AJP - GI Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 275: G269-G278, 1998;
0193-1857/98 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hellerbrand, C.
Right arrow Articles by Brenner, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hellerbrand, C.
Right arrow Articles by Brenner, D. A.
Vol. 275, Issue 2, G269-G278, August 1998

Cytokines induce NF-kappa B in activated but not in quiescent rat hepatic stellate cells

C. Hellerbrand, C. Jobin, L. L. Licato, R. B. Sartor, and D. A. Brenner

Department of Medicine, University of North Carolina, Chapel Hill, North Carolina 27599-7080

    ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References

The hepatic stellate cell (HSC), after a fibrogenic stimulus, is transformed from a quiescent to an activated phenotype, including the induction of responsiveness to a variety of agonists. We investigated the activation of nuclear factor-kappa B (NF-kappa B) and the expression of the NF-kappa B-responsive genes intercellular adhesion molecule 1 (ICAM-1) and macrophage inflammatory protein-2 (MIP-2) in freshly isolated and culture-activated HSC by tumor necrosis factor-alpha (TNF-alpha ) or interleukin-1beta . Inhibitor-kappa B was rapidly (<15 min) degraded, and NF-kappa B activity was induced in culture-activated but not in freshly isolated HSC after cytokine stimulation. After 30 min of stimulation, immunofluorescence revealed that the NF-kappa B p65 subunit was predominantly found in the nuclei of activated HSC compared with the cytoplasmic localization in unstimulated cells. No nuclear translocation appeared in freshly isolated HSC after stimulation, despite the presence of functional TNF-alpha receptors. NF-kappa B nuclear translocation appeared first partially after 4-5 days and completely after 9 days in culture. Consistent with this time course TNF-alpha induced the mRNA of the NF-kappa B-dependent genes ICAM-1 and MIP-2 in activated but not in quiescent HSC. Therefore, cytokines induce NF-kappa B activity and ICAM-1 and MIP-2 mRNAs in activated but not in quiescent HSC, through a postreceptor mechanism of regulation.

tumor necrosis factor-alpha ; nuclear factor-kappa B; interleukin-1; intercellular adhesion molecule 1

    INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References

HEPATIC FIBROSIS is characterized by increased deposition of extracellular matrix proteins within the interstitial space. The activated hepatic stellate cell (HSC, also called Ito cells, lipocytes, or fat-storing cells) is predominantly responsible for the synthesis of the extracellular matrix proteins during hepatic fibrogenesis (15, 50, 67, 73). Fibrotic hepatic injury induces the HSC to undergo an activation process (16, 21) that includes stimulation of proliferation, a phenotypic transformation to a myofibroblast-like cell with the loss of cellular retinol stores, and the appearance of smooth muscle alpha -actin, increased synthesis of extracellular matrix proteins, and contractility (42, 53, 56, 65). Many of the morphological and metabolic changes associated with HSC activation during fibrogenesis in vivo are also observed in HSC grown in culture on plastic (8, 15-17, 26). These changes include the expression of new receptors, such as platelet-derived growth factor-beta receptor (77), transforming growth factor-beta receptors 1 and 2 (18), and ferritin receptor (57). Other receptors, such as receptors for insulin-like growth factor I (4) and endothelin (30, 59), are present on both quiescent and activated HSC.

Interleukin-1 (IL-1) and tumor necrosis factor-alpha (TNF-alpha ) are elevated during hepatic inflammation, such as alcoholic liver disease (47), and contribute to the activation of HSC. TNF-alpha and IL-1 are potent inducers of nuclear factor-kappa B (NF-kappa B), a key transcription factor that induces genes involved in inflammation, responses to infection, and stress (1, 70). DNA binding activity of NF-kappa B is demonstrated in activated but not in quiescent HSC (Ref. 40, and R. A. Rippe, unpublished data), and activation of HSC is associated with the nuclear translocation of NF-kappa B (40). Using differential display, we demonstrated the expression of intercellular adhesion molecule 1 (ICAM-1) in HSC that were activated in culture or in vivo, but not in quiescent HSC (26). Because the ICAM-1 gene contains an NF-kappa B binding site and its transcription is stimulated by NF-kappa B (29, 39, 60), this observation provides functional support for a critical role of NF-kappa B in the activation of HSC.

The classic NF-kappa B protein is a heterodimer of p50 (NF-kappa B-1) and p65 (rel A) subunits, but proteins that constitute the NF-kappa B family form a variety of homodimers and heterodimers (13, 70). NF-kappa B is retained in an inactive form in the cytoplasm through association with one of the I-kappa B inhibitory proteins, such as I-kappa B-alpha (24). After cellular stimulation, inhibitor-kappa B (I-kappa B)-alpha is phosphorylated and ubiquinated and undergoes proteolysis with the proteasome complex, enabling NF-kappa B to translocate into the nucleus, where it stimulates the transcription of several genes by interacting with kappa B binding sites (2).

The effects of TNF-alpha and IL-1 on NF-kappa B signal transduction in quiescent and activated HSC are unknown. This study demonstrates that although quiescent HSC express TNF-R1 and have binding sites for TNF-alpha , TNF-alpha does not induce NF-kappa B activity. On the other hand, when activated HSC are treated with TNF-alpha or IL-1, I-kappa B-alpha is degraded, NF-kappa B translocates to the nucleus, the DNA binding activity of NF-kappa B increases, and NF-kappa B-responsive genes are induced. Thus TNF-alpha and IL-1 induce NF-kappa B binding activity and subsequent gene expression in activated but not in quiescent HSC, and this block in quiescent HSC occurs at a postreceptor step.

    METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References

HSC isolation and culture. HSC were isolated by sequential digestion of the liver of male Sprague-Dawley rats with Pronase and collagenase, followed by arabinogalactan gradient ultracentrifugation (58). The purity of the isolated HSC as examined by phase contrast- and ultraviolet-exited fluorescence microscopy was 98%, and cell viability as examined by trypan blue exclusion was 99%. HSC were cultured in DMEM supplemented with 10% fetal bovine serum (FBS) and penicillin and/or streptomycin. After 3 days in culture, the HSC had a quiescent phenotype, as described previously (20, 68). After 14 days of culture, our previous studies have documented activation of HSC by loss of retinol droplets, expression of smooth muscle alpha -actin, and expression of collagen alpha 1(I) mRNA levels (26, 58).

RNA extraction and amplification by RT-PCR. For TNF-alpha stimulation experiments, freshly isolated or culture-activated HSC were seeded for 3 days on plastic, before incubation with recombinant murine TNF-alpha (10 ng/ml; R & D Systems, Minneapolis, MN) in serum-free medium for 12 h. RNA was isolated from freshly isolated or culture-activated HSC using the Trizol method (GIBCO, Grand Island, NY) according to the manufacturer's specifications.

Integrity of the RNA was verified by agarose gel electrophoresis and visualization of ribosomal bands with ethidium bromide staining. First strand cDNA was synthesized using 1 µg of total RNA, 15 U of RNA guard (Pharmacia, Piscataway, NJ), one times first strand buffer (GIBCO), 12.5 mM dNTP (Pharmacia), 125 pmol of random hexamer primers (Pharmacia), and 125 U of Moloney murine leukemia virus RT (GIBCO) in a final volume of 25 µl. The reaction was carried out for 60 min at 39°C.

The synthesized cDNA was amplified using specific sets of primers for TNF-R1 (28), IL-1-R (23), macrophage inflammatory protein-2 (MIP-2) (78), ICAM-1 (35), and beta -actin (52) based on published sequences. The nucleotide sequences for the primers used in this study are described in Table 1. The TNF primer set 1 and 2 amplified from the transmembrane region (position 841) to two cytoplasmic domains (portion 1114 and 1354, respectively), whereas primer set 2 and 3 amplified the cytosolic portion from position 944 to position 1114 and 1354, respectively. Each PCR contained 0.4 µM of specific primer pairs, 200 µM dNTPs, 2.5 U Taq polymerase, 10 mM Tris · HCl (pH 8.3), 1.5 mM MgCl2, and 50 mM KCl in a total volume of 50 µl. PCRs were cycled as follows (after the initial denaturation for 3 min at 94°C): 1) for TNF-R1 and IL-1R (35 cycles); 94°C for 45 s, 56°C for 45 s, and 72°C for 90 s and 2) for MIP-2, ICAM-1, and beta -actin (30 cycles); 94°C for 45 s, 55°C for 30 s, and 72°C for 90 s. Final extension was carried out at 72°C for 10 min. The PCR products (1/4 vol) were electrophoresed on agarose gels containing ethidium bromide. Negative controls consisted of tubes with no primers and no RNA.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Primer list

TNF-R binding assay. A competitive ligand binding assay using cold competitive TNF-alpha and 125I-labeled TNF-alpha was used to determine surface expression of TNF-R on quiescent and activated HSC. Freshly isolated HSC and culture-activated HSC were seeded in 24-well plates in complete medium for 3 days. Cells were washed with RPMI medium containing 10% FBS before incubating the cells in the same medium for 3 h at 4°C in the presence of 800 pM human 125I-TNF-alpha (DuPont NEN, Boston, MA). Competition studies were carried out with increasing concentrations of unlabeled human TNF-alpha (2-80 nM, R & D Systems). Incubations were terminated by removal of the incubation medium and five washes with ice-cold RPMI-10% FBS, before lysing the cells in 0.1% SDS-PBS and measuring the cell-bound radioactivity in a gamma counter. Experiments were performed in triplicate. Data are displayed as mean specific binding per microgram of DNA. DNA concentration was determined by fluorometric assay.

Whole cell extracts. Freshly isolated or culture-activated HSC were grown in 60-mm dishes, washed with PBS, and cultured in serum-free medium for 24 h before a 30-min stimulation with TNF-alpha (10 ng/ml) or IL-1beta (2.5 ng/ml). Cells were washed with ice-cold PBS and lysed in Dignam C buffer (420 mM NaCl, 1.5 mM MgCl2, 20 mM HEPES, pH 7.0, 0.2 mM EDTA, 25% glycerol, and 0.5 mM dithiothreitol), containing protease and phosphatase inhibitors. Lysates were incubated on ice for 10 min and subsequently rotated at 4°C for 30 min. Cell membranes were pelleted by centrifugation at 14,000 rpm, and the resulting supernatant was aliquoted and stored at -80°C. Protein concentration was determined using the Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, CA).

Electrophoretic mobility shift assay. Freshly isolated HSC or culture-activated HSC were washed with PBS, starved in serum-free medium for 24 h, and incubated with TNF-alpha (10 ng/ml) or IL-1beta (2.5 ng/ml) for 30 min. Whole cell extracts (5 or 1 µg for time-course experiment in Fig. 5B) were incubated with a double-stranded radiolabeled oligonucleotide containing a consensus kappa B site (GGCTGGGGATTCCCCATCT) (25) or the previously described binding site of footprint 4 (FP4) on the collagen alpha 1(I) promoter (58) (CGGGAGGGGGGGAGCTGGGTG), separated by electrophoresis, and analyzed by autoradiography as described previously (33). For antibody supershifting analysis, nuclear extracts were preincubated with 1 µl of rel A antibody directed against the COOH-terminus portion of the molecule (Rockland, Gilbertsville, PA) for 15 min at RT before the addition of the binding buffer and probe as described (34). The specificity of the probes was evaluated by incubating the whole cell extracts with a 100-fold excess of unlabeled oligonucleotide. All mobility shift experiments were performed in three independent experiments, except for the time course (Fig. 5B), which was performed in two independent experiments.

p65 Western blots. Whole cell extracts (10 µg) were electrophoresed on 10% SDS-polyacrylamide gel and blotted onto nitrocellulose membrane as described previously (26). After 60 min in 10% blocking buffer [10% nonfat milk in 20 mM Tris · HCl, pH 7.6, 137 mM NaCl, 0.1% Tween 20 (TBST)], the membrane was incubated with either a rabbit anti-p65 antibody (Rockland) or an I-kappa B-alpha antibody (Santa Cruz Biotechnology, Santa Cruz, CA) diluted 1:1,000 in 5% blocking buffer (5% nonfat milk in TBST) for 45 min. After three washes with TBST, the membrane was incubated for another 30 min with horseradish peroxidase-conjugated goat anti-rabbit antibody (Amersham, Arlington Heights, IL) diluted 1:1,000 in 5% blocking buffer, washed in TBST, and then developed using the enhanced chemiluminescence light-detecting kit (Amersham) according to the manufacturer's recommended instructions (33). To ensure protein integrity and equal loading, 10 µg of total cell extract from both activated and quiescent HSC were separated on a 10% SDS-PAGE followed by Coomassie staining as described previously (32).

JNK assay. Quiescent and activated HSC were stimulated for 30 min with TNF-alpha (10 ng/ml) or IL-1beta (2.5 ng/ml), and Jun NH2-terminal kinase (JNK) activity was assessed using an in vitro kinase assay as described previously. Recombinant glutathione S-transferase (GST)-c-Jun protein (amino acids 1-79), containing the activation domain of c-Jun, a mutated GST-c-Jun with Ser63 and Ser73 mutated to Ala (GST-c-JunAA), or GST protein alone was utilized as a substrate. Whole cell extracts (5-10 µg) prepared from quiescent and activated HSC were incubated with 0.5 µg of substrate protein linked to glutathione-Sepharose beads. After extensive washing of the complexes, the kinase reactions were performed with [gamma -32P]ATP. The proteins were fractionated using 12.5% SDS-PAGE and then visualized and quantitated using PhosphoImager analysis (Molecular Dynamics, Sunnyvale, CA). Coomassie staining was used to demonstrate equal protein loading. Data represent the means of three independent experiments (±SD). Representative gels are shown.

p65 Immunofluorescence. HSC grown on chamber slides (Nunc, Naperville, IL) were stimulated for 30 min with TNF-alpha (10 ng/ml), briefly washed with PBS, and then fixed with ice-cold 100% methanol for 10 min. After blocking for 30 min with 10% nonimmune goat serum (NGS, Sigma Chemicals, St. Louis, MO) cells were incubated with rabbit anti-p65 antibody (Rockland) diluted 1:200 in 10% NGS-PBS. Slides were washed three times with PBS before 30-min incubation with rhodamine isothiocyanate-conjugated goat anti-rabbit IgG antibody (Jackson ImmunoResearch, West Grove, PA) and diluted 1:100 in 10% NGS-PBS. The p65 localization was visualized with a fluorescence light microscope.

    RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References

TNF-R1 and IL-1 receptor mRNA is expressed by quiescent and activated HSC. Because the status of TNF and IL-1 receptors in HSC is unknown, we first wanted to assess the expression of their mRNAs in quiescent and activated HSC. Using RT-PCR, we demonstrated the presence of mRNA for the TNF-R1 and the IL-1R in both quiescent and activated HSC (Fig 1A). For TNF-R mRNA analysis, various primer sets amplified parts of the transmembrane and cytoplasmic domain. This demonstrates the transcription of an intact TNF-R. Because it had been previously shown that Kupffer cells, hepatocytes, and endothelial cells are able to express ICAM-1 (36, 63, 66), we used the same cDNAs in a PCR amplifying ICAM-1 as a negative control. We previously demonstrated that freshly isolated HSC do not express ICAM-1 (26). As expected ICAM-1 mRNA was detected only in the activated HSC, demonstrating the purity of the HSC preparation. It is therefore unlikely that the detected mRNA for the TNF-R1 or IL-1R reflects contamination from other liver cell populations.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1.   Quiescent (Q) and activated (A) hepatic stellate cells (HSC) express receptors for tumor necrosis factor-alpha (TNF-alpha ) and interleukin-1 (IL-1). A: Q-HSC and A-HSC express mRNA for TNF-R1 and IL-1R. RT-PCR was performed using RNA from Q-HSC and A-HSC revealing PCR products of predicted sizes. For TNF-R1, 5' and 3' primers for each lane are listed in Table 1 and produce amplified segments of transmembrane domain and cytoplasmic domain (subsets 1 and 2) or segments of cytoplasmic domains of TNF-R (subsets 3 and 4) as described in METHODS. RT-PCR for intercellular adhesion molecule 1 (ICAM-1) and beta -actin was performed to demonstrate purity of Q-HSC and equal loading, respectively. B: competitive inhibition of TNF-alpha binding to freshly isolated, 2-day-old cultured HSC (Q-HSC) and culture-activated HSC (A-HSC). Q-HSC and A-HSC were incubated with 125I-TNF-alpha (800 pM) and increasing concentrations of unlabeled TNF-alpha as described in METHODS. In Q-HSC 325 counts/min and in A-HSC 360 counts/min were bound in assays without added cold TNF-alpha as competitor. Results are shown as percentage of 125I-TNF-alpha binding, each point representing mean of triplicate determinations. C: specific TNF-alpha binding to Q-HSC and A-HSC, which were incubated with 800 pM 125I-TNF-alpha with and without 100-fold excess of unlabeled TNF-alpha . Results are expressed as mean specific 125I-TNF-alpha binding (counts/min) from triplicate cultures ±SD after subtraction of background binding normalized to DNA concentration.

TNF-alpha binds to quiescent and activated HSC. To extend our finding of TNF-alpha R1 mRNA expression in quiescent and activated HSC, expression of TNF receptors on the cell surface of quiescent and activated HSC was demonstrated using a competitive ligand binding assay. Binding of 125I-TNF-alpha to quiescent and activated HSC was inhibited by competitive nonradioactive TNF-alpha in a dose-dependent way (Fig. 1B). A 100-fold excess of unlabeled TNF-alpha reduced 125I-TNF-alpha binding to about 5-10% of total bound 125I-TNF-alpha to quiescent and activated HSC, as shown in Fig. 1C. Thus both quiescent and activated HSC bind TNF-alpha . Differences in TNF-R number have generally not been reflected in differences in TNF downstream effects (31, 38).

TNF-alpha and IL-1beta increase NF-kappa B binding activity in activated but not in quiescent HSC. NF-kappa B binding activity is increased in activated HSC after TNF-alpha and IL-1beta stimulation, as demonstrated by electrophoretic mobility shift assays (Fig. 2A, lanes 3 and 4). However, over a range of TNF-alpha and IL-1beta concentrations, these cytokines failed to induce NF-kappa B binding activity in quiescent HSC (Fig. 2A, lanes 6 and 7 and data not shown). The components of the NF-kappa B complex induced by cytokine stimulation contains the major transactivator protein p65 as shown by antibody supershifting (Fig. 2B). To demonstrate the presence and integrity of the NF-kappa B protein in whole cell extracts of quiescent HSC, we performed Western blots for the p65 subunit (Fig. 2C) using the same whole cell extracts of activated and quiescent HSC as for the electrophoretic mobility shift assay (EMSA). With 10 µg whole cell extracts the p65 protein expression was lower in the quiescent than in the activated HSC but clearly detectable. Coomassie staining of the same protein extracts from quiescent or activated HSC used for Western blot or EMSA demonstrate that the difference in p65 expression was not due to unequal protein loading or degradation (Fig. 2D). The difference in protein pattern expression between quiescent and activated HSC may reflect their stage of activation. Expression of the p65 protein was the same in untreated and TNF-alpha - or IL-1beta -treated cells. In particular, there was no evidence of NF-kappa B p65 degradation in quiescent HSC.


View larger version (44K):
[in this window]
[in a new window]
 


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 2.   TNF-alpha and IL-1beta stimulate DNA binding activity of nuclear factor-kappa B (NF-kappa B) in A-HSC but not in Q-HSC. Q-HSC or A-HSC were stimulated with TNF-alpha (10 ng/ml) and IL-1beta (2.5 ng/ml) for 30 min. A: mobility shift assay using 5 µg whole cell extracts and radiolabeled consensus NF-kappa B site as probe were performed. Lane 1, probe without whole cell extract. In lanes 8 and 9 100-fold molar excess of unlabeled NF-kappa B oligonucleotide was used as competitor together with whole cell extracts of TNF-alpha stimulated A-HSC and Q-HSC, respectively. In lane 10 the same amount of unlabeled NF1 oligonucleotide together with whole cell extracts of TNF-alpha stimulated Q-HSC was used as control. ns, Nonspecific band. B: supershift with p65 antibody nuclear extracts (5 µg) were tested for NF-kappa B binding activity as previously described. Antibody supershifting is indicated by arrows. C: Western blots using p65 antibody and 10 µg whole cell extracts from Q-HSC or A-HSC stimulated with TNF-alpha (10 ng/ml) and IL-1 (2.5 ng/ml) for 30 min. D: total protein (10 µg) from Q-HSC or A-HSC with or without TNF-alpha -treatment were separated on a 10% SDS-PAGE and stained with Coomassie blue. Molecular size markers are indicated. E: mobility shift assay using 5 µg whole cell extracts of Q-HSC and A-HSC after a 30-min incubation with TNF-alpha (10 ng/ml) using footprint 4 (FP4) site on collagen alpha 1(I) promoter as a probe. In lane 1 probe was incubated without cellular protein and in lane 4 100-fold molar excess of unlabeled FP4 oligonucleotide was added to binding reaction of lane 2.

We also performed EMSAs with whole cell extracts from activated and quiescent HSC using the previously described binding site of FP4 on the alpha 1(I) collagen promoter (58) as a probe. The pattern of complex formation in quiescent and activated HSC was identical (Fig 2E) and consistent with previous findings. These results demonstrate the comparable quality of the whole cell extracts prepared from quiescent and activated HSC.

TNF-alpha and IL-1beta induce I-kappa B-alpha degradation in activated but not in quiescent HSC. To further investigate the mechanism for the failure of NF-kappa B induction after cytokine stimulation in quiescent HSC, we analyzed I-kappa B-alpha protein expression in quiescent and activated HSC after TNF-alpha and IL-1beta stimulation by Western blot. I-kappa B-alpha degradation has been shown to be a prerequisite for NF-kappa B activation (27). Both cytokines induce a rapid degradation of I-kappa B-alpha in activated HSC (Fig 3, A and B, right) but not in quiescent HSC (Fig. 3, A and B, left). This result is consistent with preceding EMSA data, which demonstrated nuclear translocation of NF-kappa B (p65) in activated but not in quiescent HSC.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3.   TNF-alpha and IL-1beta induce degradation of inhibitor-kappa B-alpha (I-kappa B-alpha ) in A-HSC but not in Q-HSC. Q-HSC and A-HSC were stimulated with IL-1beta (2.5 ng/ml, A) and TNF-alpha (10 ng/ml, B) for 0-90 min. Western blots were performed using 10 µg total cellular protein and antibody against I-kappa B-alpha . Recombinant truncated I-kappa B-alpha (I-kappa B-alpha -tag) was used as positive control to show antibody specificity.

JNK activity in quiescent and activated HSC after cytokine stimulation. Because TNF-alpha and IL-1beta stimulate JNK activity in a variety of cultured cells (37, 74), we assessed the ability of TNF-alpha and IL-1beta to stimulate JNK activity in quiescent and activated HSC. JNK activity was measured by a solid state in vitro kinase assay. Phosphorylated GST-c-Jun was visualized after protein fractionation using 12.5% SDS-PAGE and quantitated using PhosphoImager analysis (Fig. 4). TNF-alpha induced JNK activity 1.5 ± 0.2-fold in quiescent HSC and 2.4 ± 0.3-fold in activated HSC (where P < 0.05 for untreated vs. TNF-alpha -treated cells for both activated and quiescent HSC). IL-1beta stimulation led to a 1.6 ± 0.2-fold and 4.3 ± 1.6-fold increase of JNK activity in quiescent and activated HSC, respectively (P < 0.05 for untreated vs. IL-1beta -treated cells for both activated and quiescent HSC). A recent study has also demonstrated that IL-1 and TNF-alpha stimulate JNK in activated HSC (55). The relatively lower induction of JNK activity in quiescent HSC might be due to a higher basal activity after the isolation procedure. We found a 6.6 ± 3.3-fold higher basal JNK activity in freshly isolated HSC than in the culture-activated HSC (data not shown). These data demonstrate that the TNF-alpha signal transduction pathway that activates JNK is functional in both quiescent and activated HSC.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 4.   TNF-alpha and IL-1beta induce Jun NH2-terminal kinase (JNK) activity in Q-HSC and A-HSC. Q-HSC and A-HSC were stimulated for 30 min with TNF-alpha (10 ng/ml) or IL-1beta (2.5 µg/ml). A 10-µg whole cell extract was used in a JNK assay as described (69). Phosphorylated GST-c-Jun was visualized and quantitated after protein fractionation using 12.5% SDS-PAGE using PhosphoImager analysis. Coomassie staining confirmed equal protein loading. Experiments had been performed in triplicate, and representative gels are shown.

TNF-alpha starts to induce NF-kappa B activity in cultured HSC 4 days after isolation. We determined the time point when TNF-alpha starts to induce the NF-kappa B activity during the activation process of HSC in culture by studying p65 (rel A) subcellular localization and NF-kappa B binding activity. HSC up to 3 days in culture show an unchanged cytoplasmic pattern of p65 staining with no appreciable nuclear p65 staining after TNF-alpha stimulation (Fig 5A, A-F). On culture day 4, we first detected nuclear translocation of p65 in about 50% of the cells after TNF-alpha stimulation (Fig 5A, I), whereas the other 50% (Fig 5A, H) showed no change in the p65 staining pattern compared with the unstimulated control cells (Fig 5A, G), suggesting high heterogeneity among HSC during the activation process. After 6 and 14 days in culture, nearly all HSC show nuclear translocation of p65 after TNF-alpha stimulation (Fig 5A, K and M).


View larger version (31K):
[in this window]
[in a new window]
 


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 5.   TNF-alpha starts to stimulate NF-kappa B binding activity in HSC after 4-5 days in culture. Freshly isolated HSC were seeded on plastic and stimulated after 1, 2, 3, 4, 6, and 14 days of cell culture with 10 ng/ml of TNF-alpha for 30 min. A: nuclear translocation of p65 demonstrated by immunofluorescence using a p65 antibody. After 1-14 days of culture, HSC were incubated with 10 ng/ml TNF-alpha for 30 min. TNF-alpha stimulated nuclear translocation of p65 in HSC after 4 days in about 50% of the cells (I). After 6 days in culture p65 translocates to nucleus in nearly all cells after TNF-alpha stimulation (K). B: mobility shift assay using 1 µg whole cell extract and consensus NF-kappa B site as probe. Increased NF-kappa B activity after TNF-alpha stimulation was first detected on day 5 (lane 8 and 9). Lane 1 represents probe without whole cell extracts. In lane 12 100-fold molar excess of unlabeled NF-kappa B oligonucleotide was used as competitor in binding reaction from lane 11.

In parallel to the p65 subcellular localization study, we measured NF-kappa B binding activity by EMSA using a consensus alpha -B probe. Whole cell extracts derived from freshly isolated or 1, 3, 5, or 14 days cultured HSC with or without TNF-alpha stimulation were analyzed (Fig. 5B). TNF-alpha first induced NF-kappa B binding activity on day 5 (Fig 5B, lane 9). On day 14 the induction of NF-kappa B activity by TNF-alpha and the constitutive NF-kappa B binding activity were higher than on day 5 (Fig 5B, compare lanes 8 and 10). Both the NF-kappa B DNA binding activity and the immunofluorescence data demonstrate that NF-kappa B responsiveness is a relatively late event in HSC activation.

TNF-alpha induced ICAM-1 and MIP-2 expression in activated but not in quiescent HSC. Finally, we investigated the cytokine-mediated induction of ICAM-1 and MIP-2 mRNAs by RT-PCR in HSC cultured on plastic for 3 or 14 days (Fig. 6). The expression of the genes for ICAM-1 (29, 39) and MIP-2 (76) is stimulated by NF-kappa B through their kappa B binding sites. TNF-alpha increased the mRNA expression of ICAM-1 and MIP-2 in activated HSC. Compared with freshly isolated HSC (Fig. 1A) there is some basal expression of ICAM-1 mRNA in HSC cultured for 3 days on plastic, indicating initiation of the activation process. However, consistent with the lack of NF-kappa B activation after cytokine stimulation, there is no increased ICAM-1 or MIP-2 mRNA in 3-day-cultured HSC after TNF-alpha treatment (Fig. 6). beta -Actin mRNA expression was used to demonstrate equal amounts of RNA in each PCR. It is unlikely that the ICAM-1 expression in 3-day-cultured HSC reflects contamination from other liver cells because Kupffer cells, hepatocytes, and endothelial cells respond to TNF-alpha stimulation with increased ICAM-1 expression (12, 19, 49, 54).


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 6.   TNF-alpha induces macrophage inflammatory protein-2 (MIP-2) and ICAM-1 gene expression in activated but not in quiescent HSC. Freshly isolated HSC were cultured for 3 or 14 days (A-HSC) on plastic before 12-h stimulation with 10 ng/ml TNF-alpha . RT-PCRs were performed using 1 µg RNA. PCR products are of predicted sizes of 291, 409, and 280 bases for MIP-2, ICAM-1, and beta -actin cDNA, respectively. DNA size markers are shown.

    DISCUSSION
Top
Abstract
Introduction
Methods
Results
Discussion
References

This study focuses on the effects of TNF-alpha on NF-kappa B signal transduction in quiescent and activated HSC with corroborative evidence provided by studies with IL-1beta . Although quiescent HSC express TNF-R1 mRNA and have binding sites for TNF-alpha , this cytokine does not induce NF-kappa B activity in these cells. On the other hand, when activated HSC are treated with TNF-alpha or IL-1, I-kappa B-alpha is rapidly degraded, NF-kappa B translocates to the nucleus, the DNA binding activity of NF-kappa B increases, and NF-kappa B-responsive genes (ICAM-1 and MIP-2) are induced. Thus the TNF-alpha signal transduction pathway for NF-kappa B appears to be fully functional in activated HSC but blocked or inhibited at a postreceptor level in quiescent HSC. The presence of TNF-R on quiescent HSC was investigated by three independent methods. First we showed the presence of TNF-R mRNA using primers targeting the transmembrane and cytoplasmic region. Second, ligand binding studies demonstrated the presence of TNF-R on the surface of quiescent HSC. Third, a small but significant induction of JNK activity was observed in TNF-alpha -treated quiescent HSC. Furthermore, a recent study has demonstrated that IL-1beta induces morphological and biochemical changes in quiescent HSC (62), providing indirect evidence for the presence of an IL-1R. Overall, these data support a postreceptor defect of the NF-kappa B signaling pathway in quiescent HSC.

Recent studies have greatly increased our understanding of the TNF-alpha signaling cascade leading to NF-kappa B activation. The effects of TNF-alpha are mediated by its binding to the TNF-R1 and TNF-R2 (69). Binding of TNF-alpha to TNF-R1 is responsible for most of the known cellular effects of TNF-alpha (79). TRADD is an adaptive protein that binds to TNF-R1. FADD/MORT-1 binds to TRADD (5, 41) and is responsible for TNF-alpha induced apoptosis by directly interacting with caspase-8 (FLICE/MACH) (3). TRADD also interacts with TRAF-2 (41), which is believed to be responsible for both the activation of JNK (51) through the intermediary small G proteins Rac and cdc 42 (6) and for the phosphorylation of I-kappa B through an I-kappa B kinase complex (41). TNF-R2 also interacts with TRAF-2 and activates NF-kappa B (61). TRAF-2 directly binds to NIK-1 (43), a member of the MAP kinase kinase kinase (MAPKKK) family, which acts as an intermediate molecule in I-kappa B-alpha phosphorylation. NIK-1 directly binds I-kappa B-alpha kinase (IKK), which in turn associates with I-kappa B-alpha and phosphorylates it on serines 32 and 36 (10, 43). Phosphorylated I-kappa B-alpha then undergoes ubiquitination and degradation, releasing active NF-kappa B.

In our study, the quiescent HSC responded to incubation with TNF-alpha with a weak but significant activation of JNK but not of NF-kappa B. These results would be most consistent with a functional TNF-R1, TRADD, and TRAF-2, but with an inhibition of inducible I-kappa B degradation, resulting in an intact JNK pathway but not a NF-kappa B pathway in quiescent HSC. Although the defective mechanism is unknown, simple testable hypotheses include that the IKK is not activated because of the lack of an effective upstream transducer, that constitutive phosphatase activity dephosphorylates I-kappa B-alpha , or that ubiquitination or proteasome activity is defective. The intactness of other TNF-alpha signaling pathways, such as through caspase-8, phospholipase A2, or phospholipase C in quiescent vs. activated HSC is unknown.

A switch in the signaling pathway has been reported in pre-B cells where the major type of NF-kappa B complex is composed of p50/p65 heterodimers, which is in contrast to mature B cells, where p50/cRel is the major NF-kappa B complex (48). Although the p65 dimer is the predominant NF-kappa B protein in activated HSC, our data demonstrate that signaling pathway switching occurs during HSC transformation, which may contribute to the expression of a new cellular phenotype and/or the upregulation of a new set of genes. Acquisition of a functional I-kappa B/NF-kappa B signaling system by activated HSC correlates with the upregulation of ICAM-1 and MIP-2, suggesting that this process is an important step in the induction of these newly expressed genes. Activated HSC express a variety of NF-kappa B-responsive genes, including ICAM-1 (26), MIP-2 (68), monocyte chemoattractant protein-1 (7, 14, 45, 46), and IL-6 (71).

Increased expression of NF-kappa B-responsive genes such as ICAM-1 and MIP-2 by activated HSC may have an impact on the development of liver inflammation. ICAM-1, a member of the immunoglobulin superfamily, is a cell surface protein that contributes to the cellular adhesion and transmigration of many leukocytes via interactions with the beta 2 integrins, LFA-1 (CD11a/CD18) and myelin-associated glycoprotein-1 (D116/CD18), located on the leukocyte cell membrane (9, 44). TNF-alpha induces ICAM-1 through cooperative interactions of the transcription factors CCAAT enhancer binding protein (C/EBP) and NF-kappa B, whose binding sites are located in the ICAM-1 promoter (29, 60). ICAM-1 expression is increased in vascular and nonvascular cells during inflammation.

Several liver diseases, including alcoholic hepatitis, are characterized by neutrophil infiltration, mediated by TNF-alpha (64). The transmigration of the neutrophils out of the sinusoidal space into the hepatic parenchyma is mediated by ICAM-1, expressed on the sinusoidal endothelial cell (72) and activated HSC (26). Our study demonstrates that activated but not quiescent HSC respond to TNF-alpha or IL-1beta by increasing ICAM-1 expression. Thus the activated HSC might contribute to hepatic inflammation through leukocyte transmigration. In that respect, we have recently demonstrated that blocking NF-kappa B in activated HSC prevents the cytokine-induced expression of ICAM-1 and IL-6 genes (25).

MIP-2, a member of the CXC-chemokine family, is a neutrophil chemoattractant (22). MIP-2 has recently been demonstrated to be a major HSC-derived chemokine contributing to neutrophil chemotaxis (68). TNF-alpha induces MIP-2 in HSC after only 3 days of culture but has a greater induction after advanced transformation of HSC into myofibroblast (68). Although differences in the purification and culturing of HSC may account for the differences in the timing of MIP-2 expression between the two studies, our results provide a mechanism for the differential effect of TNF-alpha on quiescent and activated HSC. Thus TNF-alpha via NF-kappa B activation will result in chemoattraction and transmigration of neutrophils by activated but not by quiescent HSC. An unknown agonist must provide the initiation of HSC activation to manifest these effects.

According to this study, the cytokines TNF-alpha and IL-1 produced during hepatic inflammation should not stimulate NF-kappa B activity or NF-kappa B-dependent gene expression in quiescent HSC. A driving force behind liver inflammation may be the activation of HSC into NF-kappa B-responsive cells that then respond to cytokines by producing cell adhesion molecules and chemokines. Thus inhibition of I-kappa B degradation is a potential target for anti-inflammatory therapy in the liver and might influence the activation process of HSC following fibrotic stimuli.

    ACKNOWLEDGEMENTS

We thank Dr. Richard Rippe for critical review of this manuscript.

    FOOTNOTES

This work was supported by National Institutes of Health Grants GM-41804, DK-47700, and DK-34987, and the Deutsche Forschungsgemeinschaft Grant He-2458/1-1.

C. Hellerbrand and C. Joblin contributed equally to this work.

Address for reprint requests: D. A. Brenner, UNC-CH, Div. of Digestive Diseases and Nutrition, 326 Burnett-Womack Bldg., CB 7080, Chapel Hill, NC 27599-7080.

Received 3 October 1997; accepted in final form 8 April 1998.

    REFERENCES
Top
Abstract
Introduction
Methods
Results
Discussion
References

1.   Barnes, P. J., and M. Karin. Nuclear factor-kappa B: a pivotal transcription factor in chronic inflammatory diseases. N. Engl. J. Med. 336: 1066-1071, 1997[Free Full Text].

2.   Beg, A. A., T. S. Finco, P. V. Nantermet, and A. S. Baldwin, Jr. Tumor necrosis factor and interleukin-1 lead to phosphorylation and loss of I kappa B alpha: a mechanism for NF kappa B activation. Mol. Cell. Biol. 13: 3301-3310, 1993[Abstract/Free Full Text].

3.   Boldin, M. P., T. M. Goncharov, Y. V. Goltsev, and D. Wallach. Involvement of MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1- and TNF receptor-induced cell death. Cell 85: 803-815, 1996[Medline].

4.   Brenzel, A., and A. M. Gressner. Characterization of insulin-like growth factor (IGF)-I-receptor binding sites during in vitro transformation of rat hepatic stellate cells to myofibroblasts. Eur. J. Clin. Chem. Clin. Biochem. 34: 401-409, 1996[Medline].

5.   Chinnaiyan, A. M., C. G. Tepper, M. F. Seldin, K. O'Rourke, F. C. Kischkel, S. Hellbardt, P. H. Krammer, M. E. Peter, and V. M. Dixit. FADD/MORT1 is a common mediator of CD95 (Fas/APO-1) and tumor necrosis factor receptor-induced apoptosis. J. Biol. Chem. 271: 4961-4965, 1996[Abstract/Free Full Text].

6.   Coso, O. A., M. Chiariello, J.-C. Yu, H. Teramoto, P. Crespo, N. Xu, T. Miki, and J. S. Gutkind. The small GTP-binding proteins Rac1 and Cdc42 regulate the activity of the JNK/SAPK signaling pathway. Cell 81: 1137-1146, 1995[Medline].

7.   Czaja, M., A. Geerts, J. Xu, P. Schmiedeberg, and Y. Ju. Monocyte chemoattractant protein 1 (MCP-1) expression occurs in toxic rat liver injury and human liver disease. J. Leukoc. Biol. 55: 120-126, 1994[Abstract].

8.   DeLeeuw, A. M., S. P. McCarthy, A. Geerts, and D. L. Knook. Purified rat liver fat storing cells divide in culture and contain collagen. Hepatology 4: 392-403, 1984[Medline].

9.   Diamond, M. S., D. E. Staunton, A. R. deFougerolles, S. A. Stacker, J. Garcia-Aguilar, M. L. Hibbs, and T. A. Springer. ICAM-1 (CD 54): a counter-receptor for Mac-1 (CD11b/CD18). J. Cell Biol. 111: 3129-3139, 1990[Abstract/Free Full Text].

10.   Didonato, J. A., M. Hayakawa, D. M. Rothwarf, E. Zandi, and M. Karin. A cytokine-responsive I(kappa)B kinase that activates the transcription factor NF kappa B. Nature 388: 548-554, 1997[Medline].

11.   Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11: 1475-1489, 1983[Abstract/Free Full Text].

12.   Essani, N. A., G. M. McGuire, A. M. Manning, and H. Jaeschke. Differential induction of mRNA for ICAM-1 and selectins in hepatocytes, Kupffer cells and endothelial cells during endotoxemia. Biochem. Biophys. Res. Commun. 211: 74-82, 1995[Medline].

13.   Finco, T. S., and A. S. Baldwin. Mechanistic aspects of NF kappa B regulation: the emerging role of phosphorylation and proteolysis. Immunity 3: 263-272, 1995[Medline].

14.   Freter, R. R., J. A. Alberta, G. Y. Hwang, A. L. Wrentmore, and C. D. Stiles. Platelet-derived growth factor induction of the immediate-early gene MCP-1 is mediated by NF kappa B and a 90-kDa phosphoprotein coactivator. J. Biol. Chem. 271: 17417-17424, 1996[Abstract/Free Full Text].

15.   Friedman, S. L. Cellular sources of collagen and regulation of collagen production in liver. Semin. Liver Dis. 10: 20-29, 1990[Medline].

16.   Friedman, S. L. Seminars in medicine of the Beth Israel Hospital, Boston. The cellular basis of hepatic fibrosis. Mechanisms and treatment strategies. N. Engl. J. Med. 328: 1828-1835, 1993[Free Full Text].

17.   Friedman, S. L., D. C. Rockey, R. F. McGuire, J. J. Maher, J. K. Boyles, and G. Yamasaki. Isolated hepatic lipocytes and Kupffer cells from normal human liver: morphological and functional characteristics in primary culture. Hepatology 15: 234-243, 1992[Medline].

18.   Friedman, S. L., G. Yamasaki, and L. Wong. Modulation of transforming growth factor beta receptors of rat lipocytes during the hepatic wound healing response. J. Biol. Chem. 269: 10551-10558, 1994[Abstract/Free Full Text].

19.   Furutani, M., S. Arii, K. Monden, Y. Adachi, N. Funaki, H. Higashitsuji, S. Fujita, M. Mise, S. Ishiguro, and T. Kitao. Immunologic activation of hepatic macrophages in septic rats: a possible mechanism of sepsis-associated liver injury. J. Lab. Clin. Med. 123: 430-436, 1994[Medline].

20.   Gong, W., S. Roth, K. Michel, and A. M. Gressner. Isoforms and splice variant of transforming growth factor beta-binding protein in rat hepatic stellate cells. Gastroenterology 114: 352-363, 1998[Medline].

21.   Gressner, A. M. Mediators of hepatic fibrogenesis. Hepatogastroenterology 43: 92-103, 1996[Medline].

22.   Haelens, A., P. Proost, S. Struyf, G. Opdenakker, and J. van Damme. Leukocyte migration and activation by murine chemokines. Immunobiology 195: 499-521, 1996[Medline].

23.   Hart, R. P., C. Liu, A. M. Shadiack, R. J. McCormack, and G. M. Jonakait. An mRNA homologous to interleukin-1 receptor type I is expressed in cultured rat sympathetic ganglia. J. Neuroimmunol. 44: 49-56, 1993[Medline].

24.   Haskill, S., A. A. Beg, S. M. Tompkins, J. S. Morris, A. D. Yurochko, A. Sampson-Johannes, K. Mondal, P. Ralph, and A. S. Baldwin, Jr. Characterization of an immediate-early gene induced in adherent monocytes that encloses I kappa B-like activity. Cell 65: 1281-1289, 1991[Medline].

25.   Hellerbrand, C., C. Jobin, Y. Iimuro, L. L. Licato, R. B. Sartor, and D. A. Brenner. Inhibition of NF kappa B in activated hepatic stellate cells by proteasome inhibitors and an I kappa B super-repressor. Hepatology. 27: 1285-1295, 1998[Medline].

26.   Hellerbrand, C., S. C. Wang, H. Tsukamoto, D. A. Brenner, and R. A. Rippe. Expression of intercellular adhesion molecule 1 by activated hepatic stellate cells. Hepatology 24: 670-676, 1996[Medline].

27.   Henkel, T., T. Machleidt, I. Alkalay, M. Kronke, Y. Ben-Neriah, and P. A. Baeuerle. Rapid proteolysis of I kappa B alpha is necessary for activation of transcription factor NF kappa B. Nature 365: 182-185, 1993[Medline].

28.   Himmler, A., I. Maurer-Fogy, M. Kronke, P. Scheurich, K. Pfizenmaier, M. Lantz, I. Olsson, R. Hauptmann, C. Stratowa, and G. R. Adolf. Molecular cloning and expression of human and rat tumor necrosis factor receptor chain (p60) and its soluble derivative, tumor necrosis factor-binding protein. DNA Cell Biol. 9: 705-715, 1990[Medline].

29.   Hou, J., V. Baichwal, and Z. Cao. Regulatory elements and transcription factors controlling basal and cytokine-induced expression of the gene encoding intercellular adhesion molecule 1. Proc. Natl. Acad. Sci. USA 91: 11641-11645, 1994[Abstract/Free Full Text].

30.   Housset, C., D. C. Rockey, and D. M. Bissell. Endothelin receptors in rat liver: lipocytes as a contractile target for endothelin 1. Proc. Natl. Acad. Sci. USA 90: 9266-9270, 1993[Abstract/Free Full Text].

31.   Jaattela, M. Overexpression of major heat shock protein hsp70 inhibits tumor necrosis factor-induced activation of phospholipase A21. J. Immunol. 151: 4286-4294, 1993[Abstract].

32.   Jobin, C., and J. Gauthier. Differential effects of cell density on 5-lipoxygenase (5-LO). Five-lipoxygenase-activating protein (FLAP) and interleukin-1 beta (IL-1 beta) expression in human neutrophils. Inflammation 21: 235-250, 1997[Medline].

33.   Jobin, C., S. Haskill, R. J. Mayer, A. Panja, and R. B. Sartor. Evidence for an altered regulation of I kappa B alpha degradation in human colonic epithelial cells. J. Immunol. 158: 226-234, 1997[Abstract].

34.  Jobin, C., C. Hellerbrand, L. L. Licato, D. A. Brenner, and R. B. Sartor. NF kappa B mediates cytokine-induced expression of ICAM-1 in an intestinal epithelial cell line, a process blocked by proteasome inhibitors. Gut. In press.

35.   Kita, Y., T. Takashi, T. Tamatani, M. Miyasaka, and T. Horiuchi. Sequence and expression of rat ICAM-1. Biochim. Biophys. Acta 1131: 108-110, 1992[Medline].

36.   Kurose, I., H. Saito, S. Miura, H. Ebinuma, H. Higuchi, N. Watanabe, S. Zeki, T. Nakamura, M. Takaishi, and H. Ishii. CD18/ICAM-1 dependent oxidative NF kappa B activation leading to nitric oxide production in rat Kupffer cells co-cultured with syngeneic hepatoma cells. J. Clin. Invest. 99: 867-878, 1997[Medline].

37.   Kyriakis, J. M., P. Banerjee, E. Nikolakaki, T. Dai, E. A. Rubie, M. F. Ahmad, J. Avruch, and J. R. Woodgett. The stress-activated protein kinase subfamily of c-Jun kinases. Nature 369: 156-160, 1994[Medline].

38.   Larrick, J. W., and S. C. Wright. Cytotoxic mechanism of tumor necrosis factor alpha. FASEB J. 4: 3215-3223, 1990[Abstract].

39.   Ledebur, H. C., and T. P. Parks. Transcriptional regulation of the intercellular adhesion molecule-1 gene by inflammatory cytokines in human endothelial cells. J. Biol. Chem. 270: 933-943, 1995[Abstract/Free Full Text].

40.   Lee, K. S., M. Buck, K. Houglum, and M. Chojkier. Activation of hepatic stellate cells by TGF alpha and collagen type I is mediated by oxidative stress through c-myb expression. J. Clin. Invest. 96: 2461-2468, 1995.

41.   Liu, Z. G., H. Hsu, and D. V. Goeddel. Dissection of TNF receptor 1 effector function: JNK activation is not linked to apoptosis while NF kappa B activation prevents cell death. Cell 87: 565-576, 1996[Medline].

42.   Mak, K. M., M. A. Leo, and C. S. Lieber. Alcoholic liver injury in baboon: transformation of lipocytes to transitional cells. Gastroenterology 87: 188-200, 1984[Medline].

43.   Malinin, N. L., M. P. Boldin, A. V. Kovalenko, and D. Wallach. MAP3K-related kinase involved in NFkB induction by TNF, CD95 and IL-1. Nature 385: 540-544, 1997[Medline].

44.   Marlin, S. D., and T. A. Springer. Purified intercellular adhesion molecule-1 (ICAM-1) is a ligand for lymphocyte function associated antigen 1 (LFA-1). Cell 51: 813-819, 1987[Medline].

45.   Marra, F., G. Grandaliano, A. J. Valente, and H. E. Abboud. Thrombin stimulates proliferation of liver fat-storing cells and expression of monocyte chemotactic protein-1: potential role in liver injury. Hepatology 22: 780-787, 1995[Medline].

46.   Marra, F., G. Grandaliano, A. J. Valente, M. Pinzani, and H. E. Abboud. Cultured human liver fat-storing cells produce monocyte chemotactic protein-1. Regulation by proinflammatory cytokines. J. Clin. Invest. 92: 1674-1680, 1993.

47.   McClain, C., D. Hill, J. Schmidt, and A. M. Diehl. Cytokines and alcoholic liver disease. Semin. Liver Dis. 13: 170-182, 1993[Medline].

48.   Miyamoto, S., M. J. Schmitt, and I. M. Verma. Qualitative changes in the subunit composition of kappa B binding complexes during murine B-cell differentiation. Proc. Natl. Acad. Sci. USA 91: 5056-5060, 1994[Abstract/Free Full Text].

49.   Morita, M., Y. Watanabe, T. Akaike, and L. A. Aarden. Inflammatory cytokines up-regulate intercellular adhesion molecule-1 expression on primary cultured mouse hepatocytes and T-lymphocyte adhesion. Hepatology 19: 426-431, 1994[Medline].

50.   Nakatsukasa, H., P. Nagy, R. P. Evarts, H. Chu-Chieh, E. Marsden, and S. S. Thorgeirsson. Cellular distribution of transforming growth factor beta 1 and procollagen types I, III, and IV transcripts in carbon tetrachloride-induced rat liver fibrosis. J. Clin. Invest. 85: 1833-1843, 1990.

51.   Natoli, G., A. Costanzo, A. Ianni, D. J. Templeton, J. R. Woodgett, C. Balsano, and M. Levrero. Activation of SAPK/JNK by TNF receptor 1 through a noncytotoxic TRAF2-dependent pathway. Science 275: 200-203, 1997[Abstract/Free Full Text].

52.   Nudel, U., R. Zakut, M. Shani, S. Neuman, Z. Levy, and D. Yaffe. The nucleotide sequence of the rat cytoplasmic beta-actin gene. Nucleic Acids Res. 11: 1759-1771, 1983[Abstract/Free Full Text].

53.   Ogawa, K., J.-I. Suzuki, H. Mukai, and M. Mori. Sequential changes of extracellular matrix and proliferation of Ito cells with enhanced expression of desmin and actin in focal hepatic injury. Am. J. Pathol. 125: 611-619, 1986[Abstract].

54.   Ohira, H., T. Ueno, S. Shakado, M. Sakamoto, T. Torimura, S. Inuzuka, M. Sata, and K. Tanikawa. Cultured rat hepatic sinusoidal endothelial cells express intercellular adhesion molecule-1 (ICAM-1) by tumor necrosis factor-alpha or interleukin-1 alpha stimulation. J. Hepatol. 20: 729-734, 1994[Medline].

55.   Poulos, J. E., J. D. Weber, J. M. Bellezzo, A. M. DiBisceglie, R. S. Britton, B. R. Bacon, and J. J. Baldassare. Fibronectin and cytokines increase JNK, ERK, AP-1 activity, and transin gene expression in rat hepatic stellate cells. Am. J. Physiol. 273 (Gastrointest. Liver Physiol. 36): G804-G811, 1997[Abstract/Free Full Text].

56.   Ramadori, G., T. Weit, S. Schwogler, H. P. Dienes, T. Knittel, H. Rieder, and K.-H. Meyer zum Buchenfelde. Expression of the gene of the alpha-smooth muscle actin isoform in rat liver and in rat fat-storing (Ito) cells. Virchows Arch. 59: 349-357, 1990.

57.   Ramm, G. A., R. S. Britton, R. O'Neill, and B. R. Bacon. Identification and characterization of a receptor for tissue ferritin on activated rat lipocytes. J. Clin. Invest. 94: 9-15, 1994.

58.   Rippe, R. A., G. Almounajed, and D. A. Brenner. Sp1 binding activity increases in activated Ito cells. Hepatology 22: 241-251, 1995[Medline].

59.   Rockey, D. C. The cellular pathogenesis of portal hypertension: stellate cell contractility, endothelin, and nitric oxide. Hepatology 25: 2-5, 1997[Medline].

60.   Roebuck, K. A., A. Rahman, V. Lakshminarayanan, K. Janakidevi, and A. B. Malik. H2O2 and tumor necrosis factor alpha activate intercellular adhesion molecule 1 (ICAM-1) gene transcription through distinct cis-regulatory elements within the ICAM-1 promoter. J. Biol. Chem. 270: 18966-18974, 1995[Abstract/Free Full Text].

61.   Rothe, M., S. C. Wong, W. J. Henzel, and D. V. Goeddel. A novel family of putative signal transducers associated with the cytoplasmic domain of the 75 kDa tumor necrosis factor receptor. Cell 78: 681-692, 1994[Medline].

62.   Sakamoto, M., T. Ueno, H. Sugawara, T. Torimura, R. Tsuji, K. Sujaku, M. Sata, and K. Tanikawa. Relaxing effect of interleukin-1 on rat cultured Ito cells. Hepatology 25: 1412-1417, 1997[Medline].

63.   Satoh, S., A. K. Nussler, Z. Z. Liu, and A. W. Thomson. Proinflammatory cytokines and endotoxin stimulate ICAM-1 gene expression and secretion by normal human hepatocytes. Immunology 82: 571-576, 1994[Medline].

64.   Schlayer, H. J., H. Laaff, T. Peters, M. Woort-Menker, H. C. Estler, U. Karck, H. E. Schaefer, and K. Decker. Involvement of tumor necrosis factor in endotoxin-triggered neutrophil adherence to sinusoidal endothelial cells of mouse liver and its modulation in acute phase. J. Hepatol. 7: 239-249, 1988[Medline].

65.   Schmitt-Graff, A., G. Chakroun, and G. Gabbiani. Modulation of perisinusoidal cell cytoskeletal features during experimental hepatic fibrosis. Virchows Arch. 422: 99-107, 1993.

66.   Scoazec, J. Y., and G. Feldmann. In situ immunophenotyping study of endothelial cells of the human hepatic sinusoid: results and functional implications. Hepatology 14: 789-797, 1991[Medline].

67.   Shiratori, Y., Y. Ichida, A. Geerts, and E. Wisse. Modulation of collagen synthesis by fat-storing cells isolated from CCl4 or vitamin A-treated rats. Dig. Dis. Sci. 32: 1281-1289, 1987[Medline].

68.   Sprenger, H., A. Kaufmann, H. Garn, B. Lahme, D. Gemsa, and A. M. Gressner. Induction of neutrophil-attracting chemokines in transforming rat hepatic stellate cells. Gastroenterology 113: 277-285, 1997[Medline].

69.   Tartaglia, L. A., R. F. Weber, I. S. Figari, C. Reynolds, M. A. Palladino, and D. V. Goeddel. The two different receptors for tumor necrosis factor mediate distinct cellular responses. Proc. Natl. Acad. Sci. USA 88: 9292-9296, 1991[Abstract/Free Full Text].

70.   Thanos, D., and T. Maniatis. NF kappa B: a lesson in family values. Cell 80: 529-532, 1995[Medline].

71.   Tiggelman, A. M. B. C., W. Boers, C. Linthorst, H. S. Brand, M. Sala, and R. A. F. M. Chamuleau. Interleukin-6 production by human liver (myo)fibroblasts in culture. Evidence for a regulatory role of LPS, IL-1 beta and TNF alpha. J. Hepatol. 23: 295-306, 1995[Medline].

72.   Volpes, R., J. J. van den Oord, and V. J. Desmet. Immunohistochemical study of adhesion molecules in liver inflammation. Hepatology 12: 59-65, 1990[Medline].

73.   Weiner, F. R., M. A. Giambrone, M. J. Czaja, A. Shah, G. Annoni, S. Takahashi, M. Eghbali, and M. A. Zern. Ito-cell gene expression and collagen regulation. Hepatology 11: 111-117, 1990[Medline].

74.   Westwick, J., C. Weitzel, A. Minden, M. Karin, and D. A. Brenner. Tumor necrosis factor alpha stimulates AP-1 activity through prolonged activation of the c-Jun kinase. J. Biol. Chem. 269: 26396-26401, 1994[Abstract/Free Full Text].

75.   Westwick, J. K., and D. A. Brenner. Methods for analyzing c-Jun kinase. Methods Enzymol. 255: 342-359, 1995[Medline].

76.   Widmer, U., K. R. Manogue, A. Cerami, and B. Sherry. Genomic cloning and promoter analysis of macrophage inflammatory protein (MIP)-2, MIP-1 alpha, and MIP-1 beta, members of the chemokine superfamily of proinflammatory cytokines. J. Immunol. 150: 4996-5012, 1993[Abstract].

77.   Wong, L., G. Yamasaki, R. J. Johnson, and S. L. Friedman. Induction of platelet-derived growth factor receptor in rat hepatic lipocytes during cellular activation in vivo and in culture. J. Clin. Invest. 94: 1563-1569, 1994.

78.   Wu, X., G. J. Dolecki, and J. B. Lefkowith. GRO chemokines: a transduction, integration, and amplification mechanism in acute renal inflammation. Am. J. Physiol. 269 (Renal Fluid Electrolyte Physiol. 38): 248-256, 1995.

79.   Yuan, J. Transducing signals of life and death. Curr. Opin. Cell Biol. 9: 247-251, 1997[Medline].


Am J Physiol Gastroint Liver Physiol 275(2):G269-G278
0002-9513/98 $5.00 Copyright © 1998 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. Anan, E. S. Baskin-Bey, H. Isomoto, J. L. Mott, S. F. Bronk, J. H. Albrecht, and G. J. Gores
Proteasome inhibition attenuates hepatic injury in the bile duct-ligated mouse
Am J Physiol Gastrointest Liver Physiol, October 1, 2006; 291(4): G709 - G716.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. Muhlbauer, B. Allard, A. K. Bosserhoff, S. Kiessling, H. Herfarth, G. Rogler, J. Scholmerich, C. Jobin, and C. Hellerbrand
Differential effects of deoxycholic acid and taurodeoxycholic acid on NF-{kappa}B signal transduction and IL-8 gene expression in colonic epithelial cells
Am J Physiol Gastrointest Liver Physiol, June 1, 2004; 286(6): G1000 - G1008.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
T. Y. Ma, G. K. Iwamoto, N. T. Hoa, V. Akotia, A. Pedram, M. A. Boivin, and H. M. Said
TNF-{alpha}-induced increase in intestinal epithelial tight junction permeability requires NF-{kappa}B activation
Am J Physiol Gastrointest Liver Physiol, March 1, 2004; 286(3): G367 - G376.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
D A Mann and D E Smart
Transcriptional regulation of hepatic stellate cell activation
Gut, June 1, 2002; 50(6): 891 - 896.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
B. M. Stramer, J. R. Cook, M. E. Fini, A. Taylor, and M. Obin
Induction of the Ubiquitin-Proteasome Pathway during the Keratocyte Transition to the Repair Fibroblast Phenotype
Invest. Ophthalmol. Vis. Sci., July 1, 2001; 42(8): 1698 - 1706.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
X.-T. Yan, M. Zhuang, J. E. Oakes, and R. N. Lausch
Autocrine action of IL-10 suppresses proinflammatory mediators and inflammation in the HSV-1-infected cornea
J. Leukoc. Biol., January 1, 2001; 69(1): 149 - 157.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
F. J. Eng and S. L. Friedman
Fibrogenesis I. New insights into hepatic stellate cell activation: the simple becomes complex
Am J Physiol Gastrointest Liver Physiol, July 1, 2000; 279(1): G7 - G11.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Giannoukakis, W. A. Rudert, M. Trucco, and P. D. Robbins
Protection of Human Islets from the Effects of Interleukin-1beta by Adenoviral Gene Transfer of an Ikappa B Repressor
J. Biol. Chem., November 17, 2000; 275(47): 36509 - 36513.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hellerbrand, C.
Right arrow Articles by Brenner, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hellerbrand, C.
Right arrow Articles by Brenner, D. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online