|
|
||||||||
1 Department of Internal
Medicine, Veterans Affairs Medical Center and University of
Michigan School of Medicine, Ann Arbor, Michigan 48105;
3 Department of Medicine,
University of Pennsylvania, Philadelphia, Pennsylvania 19104; and
2 Department of Medical Genetics, Congenital chloride diarrhea (CLD) is a
recessively inherited disorder characterized by massive loss of
chloride in stool. We previously identified mutations in the
downregulated in adenoma (DRA) gene
in patients with CLD and demonstrated that
DRA encodes an intestine-specific
sulfate transporter. To determine whether DRA is an intestinal chloride
transporter and how mutations affect transport,
Xenopus oocytes were injected with
wild-type and mutagenized DRA cRNA and
uptake of Cl
Xenopus oocytes; intestine; sulfate; genetic disorders
CONGENITAL CHLORIDE DIARRHEA (CLD; MIM 214700), first
described by Gamble et al. (6) and Darrow (5), is a recessively inherited disorder characterized by massive loss of chloride in acidic
stools. Without adequate replacement therapy, intrauterine and lifelong diarrhea, and the resulting water and electrolyte deficits, can lead to volume depletion, hyperaldosteronism,
hyperreninemia, nephropathy, and growth and psychomotor retardation
(13). Cases of this rare disorder are clustered in Finland (13), Poland (28), Kuwait (18), and Saudi Arabia (14). Intestinal perfusion studies
in patients with CLD localized a defect in chloride absorption to the
distal ileum and colon that was best explained by a defect in
Cl As a first step toward identification of the
CLD gene, the CLD locus was mapped by
linkage analysis to chromosome 7q31 adjacent to the cystic fibrosis
transmembrane regulator
(CFTR) gene and four chromosomal
bands away from the
Cl In this study, using functional expression in
Xenopus oocytes, we have examined the
capacity of the DRA protein to transport chloride as well as sulfate.
In addition, we have determined the effect of three sequence changes,
V317del, C307W, and V317del/C307W, found in patients affected with CLD
on chloride and sulfate transport. Our results demonstrate that the DRA
protein functions as a chloride transporter and confirms the
prediction, based on the distribution of these three sequence changes
in different subpopulations, that V317del is a disease-causing mutation
and the C307W sequence change is a silent polymorphism. Chloride
transport mediated by the DRA protein exhibits features of a
Cl Mutagenesis.
A full-length DRA cDNA (27) inserted in the mammalian expression vector
pCMV5 was used as the template for mutagenesis by the ExSite PCR-based
site directed mutagenesis kit (Stratagene, La Jolla, CA) according to
manufacturer's instructions. The primers used to obtain the different
mutants were as follows: C307W alone, GACTTTAAAAACAGGTTTAAAG and
CCAGCCGTAGGATACACCTGC; V317del alone, TGGGGACATGAATCCTGGATTTC and
ACAGCCACTTTAAACCTGTTTTT; and C307W/V317del combined,
TGGGGACATGAATCCTGGATTTC and
ACAGCCACTTTAAACCTGTTTTTAAAGTCCCAGCCGTAGGATACAC. Mutated clones were
identified among nonmutated clones by PCR, Tsp45I digestion, and
electrophoresis in 6% polyacrylamide gels, as described (10). The
mutated constructs were verified by sequencing the entire coding region.
In vitro transcription of cDNA.
Wild-type and mutated DRA cDNAs (5 µg) were released from pCMV5 by digestion with Kpn I and
Xba I, recloned into Bluescript KS- (Stratagene) and verified
again by sequencing. The plasmids were then amplified in DH5- Oocyte isolation and injection.
Mature Xenopus laevis females were
purchased from Xenopus I (Ann Arbor, MI). Frogs were anesthetized by
immersion for 15 min in ice-cold water containing 0.3% 3-aminobenzoic
acid ethyl ester. Oocytes were removed and incubated at room
temperature for 3 h in Ca2+-free
modified Barth's solution containing (in mM) 88 NaCl, 1 KCl, 2.4 NaHCO3, 0.82 MgSO4, and 10 HEPES-NaOH (pH 7.4)
supplemented with 2 mg/ml collagenase (Life Technologies), and stage V
and VI oocytes were selected. After overnight incubation at 18°C in modified Barth's solution [(in mM) 88 NaCl, 1 KCl, 2.4 NaHCO3, 0.82 MgSO4, 0.33 Ca(NO3)2,
0.41 CaCl2, and 10 HEPES-NaOH (pH
7.4), supplemented with penicillin (500 U/ml) and streptomycin (100 µg/ml)], healthy oocytes were injected with 500 pg of cRNA derived from in vitro transcription of wild-type and mutant
DRA or DEPC-treated water (total
volume 50 nl). Subsequently, oocytes were cultured for 4-5 days at
18°C with a daily change of antibiotic-supplemented modified
Barth's solution.
Transport assay.
35S (carrier-free) and
36Cl were obtained from Dupont
NEN. For sulfate uptake studies twelve to twenty-five oocytes were
incubated for 15 min in a sodium-free and sulfate-free uptake solution
(in mM, 100 choline chloride, 2 KCl, 1 CaCl2, 1 MgCl2, 10 HEPES-Tris, pH 7.5). For
chloride uptake studies oocytes were incubated for 15 min in a
chloride-free uptake solution (in mM, 100 sodium gluconate, 2 potassium
gluconate, 1 calcium gluconate, 1 magnesium gluconate, 10 HEPES-Tris,
pH 7.5). The oocytes were then incubated in 0.5-1 ml uptake
solution containing either 1 mM
K235SO4
(20 µCi/ml) or 1 mM Na36Cl (5 µCi/ml) for the designated time intervals. Uptake was stopped by
washing the oocytes three times with ice-cold uptake solution containing either 5 mM
K2SO4
or 5 mM NaCl. Individual oocytes were then transferred to scintillation
vials and dissolved in 0.5 ml of 10% SDS, and after addition of
scintillation fluid, oocyte-associated radioactivity was determined in
a Beckman LS 1801 liquid scintillation counter.
In the initial set of experiments cRNAs derived from in vitro
transcription of wild-type DRA and two
of the mutagenized constructs, V317del alone and V317del/C307W, were
injected into a Xenopus oocyte
expression system and chloride transport activity was assayed. As shown
in Fig. 1, uptake of 1 mM
36Cl was significantly enhanced in
oocytes injected with wild-type DRA
cRNA compared with chloride uptake in oocytes injected with DEPC-treated water. Furthermore, as shown in Fig.
2, 1-h uptake of 1 mM
36Cl was significantly enhanced in
oocytes injected with wild-type DRA
cRNA compared with chloride uptake in oocytes injected with either of
the two mutant DRA cRNAs. In addition,
chloride uptake in oocytes injected with either of the two mutant
DRA cRNAs was not significantly
different from chloride uptake in oocytes injected with DEPC-treated
water. The anion exchange inhibitor DIDS, a potent inhibitor of
Cl
![]()
ABSTRACT
Top
Abstract
Introduction
Methods
Results
Discussion
References
and
SO2
4 was assayed. Both
Cl
and
SO2
4 were transported by wild-type DRA and an outwardly directed pH gradient stimulated
Cl
uptake, consistent with
Cl
/OH
exchange. Among three mutants, C307W transported both anions as
effectively as wild-type, whereas transport activity was lost in
V317del and the double mutant identified in 32 of 32 Finnish CLD
patients. We conclude that DRA is a chloride transporter defective in
CLD and that V317del is a functional mutation and C307W a silent polymorphism.
![]()
INTRODUCTION
Top
Abstract
Introduction
Methods
Results
Discussion
References
/HCO
3
exchange (1, 12, 29). However, there have been no in vitro studies
performed on intestine from these individuals to confirm this finding.
/HCO
3
exchanger AE2 (15). Further genetic and physical mapping implicated the downregulated in adenoma
(DRA) gene as a positional candidate
for CLD (9, 11). The protein product
of the DRA gene is a membrane
glycoprotein with 10-14 predicted transmembrane domains (4). The
DRA protein is highly homologous to a family of sulfate transport
proteins (3, 8, 22) and functional studies in Xenopus
laevis oocytes have previously confirmed its sulfate
transport activity (23, 27). Two sequence changes of
DRA, a three-base deletion (GGT) at
nucleotides 951-953 that predicts a loss of a valine (V317del) and
a T to G transversion at position 921 that predicts an amino acid
substitution of tryptophan for cysteine (C307W), were identified in all
members of a group of 32 Finnish patients with CLD (10).
All 43 parents studied were heterozygous for these two sequence
changes; of 32 healthy siblings of CLD patients, 23 were heterozygous
for V317del and 9 were homozygous for the wild-type allele (10). Three
carriers of the V317del sequence change were identified in an
examination of 436 control individuals, all of whom resided in the
Eastern part of Finland where the disease is prevalent due to a founder effect (10, 11). However, the presence of two healthy homozygous individuals with the C307W sequence change, the greater than 10-fold population frequency of heterozygotes with the C307W sequence change
compared with the overall predicted frequency of carriers of CLD in
Finland, and the lack of a CLD-associated geographical distribution for
the C307W sequence change all suggest that the C307W sequence change is
not disease causing but represents instead a functionally neutral
polymorphism (10).
/OH
exchanger. The characterization of the DRA protein as a
Cl
/OH
exchanger or a
Cl
/HCO
3
exchanger, however, requires further investigation.
![]()
METHODS
Top
Abstract
Introduction
Methods
Results
Discussion
References
and
purified by alkaline lysis followed by two successive bandings in
cesium chloride gradients (21). Each plasmid was linearized with
Xba I followed by phenol-chloroform extraction and ethanol
precipitation. Capped cRNA was synthesized from the T3 promoter using
the Promega RiboMAX large scale RNA production system in the presence
of the capping analog m7G(5')ppp(5')G (Boehringer Mannheim
Biochemicals, Indianapolis, IN) as per the manufacturer's
instructions. After digestion of the DNA template with RNase-free DNase
and extraction with phenol-chloroform, the unincorporated nucleotides
were removed by Nick Spin column (Pharmacia, Piscataway, NJ) and the
cRNA recovered by ethanol precipitation. The cRNA was then dissolved in
diethyl pyrocarbonate (DEPC)-treated water at a concentration of 10 ng/µl for oocyte injection.
![]()
RESULTS
Top
Abstract
Introduction
Methods
Results
Discussion
References
/HCO
3
exchange and HCO
3-independent SO4/OH
exchange in rabbit ileal brush-border membrane vesicles (24, 25) and
sulfate uptake in DRA cRNA-injected
oocytes (27), significantly reduced chloride uptake in oocytes injected
with wild-type DRA cRNA. DIDS also
significantly reduced chloride uptake in oocytes injected with
DEPC-treated water and the V317del mutant DRA cRNA. This finding may be the
result of inhibition of endogenous chloride uptake in
Xenopus oocytes. Overall, these
results show that, in addition to mediating sulfate transport (27), DRA
mediates DIDS-sensitive chloride transport that appears to be defective in the V317del alone and V317del/C307W mutants.

View larger version (12K):
[in a new window]
Fig. 1.
Chloride uptake in Xenopus oocytes.
Oocytes were injected with either diethyl pyrocarbonate (DEPC)-treated
water (
) or 500 pg wild-type (WT)
DRA cRNA (
; total
volume 50 nl). Four days after injection, uptake of 1 mM
36Cl was determined at 25°C in
medium containing (in mM) 100 Na gluconate, 2 K gluconate, 1 Ca
gluconate, 1 Mg gluconate, and 10 HEPES-Tris, pH 7.5. Uptake values
represent means ± SE of 12-30 determinations from 2 separate
oocyte preparations. * P < 0.05 and ** P < 0.005.

View larger version (15K):
[in a new window]
Fig. 2.
Chloride uptake in Xenopus oocytes.
Oocytes were injected with either DEPC-treated water, 500 pg WT
DRA cRNA, V317del (
V317) alone, or
V317del/C307W mutant DRA cRNA (total
volume 50 nl). Four days after injection, 1-h uptake of 1 mM
36Cl was determined at 25°C in
medium containing (in mM) 100 Na gluconate, 2 K gluconate, 1 Ca
gluconate, 1 Mg gluconate, and 10 HEPES-Tris, pH 7.5, in presence or
absence of 1 mM DIDS. Uptake values represent means ± SE
of 12-64 determinations from 3 separate oocyte preparations.
** P < 0.005 for uptake values
relative to WT injected in absence of DIDS and for uptake values in
presence of DIDS relative to uptake values in absence of DIDS.
Sulfate transport was assayed as before (27), in oocytes injected with
cRNA derived from in vitro transcription of either wild-type
DRA, V317del alone, or V317del/C307W
mutant DRA. As shown in Fig.
3, 1-h uptake of 1 mM
35SO4
was significantly enhanced in oocytes injected with wild-type DRA cRNA compared with sulfate uptake
in oocytes injected with either of the two mutant
DRA cRNAs. In addition, sulfate uptake in oocytes injected with either of the two mutant
DRA cRNAs was not significantly
different from sulfate uptake in oocytes injected with DEPC-treated
water. As previously shown (27), DIDS (1 mM) reduced sulfate uptake in
oocytes injected with wild-type DRA cRNA without affecting sulfate uptake in oocytes injected with either
the V317del mutant DRA cRNA
(P = 0.731) or DEPC-treated water
(P = 0.612). These results confirm
previous findings (27) that DRA mediates DIDS-sensitive sulfate
transport and demonstrate that sulfate transport, like chloride
transport, appears to be defective in the V317del alone and
V317del/C307W DRA mutants.
|
In separate experiments, cRNA derived from in vitro transcription of
wild-type DRA and the mutagenized
construct, C307W alone, was injected into a
Xenopus oocyte expression system and
chloride transport activity was assayed. As shown in Fig.
4A, 1-h
uptake of 1 mM 36Cl was not
significantly different in oocytes injected with wild-type DRA cRNA compared with chloride uptake
in oocytes injected with the C307W mutant
DRA cRNA. However, chloride uptake in
oocytes injected with either wild-type
DRA cRNA or the C307W mutant
DRA cRNA was significantly enhanced
over chloride uptake in oocytes injected with DEPC-treated water. The
differences in absolute uptake values for chloride uptake between this
set of experiments and those shown in Figs. 1 and 2 are most likely a
reflection of the intrinsic variability in oocyte function between
isolations. These results, demonstrating that chloride transport
mediated by the C307W mutant DRA is similar to wild-type DRA, are
consistent with genetic data that argue against this T to G
transversion as a disease-causing mutation (10).
|
As shown in Fig. 4B, 1-h uptake of 1 mM 35SO4 was not significantly different in oocytes injected with wild-type DRA cRNA compared with sulfate uptake in oocytes injected with the C307W mutant DRA cRNA. However, sulfate uptake in oocytes injected with either wild-type DRA cRNA or the C307W mutant DRA cRNA was significantly enhanced over sulfate uptake in oocytes injected with DEPC-treated water.
These results demonstrate that DRA can transport both sulfate and
chloride. Therefore, the effect of increasing concentrations of
chloride on sulfate uptake in oocytes injected with either wild-type
DRA cRNA, V317del mutant
DRA cRNA, or DEPC-treated water was
examined. As illustrated in Fig. 5,
chloride caused a concentration-dependent decrease in the 1-h uptake of
1 mM
35SO4
in oocytes injected with wild-type DRA
cRNA. In this set of experiments, at high chloride concentrations,
sulfate uptake in oocytes injected with wild-type
DRA cRNA was not significantly different from sulfate uptake in oocytes injected with DEPC-treated water. Sulfate uptake in the absence of chloride (and in the presence of 10 mM chloride) in oocytes injected with V317del mutant
DRA cRNA was not significantly
different from sulfate uptake in oocytes injected with DEPC-treated
water.
|
As an initial step to characterize the mechanism for chloride transport
mediated by the DRA protein, the effect of an outwardly directed pH
gradient on chloride uptake in oocytes injected with either wild-type
DRA cRNA, C307W, V317del alone,
V317del/C307W mutant DRA cRNA, or
DEPC-treated water was examined. As illustrated in Fig.
6, 1-h uptake of 1 mM
36Cl was significantly greater in
oocytes injected with wild-type DRA
and C307W cRNA compared with chloride uptake in oocytes injected with
V317del alone and V317del/C307W mutant
DRA cRNA. The addition of DIDS
significantly inhibited pH gradient-stimulated chloride uptake in
oocytes injected with wild-type DRA
and C307W cRNA. Of note, 1-h uptake of 1 mM
36Cl was significantly greater
(P < 0.005) in oocytes injected with V317del alone and V317del/C307W mutant
DRA cRNA compared with chloride uptake
in oocytes injected with DEPC-treated water. The addition of DIDS had
no effect on chloride uptake in oocytes injected with V317del alone and
V317del/C307W mutant DRA cRNA. These
results suggest that the DRA protein acts as a
Cl
/OH
exchanger, although they do not exclude the possibility that the DRA
protein is a
Cl
/HCO
3
exchanger. Furthermore, in the presence of an electrochemical gradient,
the V317del alone and V317del/C307W mutants mediate, in effect,
DIDS-insensitive chloride uptake.
|
Cl
/HCO
3
exchange and
Cl
/OH
exchange have been previously described in rat colonic apical membrane
vesicles (20). Of note, HCO
3
gradient-stimulated chloride uptake was inhibited by 1 mM bumetanide by
only 13%, whereas OH
gradient-stimulated chloride uptake was inhibited by 43% (20). We
therefore examined the effect of bumetanide on chloride uptake in the
presence of an outwardly directed pH gradient in oocytes injected with
either wild-type DRA cRNA, C307W,
V317del alone, V317del/C307W mutant
DRA cRNA, or DEPC-treated water. As
illustrated in Fig. 7, the addition of
bumetanide significantly inhibited pH gradient-stimulated 1 mM
36Cl uptake in oocytes injected
with wild-type DRA and C307W cRNA. As
in Fig. 6, 1-h uptake of 1 mM 36Cl
was significantly greater (P < 0.05) in oocytes injected with V317del alone and V317del/C307W
mutant DRA cRNA compared with chloride
uptake in oocytes injected with DEPC-treated water and the addition of
bumetanide had no effect on chloride uptake in these oocytes. These
results demonstrate that the DRA protein exhibits features similar to
apical
Cl
/OH
exchange in rat colon.
|
| |
DISCUSSION |
|---|
|
|
|---|
Although intestinal perfusion studies suggested that the chloride
malabsorption observed in CLD was the result of a defect in
Cl
/HCO
3
exchange in both the ileum and the colon, mapping of the CLD locus by
linkage analysis to chromosome 7q31 adjacent to the
CFTR gene and four chromosomal bands
away from the
Cl
/HCO
3
exchanger AE2 (15), implicated other intestinal chloride transport processes in this disorder. Further genetic and physical mapping implicated the
DRA gene as a positional candidate for
CLD (9, 11). The identification of
three different DRA sequence changes,
including the double-sequence change in 32 of 32 Finnish patients in
homozygous form and in heterozygous form in all 43 parents (10)
provided further evidence that DRA is involved in intestinal chloride
transport and that mutations of DRA
result in CLD. In this study we have demonstrated that in addition to
sulfate transport activity (27) DRA mediates chloride transport with
features suggestive of
Cl
/OH
exchange. Furthermore, the V317del mutation of
DRA results in the loss of both
chloride and sulfate transport activity, whereas the C307W sequence
change appears to be a functionally silent polymorphism.
The protein product of the DRA gene is
a membrane glycoprotein with 10-14 predicted transmembrane domains
(4). Protein expression is restricted to the columnar epithelial cells,
particularly to the apical (brush-border) membrane (4). As shown in
Fig. 8, three models of the secondary
structure of the DRA protein have been proposed that vary in the number
of transmembrane domains. In the top model, the V317del mutation lies
in the fourth intracellular domain of the DRA protein (4, 10). In the
other two models the V317del mutation lies in the fourth extracellular
domain of the DRA protein. Although the V317del mutation does not
affect the transcriptional activity of the gene (10), it remains to be
determined whether this mutation results in the insertion of functionally defective protein into the apical membrane of absorptive enterocytes or whether defective chloride and sulfate transport represents a trafficking defect similar to that recently described for
the intestinal Na+-dependent
glucose transporter (19). Results depicted in Figs. 6 and 7
demonstrating that chloride uptake into oocytes injected with
V317
alone and
V317/C307W mutant DRA
cRNA is significantly greater than chloride uptake in oocytes injected
with DEPC-treated water and is unaffected by the inhibitors DIDS and
bumetanide suggest that a functionally defective protein is inserted
into the membrane that nonetheless can support the movement of chloride down an electrochemical gradient. The C307W sequence change might also
be expected to affect the secondary structure of the DRA protein
through the loss of an intramolecular disulfide bond. However, cysteine
307 is not a conserved amino acid in either of the sulfate transporters
encoded by the Sat-1 and
DTDST genes (3, 8).
|
We have previously identified DRA as an intestine-specific sulfate
transporter that is sensitive to DIDS and oxalate (27). A
Cl
/OH
antiport has been identified in isolated rat and rabbit brush-border membrane vesicles capable of exchanging luminal
Cl
for intracellular
OH
,
Cl
, and/or
HCO
3 (16, 17). However, sulfate did
not inhibit pH and HCO
3
gradient-stimulated Cl
uptake (16), suggesting that sulfate is not a substrate for this ileal
Cl
/OH
(HCO
3)
exchanger. In addition, electroneutral, HCO
3-independent,
Cl
/OH
exchange has been identified in ileal brush-border membrane vesicles and, of note, a defect in this transport process in CLD was previously proposed (30). The effect of sulfate on
Cl
uptake was not, however,
examined in these vesicle transport studies. A
SO4/OH
exchanger has also been identified in rabbit ileal brush-border membrane vesicles (24). In contrast to the lack of an effect of sulfate
on pH gradient-stimulated
Cl
uptake (24),
Cl
and oxalate both
significantly inhibited pH gradient-stimulated SO4 uptake (25).
Cl
/HCO
3
and
Cl
/OH
exchange have also both been described in apical membrane vesicles of
rat distal colon (20). In this study,
HCO
3 gradient-stimulated chloride
uptake was inhibited by 1 mM bumetanide by only 13%, whereas
OH
gradient-stimulated
chloride uptake was inhibited by 43% (20). Oxalate (1 mM) also
significantly inhibited OH
gradient-stimulated chloride uptake (20). Therefore, the results of
this and previous studies (27) strongly suggest that DRA is an apical
Cl
(SO4)/OH
exchanger in the intestine and that the defect underlying CLD resides
in this transporter. Nevertheless, additional studies are required to
determine whether DRA functions as an intestinal Cl
(SO4)/HCO
3 exchanger.
DRA expression is much higher in the colon than the ileum (27). Because the colon is the major site of water absorption, this finding supports the hypothesis that a mutation in the DRA protein results in CLD. Physiologically, these results suggest that in the normal distal ileum and colon chloride is preferentially absorbed proximally. Sulfate absorption is increased in the distal colon where chloride concentrations are low due to efficient proximal absorption. Phenotypically, the defect in intestinal sulfate absorption, however, does not result in distinct clinical manifestations.
DRA was originally identified as a
gene that was expressed in normal colonic tissue but was significantly
decreased or absent in adenomas and adenocarcinomas (26), an expression
profile that has been recently confirmed using the method of serial
analysis of gene expression in normal and neoplastic cells (31). This expression profile initially led to speculation that it might represent
a tumor suppressor gene involved in colon carcinogenesis (26). With the
demonstration that DRA is an intestine-specific anion transporter, it
remains unclear whether loss of transport function may be involved in
the development of the malignant phenotype or is an epiphenomenon.
Intracellular pH (pHi)
regulation appears to be involved in cellular growth and cell division
(7) and the higher pHi, for
example, in the SW-620 human colon carcinoma cell line is accounted for
by the absence of
Cl
/OH
(HCO
3)
exchange (2). However, there is no established association between CLD
and colonic adenomas and adenocarcinomas. Furthermore, mortality in
patients affected with CLD has been linked only to inadequate
replacement therapy (13). Indeed, the loss of
DRA expression, normally restricted to
the differentiated surface epithelium of the colon, in adenomas and
adenocarcinomas may simply reflect the loss of a differentiated
phenotype during the process of neoplasia. The loss of
DRA expression in a tubular adenoma in
a Finnish CLD patient (10) is consistent with this hypothesis.
DRA is closely related to the genes
encoding the diastrophic dysplasia sulfate transporter
(DTDST) (8) and the rat canalicular SO4/HCO
3
exchanger Sat-1 (3). Injection of rat
and human DTDST cRNA into Xenopus
oocytes was recently shown to induce
Na+-independent sulfate transport
that was inhibited by extracellular chloride and bicarbonate (23). In
contrast, Sat-1-directed sulfate uptake was stimulated by extracellular
chloride and inhibited by bicarbonate. Although interpreted to suggest
that DTDST functions as a sulfate/chloride antiporter, these results
are also compatible with the notion that DTDST is a
Cl
(SO4)/OH
(HCO
3)
exchanger. Thus this family of genes may all encode anion exchangers.
In summary, we have demonstrated that the
DRA gene product functions not only as
a sulfate transporter but also confers chloride transport activity,
with features consistent with
Cl
/OH
exchange. A mutation that is present in homozygous form in all of 32 Finnish patients affected with CLD abolishes both chloride and sulfate
transport, whereas anion transport is unaffected by another sequence
change that is present in homozygous form in both CLD patients and
healthy controls. These findings functionally confirm that a mutated
DRA gene is responsible for the severe loss of chloride in stool that characterizes this disorder. The clinical picture of CLD, identification of mutations of
DRA in CLD patients, and the present
results establish the DRA protein as the anion exchanger that
physiologically is most likely responsible for absorbing greater than
90 mmol/l of chloride from the intestinal lumen along the length of the
distal ileum and colon. An understanding of the molecular background of
a rare disease has therefore made it possible to define a role for one
of the many intestinal transporters.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Alison Berent, Lena J. Zugger, Ning Huang, Kris Snow, and Wen Jiang for technical assistance; David C. Dawson, PhD, and the University of Michigan Peptide Research Center for the use of equipment in the preparation of microinjection needles; and Brenda Vibbart for assistance in the preparation of the manuscript.
| |
FOOTNOTES |
|---|
This study was supported in part by the Medical Research Service of the Department of Veterans Affairs (R. H. Moseley), by the National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-47709 (G. D. Wu), and by the Finnish Pediatric Foundation, Ulla Hjelt Fund, Farmos Research and Science Foundation, Sigrid Juselius Foundation, and the Academy of Finland.
A portion of this work was performed at the Folkhalsan Institute of Genetics.
Part of this work was presented at the annual meeting of the American Gastroenterological Association, Washington, DC, May 1997 and published in abstract form in Gastroenterology 112: A387, 1997.
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests: R. H. Moseley, Medical Service (111), Veterans Affairs Medical Center, 2215 Fuller Rd., Ann Arbor, Michigan 48105.
Received 7 January 1998; accepted in final form 2 October 1998.
| |
REFERENCES |
|---|
|
|
|---|
1.
Bieberdorf, F. A.,
P. Gorden,
and
J. S. Fordtran.
Pathogenesis of congenital alkalosis with diarrhea: implications for the physiology of normal ileal electrolyte absorption and secretion.
J. Clin. Invest.
51:
1958-1968,
1972.
2.
Bischof, G.,
E. Cosentini,
G. Hamilton,
M. Riegler,
J. Zacherl,
B. Teleky,
W. Feil,
R. Schiessel,
T. E. Machen,
and
E. Wenzl.
Effects of extracellular pH on intracellular pH-regulation and growth in a human colon carcinoma cell-line.
Biochim. Biophys. Acta
1282:
131-139,
1996[Medline].
3.
Bissig, M.,
B. Hagenbuch,
B. Stieger,
T. Koller,
and
P. J. Meier.
Functional expression cloning of the canalicular sulfate transport system of rat hepatocytes.
J. Biol. Chem.
269:
3017-3021,
1994
4.
Byeon, M. K.,
M. A. Westerman,
I. G. Maroulakou,
K. W. Henderson,
S. Suster,
X.-K. Zhang,
T. S. Papas,
J. Vesely,
M. C. Willingham,
J. E. Green,
and
C. W. Schweinfest.
The down-regulated in adenoma (DRA) gene encodes an intestine-specific membrane glycoprotein.
Oncogene
12:
387-396,
1996[Medline].
5.
Darrow, D. C.
Congenital alkalosis with diarrhoea.
J. Pediatr.
26:
519-532,
1945.
6.
Gamble, J. L.,
K. R. Fahey,
J. Appelton,
and
E. McLachlan.
Congenital alkalosis with diarrhoea.
J. Pediatr.
26:
509-518,
1945.
7.
Grinstein, S.,
D. Rotin,
and
M. J. Mason.
Na+/H+ exchange and growth factor-induced cytosolic pH changes: role in cellular proliferation.
Biochim. Biophys. Acta
988:
73-97,
1989[Medline].
8.
Hastbacka, J.,
A. de la Chapelle,
M. M. Mahtani,
G. Clines,
M. P. Reeve-Daly,
M. Daly,
B. A. Hamilton,
K. Kusumi,
B. Trivedi,
A. Weaver,
A. Coloma,
M. Lovett,
A. Buckler,
I. Kaitila,
and
E. S. Lander.
The diastrophic dysplasia gene encodes a novel sulfate transporter: positional cloning by fine-structure linkage disequilibrium mapping.
Cell
78:
1073-1087,
1994[Medline].
9.
Höglund, P.,
S. Haila,
S. W. Scherer,
L. C. Tsui,
E. D. Green,
J. Weissenbach,
C. Holmberg,
A. de la Chapelle,
and
J. Kere.
Positional candidate genes for congenital chloride diarrhea suggested by high-resolution physical mapping in chromosome region 7q31.
Genome Res.
6:
202-210,
1996
10.
Höglund, P.,
S. Haila,
J. Socha,
L. Tomaszewski,
U. Saarialho-Kere,
M.-L. Karjalainen-Lindsberg,
K. Airola,
C. Holmberg,
A. de la Chapelle,
and
J. Kere.
Mutations of the down-regulated in adenoma (DRA) gene cause congenital chloride diarrhoea.
Nat. Genet.
14:
316-319,
1996[Medline].
11.
Höglund, P.,
P. Sistonen,
R. Norio,
C. Holmberg,
A. Dimberg,
K.-H. Gustavson,
A. de la Chapelle,
and
J. Kere.
Fine mapping of the congenital chloride diarrhea gene by linkage disequilibrium.
Am. J. Hum. Genet.
57:
95-102,
1995[Medline].
12.
Holmberg, C.,
J. Perheentupa,
and
K. Launiala.
Colonic electrolyte transport in health and in congenital chloride diarrhea.
J. Clin. Invest.
56:
302-310,
1975.
13.
Holmberg, C.,
J. Perheentupa,
K. Launiala,
and
N. Hallman.
Congenital chloride diarrhoea: clinical analysis of 21 Finnish patients.
Arch. Dis. Child.
52:
255-267,
1977
14.
Kagalwalla, A. F.
Congenital chloride diarrhea: a study in Arab children.
J. Clin. Gastroenterol.
19:
36-40,
1994[Medline].
15.
Kere, J.,
P. Sistonen,
C. Holmberg,
and
A. de la Chapelle.
The gene for congenital chloride diarrhea maps close to but is distinct from the gene for cystic fibrosis transmembrane conductance regulator.
Proc. Natl. Acad. Sci. USA
90:
10686-10689,
1993
16.
Knickelbein, R.,
P. S. Aronson,
C. M. Schron,
J. Seifter,
and
J. W. Dobbins.
Sodium and chloride transport across rabbit ileal brush border. II. Evidence for Cl-HCO
3 exchange and mechanism of coupling.
Am. J. Physiol.
249 (Gastrointest. Liver Physiol. 12):
G236-G245,
1985
17.
Liedtke, C. M.,
and
U. Hopfer.
Mechanism of Cl
translocation across small intestinal brush-border membrane. II. Demonstration of Cl
-OH
exchange and Cl
conductance.
Am. J. Physiol.
242 (Gastrointest. Liver Physiol. 5):
G272-G280,
1982
18.
Lubani, M. M.,
K. I. Doudin,
D. C. Sharda,
A. A. Shaltout,
T. S. Al-Shab,
Y. K. Abdul Al,
M. A. Said,
M. M. Salhi,
and
S. A. Ahmed.
Congenital chloride diarrhoea in Kuwaiti children.
Eur. J. Pediatr.
148:
333-336,
1989[Medline].
19.
Martin, M. G.,
M. P. Lostao,
E. Turk,
J. Lam,
M. Kreman,
and
E. M. Wright.
Compound missense mutations in the sodium/D-glucose cotransporter result in trafficking defects.
Gastroenterology
112:
1206-1212,
1997[Medline].
20.
Rajendran, V. M.,
and
H. J. Binder.
Cl-HCO3 and Cl-OH exchanges mediate Cl uptake in apical membrane vesicles of rat distal colon.
Am. J. Physiol.
264 (Gastrointest. Liver Physiol. 27):
G874-G879,
1993
21.
Sambrook, J.,
E. F. Fritsch,
and
T. Maniatis.
Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, ME: Cold Spring Harbor Laboratory, 1989.
22.
Sandal, N. N.,
and
K. A. Marcker.
Similarities between a soybean nodulin, Neurospora crassa sulphate permease II and a putative tumour suppressor.
Trends Biochem. Sci.
19:
19,
1994[Medline].
23.
Satoh, H.,
M. Susaki,
C. Shukunami,
K.-I. Iyama,
T. Negoro,
and
Y. Hiraki.
Functional analysis of diastrophic dysplasia sulfate transporter.
J. Biol. Chem.
273:
12307-12315,
1998
24.
Schron, C. M.,
R. G. Knickelbein,
P. S. Aronson,
J. Della Puca,
and
J. W. Dobbins.
pH gradient-stimulated sulfate transport by rabbit ileal brush-border membrane vesicles: evidence for SO4-OH exchange.
Am. J. Physiol.
249 (Gastrointest. Liver Physiol. 12):
G607-G613,
1985.
25.
Schron, C. M.,
R. G. Knickelbein,
P. S. Aronson,
J. Della Puca,
and
J. W. Dobbins.
Effects of cations on pH gradient-stimulated sulfate transport in rabbit ileal brush-border membrane vesicles.
Am. J. Physiol.
249 (Gastrointest. Liver Physiol. 12):
G614-G621,
1985.
26.
Schweinfest, C. W.,
K. W. Hendenerson,
S. Suster,
N. Kondoh,
and
T. S. Papas.
Identification of a colon mucosa gene that is down-regulated in colon adenomas and adenocarcinomas.
Proc. Natl. Acad. Sci. USA
90:
4166-4170,
1993
27.
Silberg, D. G.,
W. Wang,
R. H. Moseley,
and
P. G. Traber.
The Down Regulated in Adenoma (dra) gene encodes an intestine-specific membrane sulfate transport protein.
J. Biol. Chem.
270:
11897-11902,
1995
28.
Tomaszewski, J.,
E. Kulesza,
and
J. Socha.
Congenital chloride diarrhoea in Poland.
Mater. Med. Pol.
4:
271-277,
1987.
29.
Turnberg, L. A.
Abnormalities in intestinal electrolyte transport in congenital chloridorrhoea.
Gut
12:
544-551,
1971
30.
Vasseur, M.,
M. Cauzac,
and
F. Alvarado.
Electroneutral, HCO
3-independent, pH gradient-dependent uphill transport of Cl
by ileal brush-border membrane vesicles: possible role in the pathogenesis of chloridorrhea.
Biochem. J.
263:
775-784,
1989[Medline].
31.
Zhang, L.,
W. Zhou,
V. E. Velculescu,
S. E. Kern,
R. H. Hruban,
S. R. Hamilton,
B. Vogelstein,
and
K. W. Kinzler.
Gene expression profiles in normal and cancer cells.
Science
276:
1268-1272,
1997
This article has been cited by other articles:
![]() |
R. W. Freel, M. Morozumi, and M. Hatch Parsing apical oxalate exchange in Caco-2BBe1 monolayers: siRNA knockdown of SLC26A6 reveals the role and properties of PAT-1 Am J Physiol Gastrointest Liver Physiol, November 1, 2009; 297(5): G918 - G929. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ohana, D. Yang, N. Shcheynikov, and S. Muallem Diverse transport modes by the solute carrier 26 family of anion transporters J. Physiol., May 15, 2009; 587(10): 2179 - 2185. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Musch, D. L. Arvans, G. D. Wu, and E. B. Chang Functional coupling of the downregulated in adenoma Cl-/base exchanger DRA and the apical Na+/H+ exchangers NHE2 and NHE3 Am J Physiol Gastrointest Liver Physiol, February 1, 2009; 296(2): G202 - G210. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R. Dorwart, N. Shcheynikov, D. Yang, and S. Muallem The Solute Carrier 26 Family of Proteins in Epithelial Ion Transport Physiology, April 1, 2008; 23(2): 104 - 114. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Kurita, T. Nakada, A. Kato, H. Doi, A. C. Mistry, M.-H. Chang, M. F. Romero, and S. Hirose Identification of intestinal bicarbonate transporters involved in formation of carbonate precipitates to stimulate water absorption in marine teleost fish Am J Physiol Regulatory Integrative Comp Physiol, April 1, 2008; 294(4): R1402 - R1412. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. A. Alrefai, X. Wen, W. Jiang, J. P. Katz, K. A. Steinbrecher, M. B. Cohen, I. R. Williams, P. K. Dudeja, and G. D. Wu Molecular cloning and promoter analysis of downregulated in adenoma (DRA) Am J Physiol Gastrointest Liver Physiol, November 1, 2007; 293(5): G923 - G934. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhang, N. Ameen, J. E. Melvin, and S. Vidyasagar Acute inflammation alters bicarbonate transport in mouse ileum J. Physiol., June 15, 2007; 581(3): 1221 - 1233. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Simpson, C. W. Schweinfest, G. E. Shull, L. R. Gawenis, N. M. Walker, K. T. Boyle, M. Soleimani, and L. L. Clarke PAT-1 (Slc26a6) is the predominant apical membrane Cl-/HCO3- exchanger in the upper villous epithelium of the murine duodenum Am J Physiol Gastrointest Liver Physiol, April 1, 2007; 292(4): G1079 - G1088. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Katoh, M. Tresguerres, K. M. Lee, T. Kaneko, K. Aida, and G. G. Goss Cloning of rainbow trout SLC26A1: involvement in renal sulfate secretion Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2006; 290(5): R1468 - R1478. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Simpson, L. R. Gawenis, N. M. Walker, K. T. Boyle, and L. L. Clarke Chloride conductance of CFTR facilitates basal Cl-/HCO3- exchange in the villous epithelium of intact murine duodenum Am J Physiol Gastrointest Liver Physiol, June 1, 2005; 288(6): G1241 - G1251. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vidyasagar, V. M. Rajendran, and H. J. Binder Three distinct mechanisms of HCO3- secretion in rat distal colon Am J Physiol Cell Physiol, September 1, 2004; 287(3): C612 - C621. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Keller, T. Ezaki, R.-J. Guo, and J. P. Lynch Cdx1 or Cdx2 expression activates E-cadherin-mediated cell-cell adhesion and compaction in human COLO 205 cells Am J Physiol Gastrointest Liver Physiol, July 1, 2004; 287(1): G104 - G114. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lohi, G. Lamprecht, D. Markovich, A. Heil, M. Kujala, U. Seidler, and J. Kere Isoforms of SLC26A6 mediate anion transport and have functional PDZ interaction domains Am J Physiol Cell Physiol, March 1, 2003; 284(3): C769 - C779. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Sterling, N. J. D. Brown, C. T. Supuran, and J. R. Casey The functional and physical relationship between the DRA bicarbonate transporter and carbonic anhydrase II Am J Physiol Cell Physiol, November 1, 2002; 283(5): C1522 - C1529. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Xie, R. Welch, A. Mercado, M. F. Romero, and D. B. Mount Molecular characterization of the murine Slc26a6 anion exchanger: functional comparison with Slc26a1 Am J Physiol Renal Physiol, October 1, 2002; 283(4): F826 - F838. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Saksena, R. K. Gill, I. A. Syed, S. Tyagi, W. A. Alrefai, K. Ramaswamy, and P. K. Dudeja Modulation of Cl-/OH- exchange activity in Caco-2 cells by nitric oxide Am J Physiol Gastrointest Liver Physiol, September 1, 2002; 283(3): G626 - G633. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lohi, S. Makela, K. Pulkkinen, P. Hoglund, M.-L. Karjalainen-Lindsberg, P. Puolakkainen, and J. Kere Upregulation of CFTR expression but not SLC26A3 and SLC9A3 in ulcerative colitis Am J Physiol Gastrointest Liver Physiol, September 1, 2002; 283(3): G567 - G575. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Lohi, M. Kujala, S. Makela, E. Lehtonen, M. Kestila, U. Saarialho-Kere, D. Markovich, and J. Kere Functional Characterization of Three Novel Tissue-specific Anion Exchangers SLC26A7, -A8, and -A9 J. Biol. Chem., April 12, 2002; 277(16): 14246 - 14254. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kunzelmann and M. Mall Electrolyte Transport in the Mammalian Colon: Mechanisms and Implications for Disease Physiol Rev, January 1, 2002; 82(1): 245 - 289. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Markovich Physiological Roles and Regulation of Mammalian Sulfate Transporters Physiol Rev, October 1, 2001; 81(4): 1499 - 1533. [Abstract] [Full Text] [PDF] |
||||
![]() |
P Hoglund, C Holmberg, P Sherman, and J Kere Distinct outcomes of chloride diarrhoea in two siblings with identical genetic background of the disease: implications for early diagnosis and treatment Gut, May 1, 2001; 48(5): 724 - 727. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Rajendran, J. Black, T. A. Ardito, P. Sangan, S. L. Alper, C. Schweinfest, M. Kashgarian, and H. J. Binder Regulation of DRA and AE1 in rat colon by dietary Na depletion Am J Physiol Gastrointest Liver Physiol, November 1, 2000; 279(5): G931 - G942. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Melvin, K. Park, L. Richardson, P. J. Schultheis, and G. E. Shull Mouse Down-regulated in Adenoma (DRA) Is an Intestinal Cl-/HCO3- Exchanger and Is Up-regulated in Colon of Mice Lacking the NHE3 Na+/H+ Exchanger J. Biol. Chem., August 6, 1999; 274(32): 22855 - 22861. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kere, H. Lohi, and P. Hoglund III. Congenital chloride diarrhea Am J Physiol Gastrointest Liver Physiol, January 1, 1999; 276(1): G7 - G13. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Mercado, L. Song, N. Vazquez, D. B. Mount, and G. Gamba Functional Comparison of the K+-Cl- Cotransporters KCC1 and KCC4 J. Biol. Chem., September 22, 2000; 275(39): 30326 - 30334. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Toure, L. Morin, C. Pineau, F. Becq, O. Dorseuil, and G. Gacon Tat1, a Novel Sulfate Transporter Specifically Expressed in Human Male Germ Cells and Potentially Linked to RhoGTPase Signaling J. Biol. Chem., June 1, 2001; 276(23): 20309 - 20315. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |