AJP - GI Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 277: G383-G390, 1999;
0193-1857/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Malakooti, J.
Right arrow Articles by Ramaswamy, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Malakooti, J.
Right arrow Articles by Ramaswamy, K.
Vol. 277, Issue 2, G383-G390, August 1999

Molecular cloning, tissue distribution, and functional expression of the human Na+/H+ exchanger NHE2

Jaleh Malakooti, Refka Y. Dahdal, Larry Schmidt, Thomas J. Layden, Pradeep K. Dudeja, and Krishnamurthy Ramaswamy

Section of Digestive and Liver Diseases, Department of Medicine, The University of Illinois at Chicago, and Westside Veterans Affairs Medical Center, Chicago, Illinois 60612


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In the present report, we describe the cloning of a human colonic cDNA that describes the full-length Na+/H+ exchanger (NHE) 2 coding region. The human NHE2 (hNHE2) cDNA encodes for a polypeptide of 812 amino acids with a 90% overall identity to both rabbit and rat NHE2 isoforms. In comparison with SLC9A2, recently reported as the human NHE2, the hNHE2 polypeptide is 115 amino acids longer in the NH2-terminal end and shows only an 84% DNA nucleotide sequence identity. Northern blot analysis revealed that hNHE2 message has an uneven tissue distribution, with high levels in the skeletal muscle, colon, and kidney and lower levels in the testis, prostate, ovary, and small intestine. Protein expression studies with hNHE2 clone showed that a 75-kDa protein was expressed. Stable expression of transfected full-length hNHE2 cDNA in Na+/H+ exchange-deficient LAP1 cells exhibited Na+-dependent pH recovery after an acid prepulse that was inhibited by 0.1 mM amiloride. These data indicate that this cDNA is the true human NHE2 cDNA and that the encoded protein is capable of catalyzing Na+/H+ exchange activity.

human colon; sodium transport


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

THE SODIUM/HYDROGEN EXCHANGERS (NHE) are highly conserved in all eukaryotes and participate in various cellular functions, such as maintenance of intracellular pH (pHi) and cell volume and vectorial Na+ transport. At physiological conditions, these antiporters mediate the electroneutral exchange of extracellular Na+ with intracellular H+ with a stoichiometry of 1:1 (17, 27). Recent molecular cloning studies have demonstrated the existence of a Na+/H+ exchange gene family, of which at least six members, designated NHE1 to NHE6, have been cloned from different animal species (1, 2, 12, 18, 25, 26, 29). The NHE1 isoform is ubiquitously expressed in all tissue types (17, 19, 27). Unlike NHE1, NHE2, NHE3, and NHE4 isoforms exhibit tissue-specific expression (2, 19, 29). In polarized epithelial cells, NHE1 is localized to the basolateral membrane (30) and is involved in the housekeeping functions, whereas NHE2 and NHE3 are localized to the apical membrane and are suggested to be involved in vectorial sodium transport (26, 29). Recent functional and immunochemical studies have suggested basolateral membrane localization of the NHE4 isoform in the thick ascending limb and distal convoluted tubules of the rat renal cortex (3). Functional analysis in heterologous systems has confirmed the ability of NHE1, NHE2, and NHE3 cDNA clones to complement the Na+/H+ exchange deficiency of the mutant cells that lack endogenous NHE activity (10, 19, 31, 33). In comparison to the other NHE isoforms, NHE4 exhibits distinct functional and pharmacological properties. For example, in a Na+/H+ exchange-deficient heterologous system, this isoform can only be activated in the presence of a coupling agent such as DIDS, and it is extremely resistant to amiloride (4).

Structurally, all NHE isoforms share the same topology and are known to have two distinct domains. Roughly the first 500 amino acids comprise the NH2-terminal domain, which is highly hydrophobic with 10-12 potential membrane-spanning segments. The last 300 amino acids are highly hydrophilic and compose the COOH-terminal domain, suggested to be the cytoplasmic region of the protein (19, 25).

To date, the complete primary structure of the human NHE1 and NHE3 isoforms have been determined and their biochemical properties have been characterized (2, 25). Cloning of a human NHE2 (hNHE2) isoform from human liver, designated SLC9A2, has also been described (11). However, SLC9A2 shows significant sequence differences from the full-length rat and rabbit NHE2 and exhibits a 99% amino acid identity to a truncated version of the rat NHE2 isoform (5).

Our earlier transport studies utilizing human intestinal basolateral and brush-border membrane vesicles have indicated kinetic and other mechanistic differences for the transport of Na+ from what has been reported in the rat and rabbit intestine, prompting us to investigate the characteristics of the hNHE isoforms at the molecular level (6, 7, 13, 20, 21, 34). Our recent studies using RNase protection and in situ hybridization demonstrated that the expression of NHE2 and NHE3 mRNA in the human gastrointestinal tract was different from the results obtained in the rat and rabbit tissues (8). In the present study, we demonstrate cloning of the full-length hNHE2 cDNA and its functional expression. We present data showing that our clone is the hNHE2 cDNA and is different from SLC9A2. The hNHE2 cDNA codes for a 75-kDa protein that is capable of catalyzing Na+/H+ exchange activity in LAP1 cells lacking endogenous NHE activity. Northern blot analysis of hNHE2 mRNA expression in various human tissues revealed that NHE2 mRNA was predominantly expressed in skeletal muscle, colon, and kidney and was present at lower levels in the testis, prostate, ovary, and small intestine.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials. Buffer reagents were purchased from Sigma Chemical (St. Louis, MO). Restriction endonucleases and other modifying enzymes were from either New England Biolabs (Beverly, MA), GIBCO BRL (Gaithersburg, MD), or Promega (Madison, WI). TA cloning kit, JM109 competent cell, and transcription/translation-coupled (TNT) wheat germ extract system were from Promega.

Molecular techniques. DNA manipulations, including restriction enzyme digestions, ligations, plasmid isolation, and Escherichia coli transformation, were carried out by standard methods (22).

RNA extraction and PCR analysis. Total RNA was extracted by the RNAzol method (Tel-Test, Friendswood, TX) according to the manufacturer's directions. Poly(A)+ mRNA was prepared by two successive passages through oligo(dT) cellulose column using the QuickPrep mRNA purification kit (Pharmacia Biotech, Piscataway, NJ). PCR was performed in a Perkin-Elmer Cetus DNA cycler, with thermostable DNA polymerases Taq (Perkin-Elmer, Foster City, CA), Klen-Taq (Clontech, Palo Alto, CA), or rTth (Boehringer Mannheim, Indianapolis, IN) according to the manufacturers' directions.

cDNA cloning. A Marathon-ready cDNA library of T84, a colonic adenocarcinoma cell line, was constructed with poly(A)+ mRNA and an oligo(dT) primer with the use of a kit from Clontech. The hNHE2-specific primers were designed based on the nucleotide sequence of our previously cloned 595-bp partial hNHE2 cDNA (8). The sequences of the primers used for 5' rapid amplification of cDNA ends (RACE) and 3' RACE were 5'-TGTGTTCTCGATTCAAGC-3' and 5'-TACTGTCCCTACATTTGCATC-3', respectively. These oligonucleotides and Marathon anchor primers were used to amplify cDNA fragments from the T84 Marathon-ready library by RACE. PCR products were gel purified and cloned in pGEM-T, a TA cloning vector, and then were used to transform E. coli JM109. Sequence analysis of the 3' RACE clones extended the 595-bp sequence to a poly(A)+ tail, which was located 179-bp downstream from an in-frame translation termination codon. In the 5' direction, the sequence was extended about 1.2 kb in several independent clones. However, no translation initiation codon was present at the NH2-terminal end of the open reading frame (ORF), and the 5' termini of some clones diverged from sequences corresponding to hNHE2 ORF, suggesting that the cloned cDNA was missing the 5' end. Attempt to extend the cDNA sequence further in the 5' direction from our T84 Marathon-ready library was unsuccessful. Therefore, a human colonic lambda gt11 cDNA library (Clontech) was screened by PCR to obtain the missing 5' segment of the cDNA. This was accomplished by employing a sense primer from lambda gt11 cloning site and an antisense primer that was designed based on one of the 5' RACE clones obtained from the T84 library. Subsequent to sequencing the new clones, PCR primers were synthesized based on the extreme 5' and 3' ends of newly identified overlapping sequences and were used to amplify hNHE2 cDNA from a human normal colonic cDNA library, which was then cloned in pGEM-T PCR cloning vector.

DNA sequence analysis. The hNHE2 cDNA was sequenced from double-stranded templates by the dideoxynucleotide chain termination method (23) with the use of the 35S-labeled dATP and Sequenase II kit (US Biochemical, Cleveland, OH). The entire hNHE2 cDNA sequence was determined on both DNA strands.

Northern blot analysis. Commercially available human multiple-tissue Northern blots, [hMTN and hMTN II (Clontech)], each containing poly(A)+ RNA (2 µg/lane) from different human tissues, were used for Northern blot analysis. A 350-bp Hind III fragment from the 3' end of the coding region of hNHE2 was radiolabeled with [alpha -32P]dCTP (3,000 Ci/mmol; ICN, Costa Mesa, CA) by random priming to a specific activity of 109 cpm/µg. Prehybridization and hybridization were performed at 68°C in ExpressHyb solution (Clontech) according to the manufacturer's instructions, with a final probe concentration of 106 cpm/ml. The blots were washed for 40 min at room temperature in 2× standard saline citrate (SSC)-0.05% SDS and for 20 min at 50°C in 0.1× SSC-0.1% SDS and were visualized by X-ray autoradiography.

Construction of hNHE2 expression vectors. The plasmids used in these studies were all constructed in mammalian expression vector pRC-CMV (Invitrogen, Carlsbad, CA). To facilitate subcloning of hNHE2 cDNA, a Hind III restriction endonuclease site was introduced to sequences upstream from the ATG translation initiation codon by PCR. The PCR products were then digested with restriction enzymes Hind III and BamH I, gel purified, and cloned, along with the BamH I and Not I (Not I restriction endonuclease site was from the polylinker of pGEM-T cloning vector) fragments of hNHE2 cDNA in Hind III-Not I sites of pRC-CMV, resulting in plasmid phNHE2. To construct a 5'-tagged hNHE2 expression vector, Flag epitope (Eastman Kodak) tag was added in frame between the first and second amino acids by PCR using a sense oligonucleotide: 5'-GTC<UNL>AAGCTT</UNL>CTCGAGCATGGA CTACAAGGACGACGATGACAAGGAACCACTGGGCAAC TGGAGG-3' that contained a Hind III restriction endonuclease site upstream from the ATG start codon (underlined), followed by 24 nucleotides coding for Flag peptide (shown in italic), which preceded the hNHE2 sequences (shown in bold) and antisense primer 5'-GATGGGTGGGAGGAGGTACAAG-3'. The PCR products were then digested with restriction enzymes Hind III and BamH I, gel purified, and cloned, along with the BamH I and Not I fragments of hNHE2 cDNA in Hind III-Not I sites of pRC-CMV. The resulting plasmid was named pFhNHE2. Plasmid pEAP harboring hNHE1 cDNA (kindly provided by J. Pouyssegur) was used to construct a Flag-tagged NHE1 expression vector (pFhNHE1), as described for pFhNHE2 construction. All PCR products and ligation points of the new constructions were sequenced to confirm the fidelity of the cDNA inserts.

In vitro synthesis of human NHE2 protein. Proteins encoded by clones pFhNHE2, phNHE2, pFhNHE1, and pRC-CMV were synthesized in vitro using a T7-dependent TNT-wheat germ extract system (Promega). Briefly, 1 µg of plasmid DNA was combined with 25 µl of wheat germ extract, 20 µM of amino acid mixture minus methionine, 40 units of RNase inhibitor, 10 units of T7 RNA polymerase, and 40 µCi of [35S]methionine (Amersham, Arlington Heights, IL) in a final volume of 50 µl. After a 1-h incubation at 30°C, a 2.5-µl aliquot from each sample was removed, mixed with 10 µl of sample buffer, boiled at 100°C for 3 min, and analyzed on a 10% SDS-polyacrylamide gel by PAGE. Gel was fixed in a solution of 20% methanol-10% acetic acid, dried, and exposed to X-ray film. A plasmid containing the luciferase gene was used as positive control (pLuc), and a reaction without the DNA template was performed to test the background incorporation of [35S]methionine.

Cell culture and transfection. The LAP1 mouse fibroblast cell line, which lacks endogenous Na+/H+ exchange activity (10), was used for transfection studies, and cells were grown in DMEM supplemented with 10% FCS, penicillin (100 U/ml), and streptomycin sulfate (100 µg/ml). Transient transfections were performed in six-well plates seeded by 1 × 106 cells per plate with the use of LipofectAMINE (GIBCO BRL), with 1.5 µg of total plasmid DNA. After 48 h, transfectants were tested for survival in response to acid load as described (9) and stable transfectants were selected in media containing G418 (400 active U/ml) in a period of 1-2 wk and maintained in media containing G418.

Measurement of Na+/H+ exchange activity. The Na+/H+ exchange activity was determined using 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein (BCECF) fluorescence to measure pH alterations in response to extracellular Na+ after an ammonium chloride prepulse. Cells grown on slides were quickly washed three times with Na+ medium containing (in mM) 120 NaCl, 1.7 CaCl2, 5 KCl, 1.0 MgCl2, 1.0 NaH2PO4, 36 mannitol, 5 dextrose, 10 HEPES, and Tris, pH 7.4. The cells were then loaded with BCECF in the dark at 23°C for 15 min as described previously (16). Cells were washed two times in Na+ medium and placed in a 2-ml cuvette at a 45° angle to the excitation beam in a PTI-Alpha scan spectrofluorometer (Princeton, NJ). Excitation wavelengths were 500 and 440 nm, and the emission wavelength was 530 nm. To measure basal exchanger activity, the medium was changed to a Na+-free medium in which Na+ was replaced with choline and then to a Na+ medium in the presence of 0.1 mM amiloride for 3 min. After these initial measurements, cells were acidified by perfusing with 20 mM NH4Cl prepulse followed by incubation in Na+-free buffer. This was followed by perfusion in a Na+-containing medium with 0.1 mM amiloride to determine sensitivity to amiloride. The perfusion medium was then changed to a medium containing Na+ to determine the Na+-dependent pH recovery as indicated by increased BCECF fluorescence. A pHi curve of BCECF fluorescence activity ratios was then established at the end of each experiment using the nigericin technique as described previously (16).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cloning of the human NHE2 cDNA. We have previously described the cloning of a 595-bp partial NHE2 cDNA from a human stomach cDNA library (8). This clone showed a high degree of amino acid homology to rabbit and rat NHE2 isoforms. To isolate the entire hNHE2 cDNA, a 5' and 3' RACE protocol was employed (Fig. 1). As a template, a cDNA library from human colonic adenocarcinoma cell line T84 was utilized (see EXPERIMENTAL PROCEDURES). Primers were designed based on our previously cloned 595-bp fragment, which extended the cDNA sequence at the 3' end to a poly(A)+ tail. In the 5' direction, the cDNA sequence was extended about 1.2 kb in several independent clones; however, DNA sequence analysis revealed that at the 5' end all of the 1.2-kb fragments had either minimal advances toward the translation initiation site or had recombined with unrelated DNA sequences. Therefore, we used DNA from a normal human colonic cDNA lambda gt11 library to obtain the 5' region. This was accomplished by PCR with the use of an antisense primer to one of the 5' RACE-generated clones and a sense primer from the lambda gt11 cloning site. A fragment that had overlapping DNA sequences at the 3' end with hNHE2 sequence and contained an in-frame translation initiation codon was obtained. Together, these clones generated a composite cDNA of 2691 nucleotides. Next, a set of primers derived from the 5' and 3' ends of the composite sequence were used to amplify and clone the entire hNHE2 cDNA from a normal human colonic cDNA library.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1.   Cloning strategy. T84 Marathon cDNA library was generated with use of a kit from Clontech. Overlapping PCR fragments were amplified by 5' and 3' rapid amplification of cDNA ends (RACE). Hatched boxes indicate anchor sequences added to ends of double stranded cDNA, which was generated by RT-PCR of T84 mRNA. Gene-specific primers are shown by arrows and consist of the following nucleotide sequences: GI-40 (5'-TACTGTCCCTACATTTGCATC-3'), GI-70 (5'-GTGTTCTCGATTCAAGCTG-3'), GI-167 (5'-ATGGGTGGGAGGAGGTACAAG3-'), GI-260 (GTCCCCTTGGCGGCAACCG GCGGC), and GI-125 (5'-ATGGATTCCACT GTTGCATCAGG-3'). Anchor primers (Clontech) are shown by half arrows. Arrowhead indicates a primer annealing to lambda gt11 vector (open box) sequence of the cDNA library used as a template for PCR. Representatives of PCR-generated cDNA fragments are shown by black lines. NHE2, Na+/H+ exchanger 2. ORF, open reading frame.

DNA nucleotide sequence of hNHE2 cDNA and deduced amino acid sequence. The complete DNA nucleotide sequence of hNHE2 cDNA and its deduced amino acid sequence are shown in Fig. 2. The cDNA contains 90 bp of 5' untranslated sequence, 2436 bp of ORF, 162 bp of 3' untranslated sequence, and a 20-nucleotide poly(A)+ tract. The extent of the transcription unit in the 5' direction is uncertain. The ORF is capable of encoding a polypeptide of 812 amino acid residues with a calculated molecular weight of 91,413. The putative ATG translation initiation site at bp 91 (Fig. 2) is in fair agreement with Kozak's (14) consensus sequence, A/G CC<UNL>ATG</UNL>G, with a G at position +4 and a C at position -3. There are two other in-frame ATG triplets at bp 149 and 217. Although nucleotide sequences surrounding the ATG codon at bp 149 do not match Kozak's consensus sequence, those of bp 217 are in complete agreement. However, these codons are less likely to be used as translation initiation sites because the first ATG at bp 91 aligns well with both rabbit and rat NHE2 translation start codons, and the amino acid residues downstream from this initiator triplet conform with the structural features of other NHE family members. In the 3' untranslated region, a potential polyadenylation signal GATAAA was found 16 nucleotides upstream from the poly(A)+ tract. Two independent clones, one from the T84 library and the other from a human colonic cDNA library, both terminated at this poly(A)+ site.


View larger version (99K):
[in this window]
[in a new window]
 
Fig. 2.   Nucleotide and deduced amino acid sequences of the human NHE2 (hNHE2) isoform. Nucleotide and amino acid residues are numbered on right and left, respectively. Stop codon is indicated by ***. Sequence of cDNA has been submitted to GenBank under accession number AF 073299.

Amino acid sequence alignment. A comparison of the amino acid sequences of hNHE2 with those of rabbit, rat, and SLC9A2 is shown in Fig. 3. In pairwise comparisons, hNHE2 showed a 92% identity to rabbit and a 90% identity to rat amino acid sequences. However, the amino acid sequence of hNHE2 differed in the NH2-terminal end from the SLC9A2 sequence by an extension of 115 amino acid residues. When this region was excluded, the two polypeptides exhibited an 89% amino acid identity and the corresponding DNA region showed only an 84% DNA nucleotide homology (data not shown).


View larger version (109K):
[in this window]
[in a new window]
 
Fig. 3.   Amino acid comparisons among hNHE2 (HuNHE2.PEP), rabbit NHE2 (RbNHE2.PEP), rat NHE2 (RtNHE2.PEP), and SLC9A2. Amino acid residues conserved among all polypeptides are overlined. Putative transmembrane domains are underlined with asterisks. Deletions are indicated by dashes. Amino acid residues are numbered on right.

The alignment of NHE2 hydropathy plots from different species, as predicted by the algorithm of Kyte and Doolittle (15), revealed that human, rabbit, and rat NHE2 had virtually identical hydropathy profiles, all predicting 12 potential transmembrane domains, whereas the first two hydrophobic domains are missing in SLC9A2 (results not shown).

In an attempt to verify hNHE2 and SLC9A2, a cDNA pool from human normal liver (Clontech) was screened by PCR with the use of specific primers to hNHE2 and SLC9A2 (11). Although the DNA region corresponding to hNHE2 was readily amplified and subsequently cloned, SLC9A2-specific primers (5'-GCAGGGGCACACATCGGGGC-3' and 5'-TGTGAAACGGGTGGTGAACGC-3') failed to generate any PCR products (data not shown). DNA nucleotide sequence analysis of the PCR-generated human liver cDNA clones were a complete match with our colonic hNHE2 cDNA sequence. Therefore, on the basis of these data, we conclude that our cloned hNHE2 cDNA represents the true homologue of the NHE2 isoform.

Tissue distribution of human NHE2. To determine tissue distribution and relative expression of hNHE2 mRNA, commercially available human multiple-tissue Northern blots (hMTN and hMTN, Clontech) were probed with hNHE2 cDNA. To minimize crosshybridization with other isoforms, the cDNA probe was chosen from the least-conserved 3' end region. Examination of mRNA distribution revealed a unique pattern of gene expression, with multiple forms present in different tissues (Fig. 4). The major mRNA detected was 5.2 kb, but additional bands at 3.0 kb and 6.5 kb were also present in some tissues. The mRNA abundance varied considerably among different tissues. The expression was the highest in skeletal muscle, followed by colon and kidney, and was present at considerably lower levels in the testis, prostate, ovary, and small intestine (Fig. 4). The message was not detected in the heart, liver, thymus, leukocytes, or brain by this method. Two additional hMTN and hMTNII blots were screened with a different probe from the 3' end of the hNHE2 cDNA, and signals identical to the previous data were observed in all blots (data not shown).


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 4.   Northern blot analysis. Northern blots of poly(A)+ RNA from different human tissues were probed with a 350-bp Hind III cDNA fragment from 3' end of hNHE2 cDNA. RNA size markers (in kb) are indicated in middle.

Characterization of hNHE2 protein. To confirm that hNHE2 cDNA can indeed be translated to a protein of expected size, the full-length hNHE2 cDNA was cloned into a mammalian expression vector entirely (phNHE2) or with an additional Flag epitope sequence added at the 5' end (pFhNHE2). Proteins encoded by these clones and control plasmids pFhNHE1, pLuc, and empty vector pRC-CMV were synthesized in vitro using a T7-dependent TNT-wheat germ extract system. A protein of about 75 kDa was observed in reaction products of pFhNHE2 and phNHE2 (Fig. 5, lanes 1 and 3). The deduced amino acid sequence of the hNHE2 polypeptide predicts the presence of three potential N-glycosylation sites (Malakooti and Ramaswamy, unpublished data). However, Tse et al. (28) have shown that the rabbit NHE2 protein, despite containing three N-glycosylation consensus sequences, is only O-linked glycosylated, and on an SDS-PAGE migrates as an 85-kDa protein, whereas the unglycosylated form is 75 kDa. This suggests that the 75-kDa protein observed here might also be the unmodified form of the hNHE2 polypeptide.


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 5.   In vitro protein synthesis. hNHE2 and NHE1 proteins were synthesized in vitro in a coupled transcription-translation wheat germ extract using clones pFhNHE2 (lane 1), pFhNHE1 (lane 2), and phNHE2 (lane 3) as templates. For controls, products of translation reactions containing pRC-CMV (empty vector, lane 4) and a positive control for translation efficiency, pLuc (lane 5), are also shown.

The human NHE1 has both N- and O-linked glycosylations. Sardet et al. (24) have shown that the glycosylated NHE1 polypeptides migrate on SDS gels as 95- and 110-kDa proteins, whereas when expressed in Sf9 insect cells, an 85-kDa protein accounting for the unglycosylated form is detected. In our TNT expression system, pFhNHE1 also produced a protein of about 85 kDa (Fig. 5, lane 2). These results suggest that all of the plasmids constructed in this study are capable of expressing polypeptides of the expected sizes for hNHE2 and hNHE1 isoforms.

Functional characterization of hNHE2 cDNA. To demonstrate that hNHE2 cDNA encoded a functional Na+/H+ exchanger, the phNHE2, pFhNHE1, and pRC-CMV constructs were transfected into LAP1, a Na+/H+ exchange-deficient mouse fibroblast cell line, as described in EXPERIMENTAL PROCEDURES. The Na+/H+ exchange activity was measured in phNHE2-LAP1 stable cells as Na+-dependent recovery of pHi from an acid load with the use of the pH-sensitive dye BCECF (Fig. 6B). The addition of Na+ medium to stably transfected cells allowed the cells to recover from an acid prepulse. In contrast, cells transfected with a mock expression vector (Fig. 6A) or untransfected LAP1 cells (data not shown) showed no Na+-dependent acid recovery. Exposure to 100 µM amiloride inhibited the Na+-dependent acid recovery. These results suggest that hNHE2 is an amiloride-sensitive and functional Na+/H+ exchanger.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 6.   NHE functional assay. Representative tracing of intracellular pH (pHi) recovery from acid loads in response to external Na+ in stable LAP/pRC-CMV empty vector (A) and LAP1/pFhNHE2 (B) transfectants is shown. Cells were grown on a coverslip, were loaded with 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein, and then were perfused with 120 mM Na+ medium containing HCO-3-free solution for 10 min at 15 ml/min, during which pHi remained constant. Removal of Na+ from perfusate resulted in a drop in pHi of cells. Addition of 0.1 mM amiloride (Amil) in presence of 120 mM Na+ medium inhibited pHi recovery. Removal of amiloride from Na+ medium allowed the pHi to return to its initial level. After a 5-min exposure to NH4Cl, there was a rapid drop in pHi in absence of Na+, which was maintained in presence of Na+ medium containing amiloride. Removal of amiloride while Na+ remained in perfusate resulted in a rapid increase in pHi.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Increasing evidence indicates that the apical NHE3 isoform is involved in Na+ absorption in the mammalian intestine and kidney (1-3). To date, however, the physiological role of NHE2, the second apical isoform, is not well understood. Our current studies have focused on cloning the NHE2 isoform so as to fully characterize its function and regulation in the human intestine.

In this study, we have identified and characterized the cDNA for the human Na+/H+ exchanger NHE2 isoform. The hNHE2 cDNA encodes a polypeptide of 812 amino acid residues that exhibits an overall 90% amino acid identity to the rat and rabbit NHE2 isoforms. As it is noted for other Na+/H+ exchanger family members, the level of identities is greater in the NH2-terminal region between transmembrane domains 2-12, with the transmembrane domain 1 exhibiting the least degree of homology. The COOH terminus, although highly divergent among different isoforms, exhibits high levels of identities (80%) among the NHE2 homologues of different species. This may indicate a similar mode of gene regulation among these species. Our studies comparing our cloned hNHE2 to the SLC9A2 isoform (11) clearly show that the cDNA reported here is the true human NHE2 homologue. Also, it should be emphasized that the SLC9A2 cDNA is almost 100% homologous to the rat NHE2 variant reported earlier (5).

Our earlier studies (8) with RNase protection and in situ hybridization demonstrated that the NHE2 and NHE3 mRNA levels in various intestinal tissues were different. For example, the message for NHE2 was expressed more in the distal colon compared with the ileum, whereas that of NHE3 was expressed more in the ileum. The Northern blot hybridization studies reported here also show higher expression of NHE2 in the colon compared with the small intestine, in which it is barely detectable. The mRNA overexpression seen in the skeletal muscle was unexpected. The abundance of the NHE2 mRNA in skeletal muscle tissues may suggest that the expression of this isoform is particularly important in muscle and may play a role other than transepithelial Na+ absorption in this tissue. Taking into consideration that hNHE3 is not expressed in the skeletal muscle (2), hNHE2 overexpression is interesting, and future studies are necessary to fully understand its function in the muscle. The origin of multiple transcripts observed in Northern blots of mRNA from different tissues may be speculated to be the result of 1) transcription termination at less-effective polyadenylation signals, 2) incomplete RNA processing, 3) alternative splicing, and 4) use of alternative promoters and/or transcription initiation sites. In our Northern blot assays a message corresponding to the size of our hNHE2 cDNA clone (2.7 kb) was not detected. This may be because of the current lack of information on the transcription initiation site or a less-effective polyadenylation signal, GATAAA (Fig. 1), which is a 1-bp variant of the canonical polyadenylation signal sequence A98A91T100A99A99A98 (32). It is possible that rare species of mRNA may not be detectable under the conditions used for our Northern blot analysis. In fact, although hNHE2 was detected in the human liver RNA by RT-PCR, it was not observed by Northern blot analysis. This may also be the case for the lack of hNHE2 mRNA detection in small intestine, which was clearly detected earlier by RNase protection assay (8). The results of our Northern blot analysis, therefore, indicate that the hNHE2 mRNA is restricted in its tissue distribution predominantly to epithelial tissues, with the exception of the skeletal muscle, suggesting additional roles of NHE2 in specialized functions in these tissues.

Our functional expression studies show that the hNHE2 cDNA codes for a protein that shows characteristics of a Na+/H+ exchanger. The NHE-deficient LAP1 cells, when transfected with hNHE2 cDNA, were capable of pH recovery from an acid load effected by ammonium chloride pulse. The pH recovery from an acid load was inhibited by amiloride at a concentration of 0.1 mM. Further studies with different amiloride analogs have to be carried out to fully characterize the human NHE2 and to compare the Ki values obtained for amiloride analogs with the other mammalian isoforms.

In summary, our studies demonstrate the successful cloning of the hNHE2 cDNA and its functional expression in NHE-deficient cells. The tissue distribution studies confirm our earlier studies of its expression in the colon, possibly indicating its major importance in colonic Na+ absorption. Future studies of its regulation by various stimuli, such as growth factors and hormones, in NHE2-transfected cells will be necessary to gain insights into the physiological role of this hNHE2 isoform.


    ACKNOWLEDGEMENTS

These studies were supported by National Institute of Diabetes and Digestive and Kidney Diseases grants DK-33349 and DK-54016 and by the Department of Veterans Affairs.


    FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: J. Malakooti, Dept. of Medicine, M/C 787, 840 South Wood St., Univ. of Illinois at Chicago, Chicago, IL 60612 (E-mail: malakoot{at}uic.edu).

Received 30 December 1998; accepted in final form 5 May 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Baird, N., H. Zuan, A. Menon, J. Orlowski, and S. Grinstein. cDNA cloning of and genomic organization of a fifth member of the Na+/H+ exchanger gene family (Abstract). J. Am. Soc. Nephrol. 7: 1251, 1996.

2.   Brant, S. R., C. H. C. Yun, M. Donowitz, and C.-M. Tse. Cloning, tissue distribution, and functional analysis of the human Na+/H+ exchanger isoform, NHE3. Am. J. Physiol. 269 (Cell Physiol. 38): C198-C206, 1995[Abstract/Free Full Text].

3.   Chambrey, R., J. M. Achard, P. L. St. John, D. R. Abrahamson, and D. G. Warnock. Evidence for an amiloride-insensitive Na+/H+ exchanger in rat renal cortical tubules. Am. J. Physiol. 273 (Cell Physiol. 42): C1064-C1074, 1997[Abstract/Free Full Text].

4.   Chambrey, R., J. M. Achard, and D. G. Warnock. Heterologous expression of rat NHE4: a highly amiloride-resistant Na+/H+ exchanger isoform. Am. J. Physiol. 272 (Cell Physiol. 41): C90-C98, 1997[Abstract/Free Full Text].

5.   Collins, J. F., T. Honda, S. Knobel, N. M. Bulus, J. Conary, R. DuBois, and F. K. Ghishan. Molecular cloning, sequencing, tissue distribution and functional expression of a Na+/H+ exchanger (NHE-2). Proc. Natl. Acad. Sci. USA 90: 3938-3942, 1993[Abstract/Free Full Text].

6.   Dudeja, P. K., M. L. Baldwin, J. M. Harig, E. J. Cragoe, Jr., K. Ramaswamy, and T. A. Brasitus. Mechanisms of Na+ transport in human distal colonic apical membrane vesicles. Biochim. Biophys. Acta 1193: 67-76, 1994[Medline].

7.   Dudeja, P. K., J. M. Harig, M. L. Baldwin, J. E. J. Cragoe, K. Ramaswamy, and T. A. Brasitus. Na+ transport in human proximal colonic apical membrane vesicles. Gastroenterology 106: 125-133, 1994[Medline].

8.   Dudeja, P. K., D. D. Rao, I. Syed, V. Joshi, R. Y. Dahdal, C. Gardner, M. C. Risk, L. Schmidt, D. Bavishi, K. E. Kim, J. M. Harig, J. L. Goldstein, T. J. Layden, and K. Ramaswamy. Intestinal distribution of human Na+/H+ exchanger isoforms NHE1, NHE2, and NHE3 mRNA. Am. J. Physiol. 271 (Gastrointest. Liver Physiol. 34): G483-G493, 1996[Abstract/Free Full Text].

9.   Franchi, A., J. E. Cragoe, and J. Pouyssegur. Functional properties of the rat Na/H exchanger NHE2 isoform expressed in Na/H exchanger-deficient Chinese hamster ovary cells. J. Biol. Chem. 261: 14614-14620, 1986[Abstract/Free Full Text].

10.   Franchi, A., D. Perucca-Lostanlen, and J. Pouyssegur. Functional expression of a human Na+/H+ antiporter gene transfected into antiporter-deficient mouse L cells. Proc. Natl. Acad. Sci. USA 83: 9388-9392, 1986[Abstract/Free Full Text].

11.   Ghishan, F. K., S. M. Knobel, and M. Summar. Molecular cloning, sequencing, chromosomal localization, and tissue distribution of the human Na+/H+ exchanger (SLC9A2). Genomics 30: 25-30, 1995[Medline].

12.   Klanke, C. A., Y. R. Su, D. F. Callen, Z. Wang, P. Meneton, N. Baird, R. A. Kandasamy, J. Orlowski, B. E. Otterud, M. Leppert, G. E. Shull, and A. G. Menon. Molecular cloning and physical and genetic mapping of a novel human Na+/H+ exchanger (NHE5/SLC9A5) to chromosome 16q22.1. Genomics 25: 615-622, 1995[Medline].

13.   Kleinman, J. G., J. M. Harig, J. A. Barry, and K. Ramaswamy. Na+ and H+ transport in human jejunal brush-border membrane vesicles. Am. J. Physiol. 255 (Gastrointest. Liver Physiol. 18): G206-G211, 1988[Abstract/Free Full Text].

14.   Kozak, M. Compilation and analysis of sequence upstream from the translational start site in eukayotic mRNAs. Nucleic Acids Res. 15: 8128-8148, 1987.

15.   Kyte, J., and R. F. Doolittle. A simple method for displaying the hydrophobic character of a protein. J. Mol. Biol. 157: 105-132, 1982[Medline].

16.   Layden, T. J., L. Schmidt, L. Agnone, P. Lisitza, J. Brewer, and J. L. Goldstein. Rabbit esophageal cell cytoplasmic pH regulation: role of Na+/H+ antiport and Na+-dependent HCO-3 transport systems. Am. J. Physiol. 263 (Gastrointest. Liver Physiol. 26): G407-G413, 1992[Abstract/Free Full Text].

17.   Noel, J., and J. Pouyssgur. Hormonal regulation, pharmacology, and membrane sorting of vertebrate Na+/H+ exchanger isoforms. Am. J. Physiol. 268 (Cell Physiol. 37): C283-C296, 1995[Abstract/Free Full Text].

18.   Numata, M., K. Petrecca, N. Lake, and J. Orlowski. Identification of a mitochondrial Na+/H+ exchanger. J. Biol. Chem. 273: 6951-6959, 1998[Abstract/Free Full Text].

19.   Orlowski, J., R. A. Kandasamy, and G. E. Shull. Molecular cloning of putative members of the Na+/H+ exchanger gene family. J. Biol. Chem. 267: 9331-9339, 1992[Abstract/Free Full Text].

20.   Ramaswamy, K., J. M. Harig, J. G. Kleinman, and M. S. Harris. Characteristics of Na+/H+ and Cl-/HCO-3 antiport systems in human ileal brush border membrane vesicles. Ann. NY Acad. Sci. 574: 128-130, 1989.

21.   Ramaswamy, K., J. M. Harig, J. G. Kleinman, M. S. Harris, and J. A. Barry. Sodium-proton exchange in human ileal brush border membrane vesicles. Biochim. Biophys. Acta 981: 193-199, 1989[Medline].

22.   Sambrook, J., E. Fritsch, and T. Maniatis. Molecular Cloning, A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.

23.   Sanger, F., S. Nicklen, and A. R. Coulson. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467, 1977[Abstract/Free Full Text].

24.   Sardet, C., L. Counillon, A. Franchi, and J. Pouyssegur. Growth factors induce phosphorylation of the Na+/H+ antiporter, a glycoprotein of 110 kD. Science 247: 723-726, 1990[Abstract/Free Full Text].

25.   Sardet, C., A. Franchi, and J. Pouyssegur. Molecular cloning, primary structure, and expression of the human growth factor-activatable Na+/H+ antiporter. Cell 56: 271-280, 1989[Medline].

26.   Tse, C. M., S. R. Brant, M. S. Walker, J. Pouyssegur, and M. Donowitz. Cloning and sequencing of a rabbit cDNA encoding an intestinal and kidney-specific Na+/H+ exchanger isoform (NHE3). J. Biol. Chem. 267: 9340-9346, 1992[Abstract/Free Full Text].

27.   Tse, M., S. Levine, C. Yun, S. Brant, L. T. Counillon, J. Pouyssegur, and M. Donowitz. Structure/function studies of the epithelial isoforms of the mammalian Na+/H+ exchanger gene family. J. Membr. Biol. 135: 93-108, 1993[Medline].

28.   Tse, C. M., S. A. Levine, C. Yun, S. Khurana, and Donowitz. Na+/H+ exchanger-2 is an O-linked but not an N-linked sialoglycoprotein. Biochem. J. 33: 12954-12961, 1994.

29.   Tse, C. M., S. A. Levine, C. H. C. Yun, M. H. Montrose, P. J. Little, J. Pouyssegur, and M. Donowitz. Cloning and expression of a rabbit cDNA encoding a serum-activated ethylisopropylamiloride-resistant epithelial Na+/H+ exchanger isoform (NHE2). J. Biol. Chem. 268: 11917-11924, 1993[Abstract/Free Full Text].

30.   Tse, C. M., A. I. Ma, V. W. Yang, A. J. M. Watson, S. Levine, M. H. Montrose, J. Potter, C. Sardet, J. Pouyssegur, and M. Donowitz. Molecular cloning and expression of a cDNA encoding the rabbit ileal villus cell basolateral membrane Na+/H+ exchanger. EMBO J. 10: 1957-1967, 1991[Medline].

31.   Wang, Z., J. Orlowski, and G. E. Shull. Primary structure and functional expression of a novel gastrointestinal isoform of the rat Na/H exchanger. J. Biol. Chem. 268: 11925-11928, 1993[Abstract/Free Full Text].

32.   Wickens, M., and P. Stephenson. Role of the conserved AAUAAA sequence: four AAUAAA point mutations prevent messenger RNA 3' end formation. Science 226: 1045-1051, 1984[Free Full Text].

33.   Yu, F. H., J. Orlowski, and G. E. Shull. Functional properties of the rat Na+/H+ exchanger NHE2 isoform expressed in Na+/H+ exchanger-deficient Chinese hamster ovary cells. J. Biol. Chem. 268: 25536-25541, 1993[Abstract/Free Full Text].

34.   Zamir, Z., J. A. Barry, and K. Ramaswamy. Sodium transport in human intestinal basolateral membrane vesicles. Gastroenterology 103: 1817-22, 1992[Medline].


Am J Physiol Gastroint Liver Physiol 277(2):G383-G390
0002-9513/99 $5.00 Copyright © 1999 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
J. B. Claiborne, K. P. Choe, A. I. Morrison-Shetlar, J. C. Weakley, J. Havird, A. Freiji, D. H. Evans, and S. L. Edwards
Molecular detection and immunological localization of gill Na+/H+ exchanger in the dogfish (Squalus acanthias)
Am J Physiol Regulatory Integrative Comp Physiol, March 1, 2008; 294(3): R1092 - R1102.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
W. A. Alrefai, X. Wen, W. Jiang, J. P. Katz, K. A. Steinbrecher, M. B. Cohen, I. R. Williams, P. K. Dudeja, and G. D. Wu
Molecular cloning and promoter analysis of downregulated in adenoma (DRA)
Am J Physiol Gastrointest Liver Physiol, November 1, 2007; 293(5): G923 - G934.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. Malakooti, R. Sandoval, V. C. Memark, P. K. Dudeja, and K. Ramaswamy
Zinc finger transcription factor Egr-1 is involved in stimulation of NHE2 gene expression by phorbol 12-myristate 13-acetate
Am J Physiol Gastrointest Liver Physiol, October 1, 2005; 289(4): G653 - G663.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K. Abdoun, F. Stumpff, K. Wolf, and H. Martens
Modulation of electroneutral Na transport in sheep rumen epithelium by luminal ammonia
Am J Physiol Gastrointest Liver Physiol, September 1, 2005; 289(3): G508 - G520.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
H. Xu, R. Chen, and F. K. Ghishan
Subcloning, localization, and expression of the rat intestinal sodium-hydrogen exchanger isoform 8
Am J Physiol Gastrointest Liver Physiol, July 1, 2005; 289(1): G36 - G41.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. Malakooti, V. C. Memark, P. K. Dudeja, and K. Ramaswamy
Molecular cloning and functional analysis of the human Na+/H+ exchanger NHE3 promoter
Am J Physiol Gastrointest Liver Physiol, March 1, 2002; 282(3): G491 - G500.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
C. Ledoussal, A. L. Woo, M. L. Miller, and G. E. Shull
Loss of the NHE2 Na+/H+ exchanger has no apparent effect on diarrheal state of NHE3-deficient mice
Am J Physiol Gastrointest Liver Physiol, December 1, 2001; 281(6): G1385 - G1396.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
M. E. Cavet, S. Akhter, R. Murtazina, F. Sanchez de Medina, C.-M. Tse, and M. Donowitz
Half-lives of plasma membrane Na+/H+ exchangers NHE1-3: plasma membrane NHE2 has a rapid rate of degradation
Am J Physiol Cell Physiol, December 1, 2001; 281(6): C2039 - C2048.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. Malakooti, R. Y. Dahdal, P. K. Dudeja, T. J. Layden, and K. Ramaswamy
The human Na+/H+ exchanger NHE2 gene: genomic organization and promoter characterization
Am J Physiol Gastrointest Liver Physiol, April 1, 2001; 280(4): G763 - G773.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
M. E. Giannakou and J. A. T. Dow
Characterization of the Drosophila melanogaster alkali-metal/proton exchanger (NHE) gene family
J. Exp. Biol., January 11, 2001; 204(21): 3703 - 3716.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
D. Maouyo, S. Chu, and M. H. Montrose
pH heterogeneity at intracellular and extracellular plasma membrane sites in HT29-C1 cell monolayers
Am J Physiol Cell Physiol, May 1, 2000; 278(5): C973 - C981.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Malakooti, J.
Right arrow Articles by Ramaswamy, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Malakooti, J.
Right arrow Articles by Ramaswamy, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online