|
|
||||||||
1 Department of Physiology, Tufts University School of Medicine, Boston, Massachusetts 02111; and 2 Department of Pathology, Albert Einstein College of Medicine, Bronx, New York 10461
| |
ABSTRACT |
|---|
|
|
|---|
Bile secretion in liver is
driven in large part by ATP-binding cassette (ABC)-type proteins that
reside in the canalicular membrane and effect ATP-dependent transport
of bile acids, phospholipids, and non-bile acid organic anions.
Canalicular ABC-type proteins can be classified into two subfamilies
based on membrane topology and sequence identity: MDR1, MDR3, and SPGP
resemble the multidrug resistance (MDR)
P-glycoprotein, whereas MRP2 is similar in structure and
sequence to the multidrug resistance protein MRP1 and transports similar substrates. We now report the isolation of the rMRP3 gene from
rat liver, which codes for a protein 1522 amino acids in length that
exhibits extensive sequence similarity with MRP1 and MRP2. Northern
blot analyses indicate that rMRP3 is expressed in lung and intestine of
Sprague-Dawley rats as well as in liver of Eisai hyperbilirubinemic
rats and TR
mutant rats, which are deficient in MRP2
expression. rMRP3 expression is also transiently induced in liver
shortly after birth and during obstructive cholestasis.
Antibodies raised against MRP3 recognize a polypeptide of
190-200 kDa, which is reduced in size to 155-165 kDa after treatment
with endoglycosidases. Immunoblot analysis and immunoconfocal
microscopy indicate that rMRP3 is present in the canalicular membrane,
suggesting that it may play a role in bile formation.
MRP; bile duct ligation; TR
rat; apical
hepatocyte domain; glycoprotein
| |
INTRODUCTION |
|---|
|
|
|---|
BILE SECRETION is an essential route for excretion and recirculation of drugs, vitamins, and lipids as well as endogenous and exogenous toxins. Biliary constituents such as bile acids, phospholipids, and glutathione and glucuronide conjugates exhibit concentrations in bile that are manyfold higher than those found in cytoplasm, indicating that secretion is an active process. Various ATP-binding cassette (ABC)-type proteins, which are sorted to the apical domain of the hepatocyte, promote bile formation by mediating ATP-dependent translocation of biliary components across the canalicular membrane. SPGP effects ATP-dependent transport of taurocholate (3, 7), generating a large fraction of the osmotic gradient that drives bile flow. MDR3 mediates flipping of phosphatidylcholine in the canalicular membrane, thereby fostering its release into bile (28, 33). MRP2 (also called cMOAT and cMRP) is primarily responsible for non-bile acid-dependent bile flow, effecting biliary secretion of glutathione, sulfate, and glucuronide conjugates, which include conjugated bilirubin (2, 12, 31). MDR1 is associated with transport of a wide variety of small, hydrophobic, cationic drugs into bile (16) and flipping of short-chain phospholipids in the canalicular membrane (41).
A number of inheritable human disorders are associated with mutations
in genes that code for canalicular transporters. Mutations in the SPGP
gene are associated with subtype II of progressive familial
intrahepatic cholestasis (PFIC) (36). PFIC III and the Dubin-Johnson
syndromes have been linked with mutations in the MDR3 (5) and MRP2 (17,
32, 42) genes, respectively. Single nucleotide changes in the MRP2 and
MDR3 mRNAs introduce nonsense codons that interrupt the protein coding
sequences and result in destabilization of the mutant transcripts.
Animal models have been generated or identified for some of these
diseases. For example, mdr2
/
knockout mice (35) exhibit a
pattern of cholestasis and cirrhosis similar to that observed in PFIC
III patients. TR
mutant rats (2, 31) and Eisai
hyperbilirubinemic rats (EHBR) (12) were identified as
hyperbilirubinemic mutants deficient in biliary secretion of non-bile
acid organic anions and were shown to harbor point mutations in
the MRP2 gene that severely reduce RNA and protein levels. Lith mice,
which manifest cholesterol cholelithiasis, overexpress SPGP and display
altered taurocholate levels in bile (43).
Canalicular ABC-type transporters can be classified into two major subtypes based on sequence and structure. ABC-type proteins characteristically contain one or two highly conserved nucleotide-binding domains (NBD) associated with hydrophobic regions capable of spanning the membrane multiple times. SPGP, MDR1, and MDR3 share extensive amino acid sequence similarity and exhibit a symmetrical 6+6 arrangement of transmembrane helices in the hydrophobic domains linked to the NBDs. MRP2 and its homologue MRP1 are asymmetrical in structure, display an 11+6 organization of the membrane-spanning domains (18, 19), and share little amino acid sequence similarity with the MDR subfamily outside of the conserved NBD regions. We now report identification in rat liver of another member of the MRP subfamily, named rMRP3, which shares substantial sequence and structural similarities with MRP2 and MRP1. rMRP3 expression is induced by obstructive cholestasis and in mutant rats deficient in MRP2 expression. We also show that the rMRP3 protein is present in the canalicular membrane of the hepatocyte.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cloning.
The amino acid sequence of the yeast bile acid transporter BAT1p (29)
was aligned with the proteins most closely resembling it in yeast and
mammals by using the CLUSTALW algorithm. Sequence motifs that were
conserved in MRP1, YHLOp, YK83p, and YCF1p, but absent in the
canalicular ABC-type transporters MDR1 and MDR3, were identified and
used to design degenerate oligonucleotide primers. The primers were
used for RT-PCR of 1 µg of poly(A)+ RNA prepared from
human liver and TR
rat liver; the latter represents a
rat mutant deficient in MRP2 mRNA accumulation. The sense primer
(AAAGAATTCGGIATIGTIGGIC/AGIACIGG) represented amino acid sequence
GIVGRT, and the antisense primer (AAAGAATTCAA/GICC/TG/ATGIGCIATIGT) was
derived from amino acid sequence TIAHRI. An EcoR I site
preceded by three random nucleotides was incorporated on the 3'
terminus of each primer. PCR parameters were 3× 95°C, 40°C,
72°C and 30× 95°C, 55°C, 72°C; all steps were for 1 min. PCR
products 470-520 bp in length were purified from agarose gels and
cloned into the pCR2 vector (Invitrogen). Clones were classified by
restriction mapping, Southern blot analysis, and nucleotide sequencing.
rat liver
poly(A)+ RNA were performed with a kit obtained from Life
Technologies and according to the manufacturer's instructions.
A full-length cDNA was constructed for each gene by combining as much
as possible of the cDNA inserts obtained from lambda cDNA library and
cDNAs generated by PCR. The 5' portion of the rat and human cDNAs were
amplified from liver poly(A)+ RNA by RT-PCR using the
proofreading thermostable polymerase Pfu (Stratagene).
Oligonucleotide primers were designed based on sequence information
obtained from the furthermost 5' RACE products. The human gene primers
were TATGCGGCCGCTCGCCTTCCTTGCAGCC (sense) and
AGATCTAGAGTGTCAAAGAAGGACTGTGG (antisense), which included a Not
I and Xba I, respectively, on the 3' terminus. For the rat cDNA, primers were CTTCTAGCTGGGGTTGAG (sense) and GTCCCTGGTCCAGAAGGAG (antisense). The nucleotide sequences of the human and rat cDNAs were
obtained by automated DNA sequencing of double-stranded plasmid DNA.
Northern blot analysis. Tissues were removed from euthanized rats and frozen immediately in liquid nitrogen. Total RNA was prepared using the Trizol reagent system (LifeTechnologies). Poly(A)+ RNA was prepared from total RNA using the FastTrac 2.0 kit (Invitrogen). Poly(A)+ RNA (5 µg/lane) was loaded and separated by electrophoresis on denaturing formaldehyde-1% agarose gels. RNA was immobilized on GeneScreen plus (DuPont) membranes after capillary transfer. DNA fragments were radioactively labeled by random primer extension (Boehringer Mannheim). The rMRP3 probe was a 1.3-kb BamH I fragment obtained from rMRP3 cDNA. The rMRP2 probe was a 1.7-kb Nco I-Xho I fragment obtained from a partial rMRP2 cDNA. Hybridization at 42°C was done in 50% formamide, 6× standard saline citrate (SSC), 10× Denhardt's, 0.5% SDS, and 100 µg/ml denatured salmon sperm DNA in a Robbins Scientific hybridization oven. The blots were washed sequentially with 2× SSC, 0.5% SDS at 25°C, 1× SSC, 0.25% SDS at 42°C, and 0.2× SSC, 0.05% SDS at 65°C and exposed to film.
Bile duct ligation. Male Sprague-Dawley rats 250-300 g in weight were anesthetized by intraperitoneal injection of pentobarbital sodium (50 mg/kg body wt). The abdominal cavity was opened aseptically, and the common bile duct was ligated at two locations and cut between the ligatures. Sham-operated animals underwent the same procedure in which the common bile duct was exposed but not ligated or cut. Livers were extracted at the times indicated and processed for subcellular fractionation, RNA preparation, or immunocytochemistry. Sinusoidal membrane vesicles (SMV) and canalicular membrane vesicles (CMV) were prepared as described (11).
Antibodies and immunoblot analysis.
The "linker" domain of MRP3, which resides immediately downstream
of the first NBD, exhibits little or no homology with other proteins in
the database. A 216-bp DNA fragment encoding amino acids 876-948
of human MRP3 was ligated in frame with the glutathione S-transferase (GST) coding region of pGEX5-3x
(Pharmacia). The construct was transformed into Escherichia
coli, and a GST-MRP3 fusion protein was overexpressed and purified
by affinity chromatography on GSH-Sepharose (Pharmacia). Antisera
raised against the GST fusion protein recognized an
isopropyl-
-D-thiogalactopyranoside inducible peptide of relative molecular mass 39 kDa in extracts of
E. coli expressing the GST-MRP3 fusion. IgG was purified from rabbit sera by affinity chromatography on protein A-Sepharose (Pharmacia). Anti-GST antibodies were cleared from IgG by passage through a GST-Sepharose column (Pierce). GST-MRP3 was bound to Affigel-10 (Bio-Rad) following the manufacturer's instructions and
used to purify MRP3-specific IgG by affinity chromatography. Immunoblot
analysis was performed as described (29). Briefly, 50 µg of protein
were incubated for 10 min at 65°C in 2.5% SDS, 0.1 M
Tris · HCl, pH 6.8, 1 M urea, and 5 mM
dithiothreitol and separated by SDS-PAGE. Proteins were
electrotransfered to nitrocellulose and incubated with antibody diluted
in 0.25% (wt/vol) gelatin, 0.5% (wt/vol) BSA, 50 mM
Tris · HCl, pH 8.0, 150 mM NaCl, and 0.05% (vol/vol) Tween
20. Secondary antibodies were horseradish peroxidase-conjugated goat
anti-rabbit IgG and anti-mouse IgG (Bio-Rad). Antibody staining was
visualized by enhanced chemiluminescence (Pierce)
Immunocytochemistry. Liver fragments (5 × 5 × 2 mm) were immersed in 0.25 M sucrose-PBS for 30 min at 0°C, submerged in optimum cutting temperature (OCT) compound (Tissue-Tek), and frozen on dry ice. Sections (6-8 µm) cut with a cryostat were incubated in blocking buffer [PBS containing 3% (wt/vol) BSA, 2% fetal calf serum, 0.02% (vol/vol) Triton X-100, and 0.1 M glycine] at 37°C for 1 h. Slides were washed in PBS at room temperature for 5 min and incubated for 2 h with affinity-purified anti-MRP3 IgG (50 µg/ml) at 37°C. After washing with PBS for 5 min, the slides were immersed in 3% (vol/vol) formaldehyde-PBS at 0°C for 2 min, washed with three changes of PBS for 15 min, and incubated in blocking buffer at room temperature for 15 min. The sections were stained with 10 µg/ml C219 IgG (Signet) for 2 h at room temperature, washed with PBS for 5 min, and incubated with Texas red-labeled goat anti-rabbit IgG and Cy2-labeled goat anti-mouse IgG (Jackson ImmunoResearch) at 15 µg/ml in blocking buffer for 45 min at room temperature. Slides were washed for 5 min with three changes of PBS at room temperature, mounted with Crystalmount (Biomeda), and observed at ×400 magnification by confocal microscopy.
| |
RESULTS |
|---|
|
|
|---|
An MRP-like protein exhibits differential expression in liver of
TR
rats, EHBR, and normal rats.
RT-PCR of poly(A)+ RNA from TR
liver
identified a number of MRP-like sequences that differed from MRP2, the
canalicular multiple organic anion transporter. The primers were
degenerate oligonucleotides capable of hybridizing to the NBD2 coding
domains of MRP-type subfamily members but not to the MDR-type
subfamily. Northern blot analysis indicated that probes derived from
one of the PCR fragments hybridized to a 5500-nt transcript present in
lung and intestine of normal Sprague-Dawley rats and liver of mutant
EHBR. The mRNA was also elevated in liver of TR
mutant
rats but exhibited very low levels in normal Sprague-Dawley rat liver
(Fig. 1). A full-length cDNA for the gene
was assembled from lambda phage inserts and an RT-PCR fragment
generated by a proofreading thermostable polymerase. Nucleotide
sequence analysis indicated that the cDNA contained a single long open
reading frame (ORF) capable of encoding a polypeptide 1522 amino acids
in length that bears the hallmarks of an ABC-type protein (Fig.
2). The ORF contains two hydrophobic
polytopic membrane-spanning regions and two nucleotide-binding domains
(NBD1 and NBD2) harboring Walker A and B nucleotide-binding motifs and
the C moiety characteristic of ABC-type proteins.
|
|
|
rMRP3 mRNA levels change upon birth and during obstructive
cholestasis.
Little or no rMRP3 transcript was detected in livers of 18- or
20-day-old rat fetuses. Levels of rMRP3 RNA increased postpartum, peaked at 5-7 days after birth, and then decreased slowly to
levels observed in adults (Fig.
4A). The MRP2 RNA species was
also low in fetuses and increased postpartum. However, the rate of
increase in MRP2 mRNA, when compared with levels present in adults, was markedly slower than was observed for rMRP3.
|
rats and EHBR, suggesting that accumulation in the
hepatocyte of a compound normally secreted into bile may be responsible
for the increase in rMRP3 mRNA levels. An initial test of this
hypothesis is the response of rMRP3 to ligation of the common bile
duct. Northern blot analysis revealed that there was a severalfold
increase in rMRP3 mRNA 24 h after bile duct ligation (Fig.
4B). The high levels were maintained after 72 h, 5 days, or 7 days of bile duct ligation (not shown). This effect appears to be
specific to the liver; no change in rMRP3 was observed in intestine or
lung of bile duct-ligated rats, the two other rat tissues that display significant expression of rMRP3.
rMRP3 is present in the canalicular membrane.
Antibodies were raised against residues 876-948 of rMRP3, which
reside immediately downstream of the first NBD and represent the
variable linker region of rMRP3. This region is 62% identical in rat
and human MRP3 but exhibits little similarity with the MRP1-,
MRP2-, SPGP-, or MDR-encoded
P-glycoproteins. The antisera recognized a polypeptide with a relative
molecular mass of 190-200 kDa in immunoblots of CMV proteins
purified from rat liver. No detectable cross-reactive material was
detected in SMV preparations (Fig.
5A). Antibody staining of the
200-kDa protein was blocked by the GST-MRP3 fusion peptide but not by
GST alone. The c219 monoclonal antibody, which cross-reacts with
MDR-encoded P-glycoproteins, stains a 170-kDa band in CMV
proteins that is not detected in SMV. c219 staining was not affected by
GST-MRP3 or GST. The molecular mass of 169 kDa predicted for rMRP3 from
the deduced amino acid sequence is smaller than the apparent molecular
mass of 200 kDa observed in SDS-PAGE. Treatment of CMV proteins with
peptide N-glycosidase F (PNGaseF), which cleaves glycoprotein
asparagine-linked oligosaccharides (39), decreased the apparent
molecular mass of rMRP3 to a size more in agreement with that deduced
for the cDNA sequence (Fig. 5B). The 190- to 200-kDA signal
was also detected in CMV purified from TR
rats and rats
that had undergone bile duct ligation (Fig. 5C). Rat liver
subcellular fractions greatly enriched in lysosomal, mitochondrial,
endoplasmic reticulum, or cytosolic proteins exhibited no detectable
immunostaining with the MRP3 antibodies (not shown).
|
and bile
duct-ligated rats; less intense staining was detectable in liver
sections derived from sham-operated animals. Sparse lateral staining
was observed with anti-MRP3 antibodies, particularly in tissues derived
from bile duct-ligated animals; however, the strongest signal
originated from the canaliculus. No canalicular staining was observed
in liver sections incubated with preimmune IgG or when anti-MRP3 IgG
was preincubated with the GST-MRP3 fusion protein. Preincubation with
GST alone had no effect on immunostaining, and c219 staining was
unaffected by GST-MRP3 or GST.
|
| |
DISCUSSION |
|---|
|
|
|---|
The rMRP3 gene encodes a protein that exhibits significant amino acid sequence similarity with the glutathione conjugate pumps MRP1 (4) and MRP2 (2, 12, 31) of mammals and YCF1 (37) and Atmrp1 (25) of yeast and plants, respectively. Analysis of the rMRP3 primary sequence outlines a putative membrane topology similar to that determined empirically for MRP1, suggesting that rMRP3 has an extracellular amino terminus, 11 membrane-spanning helices in the amino-terminal region, and 6 transmembrane domains between the two NBDs. rMRP3 contains several consensus N-linked glycosylation sites that match the location of sites empirically identified in MRP1 (8). Treatment of membrane extracts with endoglycosidase reduces the apparent molecular mass of the protein that reacts with anti-MRP3 antibodies, suggesting that rMRP3 undergoes a pattern of decoration with oligosaccharides similar to that of MRP1.
The rMRP3 transcript is present at low levels in normal adult liver but
is elevated in TR
rats and EHBR, suggesting that
accumulation of an MRP2 substrate, or an event secondary to this
increase, regulates rMRP3 expression. Supporting this hypothesis is the
observation that rMRP3 mRNA levels increase rapidly during obstructive
cholestasis. Many changes occur in hepatocytes after bile duct ligation
that may induce the rMRP3 RNA increase. However, bile duct ligation is
accompanied by accumulation in the hepatocyte of MRP2 substrates, a
reduction of MRP2 RNA levels in liver, and almost complete
disappearance of MRP2 from the canalicular membrane (40). The
connection between the developmental patterns of MRP2 and rMRP3
expression in newborn liver is less clear but still consistent with the
hypothesis. rMRP3 RNA accumulates rapidly after birth and then declines
to adult levels by day 15. The MRP2 transcript undergoes a
slow, steady increase in accumulation that has not reached adult levels by day 15. However, the increase in MRP2 function by the
seventh day after birth may be sufficient to clear inducing substrates from the hepatocyte and lead to decreased rMRP3 expression.
Immunofluorescence confocal microscopy and immunoblot analyses of
subcellular liver membrane fractions indicate that rMRP3 is present in
the canalicular membrane, suggesting that it may play a role in bile
formation. However, the function of rMRP3 in liver is unknown.
Eukaryotes harbor multiple homologues of MRP-like proteins. A complete
inventory of S. cerevisiae ABC-type proteins identifies six
different genes (6), Arabidopsis thaliana contains at least
three (34), and mammals express eight or more (MRP1 through
MRP6, SUR1, and SUR2). Some of
the MRP subfamily members exhibit broad substrate specificities and
transport a wide variety of amphiphylic organic anions; MRP1 (22) and
MRP2 (15, 26) transport many glutathione and glucuronide conjugates, as
do the yeast YCF1 (23) and plant Atmrp1 (25) and Atmrp2 (24). However,
the homologues do not behave identically; MRP1 and MRP2 display
different affinities for specific substrates (15), as do the plant
homologues Atmrp1 and Atmrp2 (24). MRP2-deficient TR
rats and EHBR secrete compounds into bile that are related to MRP2
substrates and include unconjugated bilirubin (30), sulfate-conjugated drugs (38), and others (14). rMRP3 may transport one or more of these compounds.
Not all MRP subfamily members transport glutathione and glucuronide conjugates. The yeast MRP-like protein BAT1p mediates ATP-dependent transport of bile salts that include taurocholate, glycocholate, and taurochenodeoxycholate (29). Bile salt secretion is the principal force driving bile flow, and there is evidence suggesting that the canalicular membrane contains a bile salt transporter in addition to the SPGP taurocholate transporter. Isolated CMV display robust ATP-dependent transport of glycocholate; however, insect cells heterologously expressing SPGP exhibit no detectable glycocholate transport (7). Moreover, the polarized WIF-B hepatoma-fibroblast fusion cell line (10) exhibits vectorial transport and accumulation of fluorescently labeled glycocholate in the canalicular vacuoles (1) that form between adjacent cells and that contain canalicular transport ATPases (27). However, WIF-B cells contain no detectable SPGP mRNA but exhibit high levels of rMRP3 mRNA (data to be published elsewhere). rMRP3 is similar in sequence and structure to the yeast bile acid transporter BAT1p and may mediate transport of a subset of bile acids that are poor substrates for SPGP.
| |
NOTE ADDED IN PROOF |
|---|
While this study was in press, Konig et al. (Hepatology 29: 1156-1163, 1999) reported localization of human MRP3 to the basolateral hepatocyte domain. Further studies are required to investigate possible species differences and specificity of the immunologic observation.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Fernado Agarraberes for help and suggestions in staining and visualization of immunoconfocal fluorescence images.
| |
FOOTNOTES |
|---|
This work was supported by the American Liver Foundation Bobby Banks Scholar Award and National Institutes of Health Grants DK-51005 and DK-35652.
Address for reprint requests and other correspondence: D. F. Ortiz, Dept. of Physiology, Tufts School of Medicine, 136 Harrison Ave., Boston, MA 02111 (E-mail: dortiz{at}opal.tufts.edu).
Received 22 December 1998; accepted in final form 15 February 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Bravo, P.,
V. Bender,
and
D. Cassio.
Efficient in vitro vectorial transport of a fluorescent conjugated bile acid analogue by polarized hepatic hybrid WIF-B and WIF-B9 cells.
Hepatology
27:
576-583,
1998[Medline].
2.
Buchler, M.,
J. Konig,
M. Brom,
J. Kartenbeck,
H. Spring,
T. Horie,
and
D. Keppler.
cDNA cloning of the hepatocyte canalicular isoform of the multidrug resistance protein, cMrp, reveals a novel conjugate export pump deficient in hyperbilirubinemic mutant rats.
J. Biol. Chem.
271:
15091-15098,
1996
3.
Childs, S.,
R. L. Yeh,
E. Georges,
and
V. Ling.
Identification of a sister gene to P-glycoprotein.
Cancer Res.
55:
2029-2034,
1995
4.
Cole, S. P. C.,
G. Bhardwaj,
J. H. Gerlach,
J. E. Mackie,
C. E. Grant,
K. C. Almquist,
A. J. Stewart,
E. U. Kurtz,
A. M. V. Duncan,
and
R. G. Deeley.
Overexpression of a transporter gene in a multi-drug-resistant lung cancer cell line.
Science
258:
1650-1654,
1992
5.
De Vree, J. M.,
E. Jacquemin,
E. Sturm,
D. Cresteil,
P. J. Bosma,
J. Aten,
J. F. Deleuze,
M. Desrochers,
M. Burdelski,
O. Bernard,
R. P. Oude Elferink,
and
M. Hadchouel.
Mutations in the MDR3 gene cause progressive familial intrahepatic closestasis.
Proc. Natl. Acad. Sci. USA
95:
282-287,
1998
6.
Decottignies, A.,
and
A. Goffeau.
Complete inventory of the yeast ABC proteins.
Nat. Genet.
15:
137-45,
1997[Medline].
7.
Gerloff, T.,
B. Stieger,
B. Hagenbuch,
J. Madon,
L. Landmann,
J. Roth,
A. F. Hofmann,
and
P. J. Meier.
The sister of P-glycoprotein represents the canalicular bile salt export pump of mammalian liver.
J. Biol. Chem.
273:
10046-10050,
1998
8.
Hipfner, D. R.,
K. C. Almquist,
E. M. Leslie,
J. H. Gerlach,
C. E. Grant,
R. G. Deeley,
and
S. P. Cole.
Membrane topology of the multidrug resistance protein (MRP). A study of glycosylation-site mutants reveals an extracytosolic NH2 terminus.
J. Biol. Chem.
272:
23623-23630,
1997
9.
Hirohashi, T.,
H. Suzuki,
K. Ito,
K. Ogawa,
K. Kume,
T. Shimizu,
and
Y. Sugiyama.
Hepatic expression of multidrug resistance-associated protein-like proteins maintained in Eisai-hyperbilirubinemic rats.
Mol. Pharmacol.
53:
1068-1075,
1998
10.
Ihrke, G.,
E. B. Neufeld,
T. Meads,
M. R. Shanks,
D. Cassio,
M. Laurent,
T. A. Schroer,
R. E. Pagano,
and
A. L. Hubbard.
Wif-B cells: an in vitro model for studies of hepatocyte polarity.
J. Cell Biol.
123:
1761-1775,
1993
11.
Inoue, M.,
R. Kinne,
T. Tran,
L. Biempica,
and
I. M. Arias.
Rat liver canalicular membrane vesicles. Isolation and topological characterization.
J. Biol. Chem.
258:
5183-5188,
1983
12.
Ito, K.,
H. Suzuki,
T. Hirohashi,
K. Kume,
T. Shimizu,
and
Y. Sugiyama.
Expression of the putative ATP-binding cassette region, homologous to that in multidrug resistance associated protein (MRP), is hereditarily defective in Eisai hyperbilirubinemic rats (EHBR).
Int. Hepatol. Commun.
292:
292-299,
1996.
13.
Ito, K.,
H. Suzuki,
T. Hirohashi,
K. Kume,
T. Shimizu,
and
Y. Sugiyama.
Molecular cloning of canalicular multispecific organic anion transporter defective in EHBR.
Am. J. Physiol.
272 (Gastrointest. Liver Physiol. 35):
G16-G22,
1997
14.
Jansen, P. L.,
J. W. van Klinken,
M. van Gelder,
R. Ottenhoff,
and
R. P. Elferink.
Preserved organic anion transport in mutant TR
rats with a hepatobiliary secretion defect.
Am. J. Physiol.
265 (Gastrointest. Liver Physiol. 28):
G445-G452,
1993
15.
Jedlitschky, G.,
I. Leier,
U. Buchholz,
J. Hummel-Eisenbeiss,
B. Burchell,
and
D. Keppler.
ATP-dependent transport of glutathione S-conjugates by the multidrug resistance protein MRP1 and its apical isoform MRP2.
Biochem. J.
327:
305-310,
1997.
16.
Kaminoto, Y.,
Z. Gatmaitan,
J. Hsu,
and
I. M. Arias.
The function of Gp170, the multidrug resistance gene product in rat liver canalicular membranes.
J. Biol. Chem.
264:
11693-11698,
1989
17.
Kartenbeck, J.,
U. Leuschner,
R. Mayer,
and
D. Keppler.
Absence of the canalicular isoform of the MRP gene-encoded conjugate export pump from the hepatocytes in Dubin-Johnson syndrome.
Hepatology
23:
1061-1066,
1996[Medline].
18.
Kast, C.,
and
P. Gros.
Epitope insertion favors a six transmembrane domain model for the carboxy-terminal portion of the multidrug resistance-associated protein.
Biochemistry
37:
2305-2313,
1998[Medline].
19.
Kast, C.,
and
P. Gros.
Topology mapping of the amino-terminal half of multidrug resistance-associated protein by epitope insertion and immunofluorescence.
J. Biol. Chem.
272:
26479-26487,
1997
20.
Kiuchi, Y.,
H. Suzuki,
T. Hirohashi,
C. A. Tyson,
and
Y. Sugiyama.
cDNA cloning and inducible expression of human multidrug resistance associated protein 3 (MRP3).
FEBS Lett.
433:
149-52,
1998[Medline].
21.
Kool, M.,
M. de Haas,
G. L. Scheffer,
R. J. Scheper,
M. J. van Eijk,
J. A. Juijn,
F. Baas,
and
P. Borst.
Analysis of expression of cMOAT (MRP2), MRP3, MRP4, and MRP5, homologues of the multidrug resistance-associated protein gene (MRP1), in human cancer cell lines.
Cancer Res.
57:
3537-3547,
1997
22.
Leir, I.,
G. Jedlitschky,
S. P. Buchholz,
S. P. C. Cole,
R. G. Deeley,
and
D. Keppler.
The MRP gene encodes an ATP-dependent export pump for leukotriene C4 and structurally related conjugates.
J. Biol. Chem.
269:
27807-27810,
1994
23.
Li, Z. S.,
M. Szczypka,
Y. P. Lu,
D. J. Thiele,
and
P. A. Rea.
The yeast cadmium factor protein (YCF1) is a vacuolar glutathione S-conjugate pump.
J. Biol. Chem.
271:
6509-6517,
1996
24.
Lu, Y. P.,
Z. S. Li,
Y. M. Drozdowicz,
S. Hortensteiner,
E. Martinoia,
and
P. A. Rea.
AtMRP2, an Arabidopsis ATP binding cassette transporter able to transport glutathione S-conjugates and chlorophyll catabolites: functional comparisons with Atmrp1.
Plant Cell
10:
267-282,
1998
25.
Lu, Y. P.,
Z. S. Li,
and
P. A. Rea.
AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.
Proc. Natl. Acad. Sci. USA
94:
8243-8248,
1997
26.
Madon, J.,
U. Eckhardt,
T. Gerloff,
B. Stieger,
and
P. J. Meier.
Functional expression of the rat liver canalicular isoform of the multidrug resistance-associated protein.
FEBS Lett.
406:
75-88,
1997[Medline].
27.
Nies, A. T.,
T. Cantz,
M. Brom,
I. Leier,
and
D. Keppler.
Expression of the apical conjugate export pump, Mrp2, in the polarized hepatoma cell line, WIF-B.
Hepatology
28:
1332-40,
1998[Medline].
28.
Nies, A. T.,
Z. Gatmaitan,
and
I. M. Arias.
ATP-dependent phosphatidylcholine translocation in rat liver plasma membrane vesicles.
J. Lipid Res.
37:
1125-1136,
1996[Abstract].
29.
Ortiz, D. F.,
M. V. St Pierre,
A. Abdulmessih,
and
I. M. Arias.
A yeast ABC-type protein mediating ATP-dependent bile acid transport.
J. Biol. Chem.
272:
15358-15365,
1997
30.
Pascolo, L.,
E. J. Bayon,
F. Cupelli,
J. D. Ostrow,
and
C. Tiribelli.
ATP-dependent transport of unconjugated bilirubin by rat liver.
Biochem. J.
331:
99-103,
1998.
31.
Paulusma, C. C.,
P. J. Bosma,
G. J. Zaman,
C. T. Bakker,
M. Otter,
G. L. Scheffer,
R. J. Scheper,
P. Borst,
and
R. P. Oude Elferink.
Congenital jaundice in rats with a mutation in a multidrug resistance-associated protein gene.
Science
271:
1126-1128,
1996[Abstract].
32.
Paulusma, C. C.,
M. Kool,
P. J. Bosma,
G. L. Scheffer,
F. ter Borg,
R. J. Scheper,
G. N. Tytgat,
P. Borst,
F. Baas,
and
R. P. Oude Elferink.
A mutation in the human canalicular multispecific organic anion transporter gene causes the Dubin-Johnson syndrome.
Hepatology
25:
1539-1542,
1997[Medline].
33.
Ruetz, S.,
and
P. Gros.
Phosphatidylcholine translocase: a physiological role for the mdr2 gene.
Cell
77:
1071-1081,
1994[Medline].
34.
Sanchez-Fernandez, R.,
W. Ardiles-Diaz,
M. Van Montagu,
D. Inze,
and
M. J. May.
Cloning and expression analyses of AtMRP4, a novel MRP-like gene from Arabidopsis thaliana.
Mol. Gen. Genet.
258:
655-662,
1998[Medline].
35.
Smit, J. J.,
A. H. Schinkel,
R. P. Oude Elferink,
A. K. Groen,
E. Wagenaar,
L. van Deemter,
C. A. Mol,
R. Ottenhoff,
N. M. van der Lugt,
M. A. van Roon,
M. A. van der Valk,
G. F. A. Offerhaus,
A. J. M. Berns,
and
P. Borst.
Homozygous disruption of the murine mdr2 P-glycoprotein gene leads to a complete absence of phospholipid from bile and to liver disease.
Cell
75:
451-462,
1993[Medline].
36.
Strautnieks, S. S.,
L. N. Bull,
A. S. Knisely,
S. A. Kocoshis,
N. Dahl,
H. Arnell,
E. Sokal,
K. Dahan,
S. Childs,
V. Ling,
M. S. Tanner,
A. F. Kagalwalla,
A. Nemeth,
J. Pawlowska,
A. Baker,
G. Mieli-Vergani,
N. B. Freimer,
R. M. Gardiner,
and
R. J. Thompson.
A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis.
Nat. Genet.
20:
233-238,
1998[Medline].
37.
Szczypka, M. S.,
J. A. Wemmi,
S. M. Moye-Rowley,
and
D. J. Thiele.
A yeast metal resistance protein similar to human cystic fibrosis transmembrane conductance regulator (CFTR) and multi-drug-resistance-associated protein.
J. Biol. Chem.
36:
22853-22857,
1994.
38.
Takenaka, O.,
T. Horie,
K. Kobayashi,
H. Suzuki,
and
Y. Sugiyama.
Kinetic analysis of hepatobiliary transport for conjugated metabolites.
Pharm. Res.
12:
1746-1755,
1995[Medline].
39.
Tarentino, A. L.,
C. M. Gomez,
and
T. H. Plummer, Jr.
Deglycosylation of asparagine-linked glycans by peptide:N-glycosidase F.
Biochemistry
24:
4665-4671,
1985[Medline].
40.
Trauner, M.,
M. Arrese,
C. J. Soroka,
M. Ananthanarayanan,
T. A. Koeppel,
S. F. Schlosser,
F. J. Suchy,
D. Keppler,
and
J. L. Boyer.
The rat canalicular conjugate export pump (Mrp2) is down-regulated in intrahepatic and obstructive cholestasis.
Gastroenterology
113:
255-264,
1997[Medline].
41.
Van Helvoort, A.,
A. J. Smith,
H. Sprong,
I. Fritzsche,
A. H. Schinkel,
P. Borst,
and
G. van Meer.
MDR1 P-glycoprotein is a lipid translocase of broad specificity, while MDR3 P-glycopro tein specifically translocates phosphatidylcholine.
Cell
87:
507-517,
1996[Medline].
42.
Wada, M.,
S. Toh,
K. Taniguchi,
T. Nakamura,
T. Uchiumi,
K. Kohno,
I. Yoshida,
A. Kimura,
S. Sakisaka,
Y. Adachi,
and
M. Kuwano.
Mutations in the canilicular multispecific organic anion transporter (cMOAT) gene, a novel ABC transporter, in patients with hyperbilirubinemia II/Dubin-Johnson syndrome.
Hum. Mol. Genet.
7:
203-207,
1998
43.
Wang, D. Q.,
B. Paigen,
and
M. C. Carey.
Phenotypic characterization of Lith genes that determine susceptibility to cholesterol cholelithiasis in inbred mice: physical-chemistry of gallbladder bile.
J. Lipid Res.
38:
1395-1411,
1997[Abstract].
This article has been cited by other articles:
![]() |
S. Perwaiz, D. Forrest, D. Mignault, B. Tuchweber, M. J. Phillip, R. Wang, V. Ling, and I. M. Yousef Appearance of atypical 3{alpha},6{beta},7{beta},12{alpha}-tetrahydroxy-5{beta}-cholan-24-oic acid in spgp knockout mice J. Lipid Res., March 1, 2003; 44(3): 494 - 502. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. J. Cherrington, D. P. Hartley, N. Li, D. R. Johnson, and C. D. Klaassen Organ Distribution of Multidrug Resistance Proteins 1, 2, and 3 (Mrp1, 2, and 3) mRNA and Hepatic Induction of Mrp3 by Constitutive Androstane Receptor Activators in Rats J. Pharmacol. Exp. Ther., January 1, 2002; 300(1): 97 - 104. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Inokuchi, E. Hinoshita, Y. Iwamoto, K. Kohno, M. Kuwano, and T. Uchiumi Enhanced Expression of the Human Multidrug Resistance Protein 3 by Bile Salt in Human Enterocytes. A TRANSCRIPTIONAL CONTROL OF A PLAUSIBLE BILE ACID TRANSPORTER J. Biol. Chem., December 7, 2001; 276(50): 46822 - 46829. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. G. Dietrich, D.R. de Waart, R. Ottenhoff, A. H. Bootsma, A. H. van Gennip, and R. P.J.O. Elferink Mrp2-deficiency in the rat impairs biliary and intestinal excretion and influences metabolism and disposition of the food-derived carcinogen 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) Carcinogenesis, May 1, 2001; 22(5): 805 - 811. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zeng, G. Liu, P. A. Rea, and G. D. Kruh Transport of Amphipathic Anions by Human Multidrug Resistance Protein 3 Cancer Res., September 1, 2000; 60(17): 4779 - 4784. [Abstract] [Full Text] |
||||
![]() |
P. Borst, R. Evers, M. Kool, and J. Wijnholds A Family of Drug Transporters: the Multidrug Resistance-Associated Proteins J Natl Cancer Inst, August 16, 2000; 92(16): 1295 - 1302. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Madon, B. Hagenbuch, L. Landmann, P. J. Meier, and B. Stieger Transport Function and Hepatocellular Localization of mrp6 in Rat Liver Mol. Pharmacol., March 1, 2000; 57(3): 634 - 641. [Abstract] [Full Text] |
||||
![]() |
E. M. Leslie, K.-i. Ito, P. Upadhyaya, S. S. Hecht, R. G. Deeley, and S. P. C. Cole Transport of the beta -O-Glucuronide Conjugate of the Tobacco-specific Carcinogen 4-(Methylnitrosamino)-1-(3-pyridyl)-1-butanol (NNAL) by the Multidrug Resistance Protein 1 (MRP1). REQUIREMENT FOR GLUTATHIONE OR A NON-SULFUR-CONTAINING ANALOG J. Biol. Chem., July 20, 2001; 276(30): 27846 - 27854. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-S. Chen, K. Lee, and G. D. Kruh Transport of Cyclic Nucleotides and Estradiol 17-beta -D-Glucuronide by Multidrug Resistance Protein 4. RESISTANCE TO 6-MERCAPTOPURINE AND 6-THIOGUANINE J. Biol. Chem., August 31, 2001; 276(36): 33747 - 33754. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Wang, M. Salem, I. M. Yousef, B. Tuchweber, P. Lam, S. J. Childs, C. D. Helgason, C. Ackerley, M. J. Phillips, and V. Ling Targeted inactivation of sister of P-glycoprotein gene (spgp) in mice results in nonprogressive but persistent intrahepatic cholestasis PNAS, February 13, 2001; 98(4): 2011 - 2016. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |