.4 s) compared with mouse channels (mShab, time constant of 4.2 s). For both channels, recovery was well described by a single exponential process. Thus the recovery from inactivation by smooth muscle Kv2.2 channels is uniquely complex and slow.
Although we have not characterized the recovery from inactivation in detail, it appears to have properties of cumulative inactivation described and modeled by Aldrich (1). Our results imply that although there is little inactivation during a single depolarization of 1- to 5-s duration [i.e., during a single slow wave, (32)], it is expected that inactivation will accumulate during rhythmic depolarizations separated by <10 s and that this inactivation will limit current through Kv2.2 channels in the steady state. An apparent continued development of inactivation during repolarization can be seen in the delayed rectifier currents of colonic smooth muscle myocytes [see Carl (4)].
Carl (4) used a pharmacological approach to identify the components of delayed rectifier K+ current in canine circular colonic smooth muscle and concluded that there are three components of this current: IdK(f), IdK(s), and IdK(n). Carl (4) further reported that the current recorded in the presence of TEA [dominated by IdK(f)] activated relatively quickly, whereas the current recorded in the presence of 4-AP [dominated by IdK(s)] activated relatively slowly. The activation of smooth muscle Kv2.2 showed a sigmoidal time course as do other Kv1 and Kv2 currents. Although Carl (4) reported single exponential time constants to describe the activation of delayed rectifier currents in smooth muscle myocytes, those currents also showed a sigmoidal activation with t1/2 values at +10 mV of 20.6 ms in control [IdK(f) + IdK(s)], 30.3 ms in the presence of 4-AP [largely IdK(s)], and 13.9 ms in the presence of TEA [largely IdK(f)] (A. Carl, personal communication). Thus the rate of activation of IdK(f) is closer to that of the Kv1 channels, whereas the rate of activation of IdK(s) is closer to that of the Kv2 channels. Although there is an approximately threefold difference between t1/2 values of IdK(s) and Kv2.2, quantitative comparison of these parameters is difficult. In particular, the pharmacological dissection of the native currents is likely to be incomplete and some of the current recorded in the presence of 10 mM 4-AP may have been contributed by Kv1 channels. Such a contribution might add to the difference in t1/2 values seen here. Carl (4) found that the delayed rectifier current remaining in the presence of TEA [predominantly IdK(f)] was quite sensitive to 4-AP (IC50 = 23 µM). Thus the sensitivity of IdK(f) to 4-AP resembles that of the Kv1 currents [IC50 values < 211 µM, (14, 23)], and this is one piece of evidence suggesting that IdK(f) is mediated by a heterotetramer formed of Kv1.2 and Kv1.5 subunits (27). The low sensitivity of IdK(s) to 4-AP is closer to the property of smooth muscle Kv2.2 (IC50 at +20 mV = 2 mM), suggesting that Kv2.2 may be a component of IdK(s). The Kv2.2 channels from smooth muscle are very sensitive to quinine [IC50 = 14 µM compared with 365 µM for Kv1.5 (22)]. Therefore, we performed experiments on native colonic myocytes to examine if quinine at low concentrations would preferentially block IdK(s). Figure 7, A-C, shows that in the presence of 5 mM 4-AP [a concentration that blocks all of IdK(f) but only a portion of IdK(s)], the overall delayed rectifier current is reduced and the t1/2 of the remaining current is significantly increased. Combining TEA (5 mM) or quinine (10 µM) [agents that should only block IdK(s) at these concentrations] with 4-AP further reduces the current and changes the t1/2 back to the original level in the absence of blockers. The converse experiment in Fig. 7E shows that when TEA is applied, which only blocks IdK(s), the addition of 10 µM quinine does not further reduce the current and does not change the activation rate. A comparison of the kinetic and pharmacological properties of cloned and native Kv channels from canine colonic smooth muscle is shown in Table 1.
|
In summary, the results reported here and in our previous study (27) suggest that Kv1.2 and Kv1.5 underlie IdK(f), whereas Kv2.2 may be a component of IdK(s) based on similarities of the voltage dependencies of activation, activation kinetics, and the pharmacology of K+ currents recorded in smooth muscle myocytes and in Xenopus oocytes. However, several issues remain outstanding. First among these is the difficulty comparing currents encoded by mammalian genes expressed in Xenopus oocytes with those recorded in native cells. In addition, the potential functions of accessory subunits or Kv channels not yet identified at the molecular level must be considered. Definitive assignments must await antibody studies at the immunocytochemical level combined with antisense knockout experiments in smooth muscle myocytes.
Beech and Bolton (2), Okabe et al. (21), and Robertson and Nelson and colleagues (25, 26) have reported delayed rectifier currents in single smooth muscle cells, outside the GI tract, that are relatively insensitive to 4-AP. Although direct comparisons are not possible because of the voltage sensitivity of 4-AP inhibition of K+ currents (6, 28) and the examination of 4-AP block at different step potentials, our finding Kv2.2 mRNA in all smooth muscle myocytes examined (both GI and non-GI) raises the possibility that this clone may represent a component of the slowly activating K+ current of smooth muscle myocytes from visceral and vascular smooth muscles.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Andreas Carl and Kenton Sanders for discussion and comments on the manuscript and Sherri Bloomer for assistance in data analysis.
| |
FOOTNOTES |
|---|
The nucleotide sequences for hKv2.2 and cKv2.2 have been submitted to the GenBank database with accession nos. U69962 and U69963, respectively.
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-41315.
Address for reprint requests: B. Horowitz, Dept. of Physiology, School of Medicine, Univ. of Nevada, Reno, NV 89557.
Received 18 August 1997; accepted in final form 29 January 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Aldrich, R. W.
Inactivation of voltage-gated delayed potassium current in molluscan neurons: a kinetic model.
Biophys. J.
36:
519-532,
1981
2.
Beech, D. J.,
and
T. B. Bolton.
Two components of potassium current activated by depolarization of single smooth muscle cells from the rabbit portal vein.
J. Physiol. (Lond.)
418:
293-309,
1989
3.
Burke, E. P.,
K. M. Sanders,
and
B. Horowitz.
Sodium pump isozymes are differentially expressed in electrically dissimilar regions of colonic circular smooth muscle.
Proc. Natl. Acad. Sci. USA
88:
2370-2374,
1991
4.
Carl, A.
Multiple components of delayed rectifier K+ current in canine colonic myocytes.
J. Physiol. (Lond.)
484:
339-353,
1995[Medline].
5.
Carl, A.,
and
K. M. Sanders.
Ca2+-activated K+ channels of canine colonic myocytes.
Am. J. Physiol.
257 (Cell Physiol. 26):
C470-C480,
1989
6.
Castle, N. A.,
S. R. Fadous,
D. E. Logothetis,
and
G. K. Wang.
4-Aminopyridine binding and slow inactivation are mutually exclusive in rat Kv1.1 and Shaker potassium channels.
Mol. Pharmacol.
46:
1175-1181,
1994[Abstract].
7.
Chirgwin, J. M.,
A. E. Przybyla,
R. J. MacDonald,
and
W. J. Rutter.
Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease.
Biochemistry
18:
5294-5299,
1979[Medline].
8.
Feinberg, A. P.,
and
B. Volgelstein.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.
Anal. Biochem.
132:
266-267,
1983.
9.
Fink, M.,
F. Duprat,
F. Lesage,
C. Heurteaux,
G. Romey,
J. Barhanin,
and
M. Lazdunski.
A new K+ channel beta subunit to specifically enhance Kv2.2 (CDRK) expression.
J. Biol. Chem.
271:
26341-26348,
1996
10.
Fleischmann, B. K.,
R. J. Washabau,
and
M. I. Kotlikoff.
Control of resting membrane potential by delayed rectifier potassium currents in ferret airway smooth muscle cells.
J. Physiol. (Lond.)
469:
625-638,
1993
11.
Frech, G. C.,
A. M. VanDongen,
G. Schuster,
A. M. Brown,
and
R. H. Joho.
A novel potassium channel with delayed rectifier properties isolated from rat brain by expression cloning.
Nature
340:
642-645,
1989[Medline].
12.
Gelband, C. H.,
and
J. R. Hume.
Ionic currents in single smooth muscle cells of the canine renal artery.
Circ. Res.
71:
745-758,
1992
13.
Harpold, M. M.,
R. M. Evans,
M. G. Salditt,
and
J. E. Darnell.
Production of mRNA in Chinese hamster cells: relationship of the rate of synthesis to the cytoplasmic concentration of nine specific mRNA sequences.
Cell
17:
1025-1035,
1979[Medline].
14.
Hart, P. J.,
K. E. Overturf,
S. N. Russell,
A. Carl,
J. R. Hume,
K. M. Sanders,
and
B. Horowitz.
Cloning and expression of a Kv1.2 class delayed rectifier K+ channel from canine colonic smooth muscle.
Proc. Natl. Acad. Sci. USA
90:
9659-9663,
1993
15.
Hugnot, J. P.,
M. Salinas,
F. Lesage,
E. Guillemare,
J. De Weille,
C. Heurteaux,
M. G. Mattéi,
and
M. Lazdunski.
Kv8.1, a new neuronal potassium channel subunit with specific inhibitory properties towards Shab and Shaw channels.
EMBO J.
15:
3322-3331,
1996[Medline].
16.
Hwang, P. M.,
C. E. Glatt,
D. S. Bredt,
G. Yellen,
and
S. H. Snyder.
A novel K+ channel with unique localizations in mammalian brain: molecular cloning and characterization.
Neuron
8:
473-481,
1992[Medline].
17.
Keef, K. D.,
C. Du,
S. M. Ward,
B. McGregor,
and
K. M. Sanders.
Enteric inhibitory neural regulation of human colonic circular muscle: role of nitric oxide.
Gastroenterology
105:
1009-1016,
1993[Medline].
18.
Koh, S. D.,
K. M. Sanders,
and
A. Carl.
Regulation of smooth muscle delayed rectifier K+ channels by protein kinase A.
Pflügers Arch.
432:
401-412,
1996[Medline].
19.
Krieg, P. A.,
and
D. A. Melton.
Functional messenger RNAs are produced by SP6 in vitro transcription of cloned cDNAs.
Nucleic Acids Res.
12:
7057-7070,
1984
20.
Methfessel, C.,
V. Witzemann,
T. Takahashi,
M. Mishina,
S. Numa,
and
B. Sakmann.
Patch clamp measurements on Xenopus laevis oocytes: currents through endogenous channels and implanted acetylcholine receptor and sodium channels.
Pflügers Arch.
407:
477-488,
1986.
21.
Okabe, K.,
K. Kitamura,
and
H. Kuriyama.
Features of 4-aminopyridine sensitive outward current observed in single smooth muscle cells from the rabbit pulmonary artery.
Pflügers Arch.
409:
561-568,
1987[Medline].
22.
Overturf, K. E.,
S. N. Russell,
A. Carl,
F. Vogalis,
P. J. Hart,
J. R. Hume,
K. M. Sanders,
and
B. Horowitz.
Cloning and characterization of a Kv1.5 delayed rectifier K+ channel from vascular and visceral smooth muscles.
Am. J. Physiol.
267 (Cell Physiol. 36):
C1231-C1238,
1994
23.
Pak, M. D.,
K. Baker,
M. Covarrubias,
A. Butler,
A. Ratcliffe,
and
L. Salkoff.
mShal, a subfamily of A-type K+ channel cloned from mammalian brain.
Proc. Natl. Acad. Sci. USA
88:
4386-4390,
1991
24.
Pak, M. D.,
M. Covarrubias,
A. Ratcliffe,
and
L. Salkoff.
A mouse brain homolog of the Drosophila Shab K+ channel with conserved delayed-rectifier properties.
J. Neurosci.
11:
869-880,
1991[Abstract].
25.
Robertson, B. E.,
and
M. T. Nelson.
Aminopyridine inhibition and voltage dependence of K+ currents in smooth muscle cells from cerebral arteries.
Am. J. Physiol.
267 (Cell Physiol. 36):
C1589-C1597,
1994
26.
Robertson, B. E.,
R. Schubert,
J. Hescheler,
and
M. T. Nelson.
cGMP-dependent protein kinase activates Ca2+-activated K+ channels in cerebral artery smooth muscle cells.
Am. J. Physiol.
265 (Cell Physiol. 34):
C299-C303,
1993
27.
Russell, S. N.,
K. E. Overturf,
and
B. Horowitz.
Heterotetramer formation and charybdotoxin sensitivity of two K+ channels cloned from smooth muscle.
Am. J. Physiol.
267 (Cell Physiol. 36):
C1729-C1733,
1994
28.
Russell, S. N.,
N. G. Publicover,
P. J. Hart,
A. Carl,
J. R. Hume,
K. M. Sanders,
and
B. Horowitz.
Block by 4-aminopyridine of a Kv1.2 delayed rectifier K+ current expressed in Xenopus oocytes.
J. Physiol. (Lond.)
481:
571-584,
1994[Medline].
29.
Salinas, M.,
J. De Weille,
E. Guillemare,
M. Lazdunski,
and
J. P. Hugnot.
Modes of regulation of shab K+ channel activity by the Kv8.1 subunit.
J. Biol. Chem.
272:
8774-8780,
1997
30.
Shen, M. H.,
P. S. Harper,
and
M. Upadhyaya.
Amplification of the total coding sequence of the NF1 gene from peripheral blood lymphocyte RNA.
PCR Methods Applic.
4:
311-313,
1995[Medline].
31.
Shi, G.,
A. K. Kleinklaus,
N. V. Marrion,
and
J. S. Trimmer.
Properties of Kv2.1 K+ channels expressed in transfected mammalian cells.
J. Biol. Chem.
269:
23204-23211,
1994
32.
Smith, T. K.,
J. B. Reed,
and
K. M. Sanders.
Origin and propagation of electrical slow waves in circular muscle of canine proximal colon.
Am. J. Physiol.
252 (Cell Physiol. 21):
C215-C224,
1987
33.
Thomas, P. S.
Hybridization of denatured RNA and small DNA fragment transferred to nitrocellulose.
Proc. Natl. Acad. Sci. USA
77:
5201-5205,
1980
34.
Thornbury, K. D.,
S. M. Ward,
and
K. M. Sanders.
Participation of fast-activating, voltage-dependent K currents in electrical slow waves of colonic circular muscle.
Am. J. Physiol.
263 (Cell Physiol. 32):
C226-C236,
1992
35.
Winslow, S. G.,
and
P. A. Henkart.
Polyinosinic acid as a carrier in the microscale purification of total RNA.
Nucleic Acids Res.
19:
3251-3255,
1991
This article has been cited by other articles:
![]() |
B. Adegunloye, E. Lamarre, and R. S. Moreland Quinine Inhibits Vascular Contraction Independent of Effects on Calcium or Myosin Phosphorylation J. Pharmacol. Exp. Ther., January 1, 2003; 304(1): 294 - 300. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. Cox, K. Folander, and R. Swanson Differential Expression of Voltage-Gated K+ Channel Genes in Arteries From Spontaneously Hypertensive and Wistar-Kyoto Rats Hypertension, May 1, 2001; 37(5): 1315 - 1322. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Xu, Y. Lu, G. Tang, and R. Wang Expression of voltage-dependent K+ channel genes in mesenteric artery smooth muscle cells Am J Physiol Gastrointest Liver Physiol, November 1, 1999; 277(5): G1055 - G1063. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. R. Wade, L. G. Laurier, H. G. Preiksaitis, and S. M. Sims Delayed rectifier and Ca2+-dependent K+ currents in human esophagus: roles in regulating muscle contraction Am J Physiol Gastrointest Liver Physiol, October 1, 1999; 277(4): G885 - G895. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Epperson, H. P. Bonner, S. M. Ward, W. J. Hatton, K. K. Bradley, M. E. Bradley, J. S. Trimmer, and B. Horowitz Molecular diversity of KV alpha - and beta -subunit expression in canine gastrointestinal smooth muscles Am J Physiol Gastrointest Liver Physiol, July 1, 1999; 277(1): G127 - G136. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. Gelband, J. D. Warth, H. S. Mason, M. Zhu, J. M. Moore, J. L. Kenyon, B. Horowitz, and C. Sumners Angiotensin II Type 1 Receptor–Mediated Inhibition of K+ Channel Subunit Kv2.2 in Brain Stem and Hypothalamic Neurons Circ. Res., February 19, 1999; 84(3): 352 - 359. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Thorneloe, T. T. Chen, P. M. Kerr, E. F. Grier, B. Horowitz, W. C. Cole, and M. P. Walsh Molecular Composition of 4-Aminopyridine-Sensitive Voltage-Gated K+ Channels of Vascular Smooth Muscle Circ. Res., November 23, 2001; 89(11): 1030 - 1037. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||