AJP - GI  AJP: Regulatory, Integrative and Comparative Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 277: G1041-G1047, 1999;
0193-1857/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hong, D.-H.
Right arrow Articles by Forstner, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hong, D.-H.
Right arrow Articles by Forstner, G.
Vol. 277, Issue 5, G1041-G1047, November 1999

Induction of mucin gene expression in human colonic cell lines by PMA is dependent on PKC-epsilon

D.-H. Hong1, G. Petrovics2, W. B. Anderson2, J. Forstner1, and G. Forstner1

2 Laboratory of Cellular Oncology, Signal Transduction Section, National Cancer Institute, National Institutes of Health, Bethesda, Maryland 20892; and 1 Division of Gastroenterology, Research Institute, The Hospital for Sick Children, Departments of Paediatrics and Biochemistry, University of Toronto, Toronto, Ontario, Canada M5G 1X8


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Treatment of HT-29 cells with phorbol 12-myristate 13-acetate (PMA), an activator of protein kinase C (PKC), induces MUC2 expression. To investigate the role of PKC in regulating mucin genes in intestinal cells, we examined the regulation of MUC1, MUC2, MUC5AC, MUC5B, and MUC6 expression in two human mucin-producing colonic cell lines, T84 and HT29/A1. T84 and HT29/A1 cells (at 80-90% confluency) were exposed to 100 nM PMA for 0, 3, and 6 h. Twofold or greater increases in mRNA levels for MUC2 and MUC5AC were observed in both cell lines during this time period, whereas the levels of MUC1, MUC5B, and MUC6 mRNAs were only marginally affected. These results indicated that PKC differentially regulates mucin gene expression and that it may be responsible for altered mucin expression. Our previous results suggested that the Ca2+-independent PKC-epsilon isoform appeared to mediate PMA-regulated mucin exocytosis in these cell lines. To determine if PKC-epsilon was also involved in MUC2/MUC5AC gene induction, HT29/A1 cells were stably transfected with either a wild-type PKC-epsilon or a dominant-negative ATP-binding mutant of PKC-epsilon (PKC-epsilon K437R). Overexpression of the dominant-negative PKC-epsilon K437R blocked induction of both mucin genes, whereas PMA-induced mucin gene expression was not prevented by overexpression of wild-type PKC-epsilon . PMA-dependent MUC2 mucin secretion was also blocked in cells overexpressing the dominant-negative PKC-epsilon K437R. On the basis of these observations, PKC-epsilon appears to mediate the expression of two major gastrointestinal mucins in response to PMA as well as PMA-regulated mucin exocytosis.

protein kinase C; signal transduction; phorbol 12-myristate 13-acetate


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

MUCUS PLAYS AN IMPORTANT role in protecting nonsquamous epithelial surfaces against mechanical damage and in stabilizing the luminal microenvironment of surface cells. Highly glycosylated mucin proteins are the major components of mucus, responsible for its viscoelastic properties. Nine different mucin genes have now been identified in various human tissues. MUC1, MUC2, MUC3, MUC5AC, MUC5B, and MUC6 are expressed in intestinal cells (3, 19, 28, 35, 36). Three mucins, MUC1 (17), the homologue of MUC3 in the rat (14) [although not apparently human MUC3 (10)], and MUC4 (23), have been reported to have classic carboxy-terminal membrane-spanning domains and therefore may be anchored in whole or in part to the surface plasma membrane. The remainder are secreted mucins that are stored in secretory granules within cells and secreted in response to a wide variety of stimuli (8) to form the surface mucus gel. Although individual mucins display tissue specificity, there is growing evidence that expression is subject to regulatory control and that the relative expression of particular mucins may represent a specific response to inflammation or environmental factors. For example, in the adult intestine MUC5AC is normally expressed in mucus-secreting foveolar cells of gastric glands but can be expressed in colonic neoplastic cells, depending on culture conditions (19), and may appear in goblet cells in inflamed duodenum and colon (29).

Regulation of the expression of MUC2 has been explored in HT-29 cells and shown to be subject to both protein kinase C (PKC)- and protein kinase A-dependent stimuli (37). The present study was undertaken to assess the effect of phorbol 12-myristate 13-acetate (PMA) on the expression of the mucin genes MUC1, MUC2, MUC5AC, MUC5B, and MUC6 and to determine whether the PKC isoform PKC-epsilon was involved, because we had previously identified PKC-epsilon as the likely isoform mediating PMA-stimulated mucin exocytosis (12). To examine the role of PKC-epsilon in PMA-induced mucin gene expression, we have utilized stably transfected HT29/A1 cells constructed to overexpress either wild-type PKC-epsilon or a dominant-negative PKC-epsilon mutant.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. All chemicals were obtained from Sigma (St. Louis, MO) unless otherwise noted. Nytran nylon membranes were obtained from Schleicher & Schuell (Keene, NH).

Cell culture. T84 human colonic carcinoma cell lines were obtained from the American Type Culture Collection (Rockville, MD). T84 cells were cultured in a 1:1 mixture of DMEM-F12 with 5% FBS, penicillin (100 U/ml), and streptomycin (100 µg/ml). HT29/A1, a mucin-producing subclone of the HT29 human colonic tumor cell line, was obtained from Dr. K.-M. Kreusel (Institut fur Klinische Physiologie, Universitats-klinikum, Frei Universitat Berlin, Berlin, Germany). It has been described previously as HT29/B6 (15). HT29/A1 cells were grown in RPMI 1640 medium containing 10% (vol/vol) FBS, penicillin (100 U/ml), and streptomycin (100 µg/ml). All cell culture regents were from GIBCO BRL (Burlington, ON). Cultures were maintained at 37°C in a humidified atmosphere of 5% CO2 and 95% air.

Extraction of total RNA. Total RNA was extracted by the method of Chomczynski and Sacchi (5). Briefly, cultures grown in 10-cm-diameter dishes were washed three times with ice-cold PBS and lysed directly in the dishes using 2 ml of solution A (4 M guanidium isothionate, 25 mM sodium citrate, pH 7.0, 0.5% sarcosyl, and 10 mM beta -mercaptoethanol). The lysed monolayer was scraped with a cell scraper to ensure that all material was released from the dishes. The lysate was transferred to a 15-ml polypropylene tube, and 0.2 ml of 2 M sodium acetate (pH 4.0), 2 ml phenol, and 0.4 ml of a chloroform-isoamyl alcohol mixture (49:1) were added sequentially. The lysate was mixed by inversion after each addition. After brief vortexing, the mixture was kept on ice for 15 min and then centrifuged at 12,000 g for 30 min at 4°C. The upper aqueous phase was transferred to a new tube, and an equal volume of ice-cold isopropanol was added. The samples were mixed and stored at -20°C overnight. RNA was collected by centrifugation at 12,000 g for 20 min at 4°C. The supernatant was discarded, and the RNA pellet was recovered by centrifugation at 12,000 g for 15 min at 4°C, washed twice with 70% ethanol, and dried under vacuum. The dried RNA pellet was then dissolved in diethylpyrocarbonate-treated water and was quantitated by spectrophotometry at a wavelength of 260 nm.

RNA analysis. For Northern blot hybridization, RNA samples (15 µg) were denatured at 65°C for 15 min, applied to a 1.0% agarose gel containing 2.2 M formaldehyde, and then electrophoresed at 30 V for 12 h. The quality and the relative abundance of RNA per lane were judged by comparing the ethidium bromide staining of the ribosomal bands. RNA was transferred to a Nytran nylon membrane and immobilized by UV cross-linker (Stratagene). Membranes were incubated at 43°C overnight in prehybridization buffer [5× sodium chloride-sodium phosphate-EDTA (SSPE), 0.2% SDS, 5× Denhardt's solution, 100 µg/ml sonicated salmon sperm DNA, and 50% formamide]. After prehybridization, the membranes were hybridized for 36 h at 43°C in prehybridization buffer containing 10% dextran sulfate and 32P-labeled cDNA (1,000,000 cpm/ml). After hybridization, the membranes were washed three times with 1× SSPE and 0.1% SDS for 15 min at room temperature and then washed two times with 0.1× SSPE and 0.1% SDS for 15 min at 55°C. Membranes were exposed to Kodak X-Omat film with intensifying screens for 6-12 h at -80°C. Slot-blot analysis was performed by applying 8 µg of total RNA to Nytran nylon membranes using a slot-blot apparatus (Schleicher & Schuell). Membranes were incubated at 43°C overnight in prehybridization buffer (5× SSPE, 0.2% SDS, 5× Denhardt's solution, 100 µg/ml sonicated salmon sperm DNA, and 50% formamide). After prehybridization, the membranes were hybridized for 36 h at 43°C in prehybridization buffer containing 10% dextran sulfate and 32P-labeled cDNA (1,000,000 cpm/ml). After hybridization, the membranes were washed three times with 1× SSPE and 0.1% SDS for 15 min at room temperature and then two times with 0.1× SSPE and 0.1% SDS for 15 min at 55°C. Membranes were exposed to Kodak Biomax film with intensifying screens for 6-12 h at -80°C. Images were scanned using an UVP image system, and the densitometric ratio of mucin mRNA to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was quantitated by NIH Image software.

cDNA probes. The 411-bp cDNA from the carboxy-terminal region of MUC2 cloned in our laboratory has been described elsewhere (40). The MUC1 cDNA (656 bp) probe was generated by RT-PCR using the specific primers (sense, 690 5'-AGGCTCAGCTTCTAC-TCTGG-3' 710 and antisense, 1356 5'-GACAGACAGCCAAGGCAATG-3' 1326), described by Chambers and Harris (4). The 271-bp MUC5AC cDNA probe was generated by RT-PCR using the specific primers described by Voynow and Rose (38). A 104-bp cDNA probe was generated by RT-PCR using the sense primer 1651 5'-AGCTCCAAAGCCACTTCCTC-3' 1670 and antisense primer 1754 5'-GGGATGGGTGTAAAGCTGGTAG-3' 1733, based on the updated GenBank sequence of the JER57 clone initially isolated by Dufosse et al. (7) and subsequently identified as part of MUC5B (6). The MUC6 cDNA probe was generated by RT-PCR with primers selected according to the published sequence (31). A 590-bp fragment was produced by specific sense primer 610 5'-GCTTCACCAACAACAAGTTTAAG-3' 630 and antisense primer 1199 5'-CATCATTCAGACAAGCAAAGC-3' 1179. A second round of RT-PCR, using the 590-bp fragment as template, was performed with internal sense primer 797 5'-CCAAGTCTACCAGTAGAGAC-3' 818 and antisense primer 1098 5'-CTTCTGCTTCGATCCACTCA-3' 1079 to generate a 302-bp cDNA probe. The 983-bp GAPDH cDNA probe was generated by RT-PCR using cDNA from human gastric tissue as template. The primer set (sense, 44 5'-TGAAGGTCGGAGTCAACGGATTTGGT-3' 69 and antisense, 1026 5'-CATGTGGGCCATGAGGTCCACCAC-3' 1003) was chosen from the published sequence (33). The specificity of the probes for mRNA of expected molecular mass was confirmed by Northern blot analysis.

RT-PCR. One milligram of total RNA was reverse transcribed with 50 units Moloney murine leukemia virus RT (Perkin Elmer, Foster City, CA), 2.5 µM random hexamer, 1 mM dGTP, 1 mM dATP, 1 mM dTTP, 1 mM dCTP, and 20 units RNase inhibitor in a total volume of 20 µl for 30 min at 42°C. PCR was performed in a 50-µl reaction containing 0.5 units Taq polymerase (Perkin Elmer), 125 µM each dNTP, 2 mM MgCl2, 50 mM KCl, 10 mM Tris · HCl, pH 8.3, and 0.1 mM primers (both sense and antisense). PCR was carried out under the following conditions: 95°C for 5 min, 1 cycle; 94°C for 1 min, 60°C for 1 min, 72°C for 1 min, 30 cycles; and 72°C for 7 min, 1 cycle (Perkin Elmer Cetus DNA thermal cycler 480). The PCR reaction products (10 µl) were separated by electrophoresis on a 2.0% agarose/Tris acetate EDTA gel and stained with ethidium bromide.

Construction of a kinase inactive mutant of PKC-epsilon . The PKC-epsilon kinase inactive mutant construct was generated by the PCR overlap extension method of Ho et al. (11). The following oligonucleotide primers were used in the mutagenesis protocol: 5' primer, CCGCGTCGACCATGGTAGTGTTCAATGG; mutagen primer A, CGTCCTTCTTTA<UNL>GGGCCCT</UNL>CACAGCATA GAC; mutagen primer B, GTCTATGCTGTGA<UNL>GGGCCCT</UNL>AAA GAAGGACG; and 3' primer, ATTCGCGCGCTCAGGGCATCAGGTCTTCAC. The altered sites introduced into primers A and B (underlined nucleotides) were designed to mutate the original amino acids Lys-437 and Val-438 to Arg-437 and Ala-438, respectively, and to introduce a new Apa I restriction site (GGGCCC). The mutant cDNA fragment generated by the PCR overlap extension procedure was cloned into the mammalian epitope tagging expression vector (epsilon MTH), which contains the metallothionein promoter as described by Olah et al. (25). The PCR reactions were performed with low (<= 10) cycle number using the high-fidelity Vent DNA polymerase to minimize the chance of undesired point mutations. The introduced ATP binding site mutation was verified in selected clones by restriction digestions and DNA sequencing. This PKC-epsilon K437R cDNA construct has been verified by stable transfection into NIH/3T3 fibroblasts in which the expressed mutant protein was characterized by Western blotting, kinase activity, and phorbol binding assays as well as by cell fractionation, immunocytochemistry, and fluorescent microscopy experiments (26).

Transfection of HT29/A1 cells. HT29/A1 cells were grown in RPMI 1640 containing 10% FBS. The cells were transfected with either empty expression vector (epsilon MTH), with the epsilon MTH expression vector containing the dominant-negative mutant PKC-epsilon K437R, or with the epsilon MTH PKC-epsilon wild-type vector containing full-length mouse PKC-epsilon cDNA, using lipofectamine (GIBCO BRL), following the procedure recommended by the manufacturer. Stably transfected cell lines were selected with G418 (0.5 mg/ml). Resistant clones (10-20) from each transfection were selected at random and screened for protein expression by Western blot analysis. The epsilon MTH vector contains a zinc-inducible promoter. Thus transfected cells were incubated in the presence and absence of 75 µM zinc acetate, as noted, to induce synthesis of the indicated recombinant proteins.

Preparation of cell extracts for Western blotting. For protein extraction, cells were washed with ice-cold PBS, scraped into ice-cold buffer A [0.2% Triton X-100, 20 mM Tris · HCl, pH 7.5, 0.25 M sucrose, 50 mM beta -mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride (PMSF), 200 µg/ml of leupeptin, 5 mM EDTA, and 2 mM EGTA]. The cells were disrupted using a Dounce homogenizer. Homogenates were kept for 1 h at 4°C and then centrifuged at 100,000 g for 30 min at 4°C. The supernatant was either used immediately for SDS-PAGE or stored at -80°C. Protein concentration was assayed with Coomassie blue plus protein reagent (Pierce, Rockford, IL) using BSA as standard.

Western blotting. Protein samples were analyzed using 10% SDS-PAGE (16). The separated proteins were electrophoretically transferred to a polyvinylidene difluoride (PVDF) membrane (Immobilon-P) using a Bio-Rad transfer blot apparatus by the method of Towbin et al. (32). Nonspecific sites were blocked by incubation of PVDF membranes with 4% nonfat dry milk (Bio-Rad) or 3% BSA in 50 mM Tris · HCl, pH 7.5, 0.15 M NaCl, and 0.05% Tween 20 (TBST) for 1 h. The membranes then were incubated at 4°C overnight with anti-PKC-epsilon antibody (GIBCO BRL) at a dilution of 1:333. After three washes (15 min) with TBST, secondary antibody [horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG, (1:3,000 dilution) or HRP-conjugated rabbit anti-mouse IgG, (1:5,000 dilution)] was added and incubated for 1 h at room temperature. Membranes were washed three times, each for 15 min with TBST, and bound antibody was dectected by the enhanced chemiluminescence detection system (Amersham, Oakville, ON). When necessary, blots were scanned by UVP Image System and the captured image was analyzed for band densities by NIH Image software.

Mucin secretion assay. HT29/A1 cells were washed twice with 1 ml of growth medium (without FBS). One milliliter of growth medium (without FBS) was then added to each well, and the cells were allowed to equilibrate for 15 min at 37°C in a CO2 incubator. The medium was removed, 1 ml of fresh medium with or without potential secretagogues was added to each well, and the incubation was continued, unless otherwise specified, for 30 min at 37°C. The media were collected into 1.5-ml Eppendorf tubes containing 10 µl of 100 mM PMSF and mixed, and aliquots were removed for immunoassay. Ice-cold 10% TCA (1 µl) was then added to each well, and the cell protein was allowed to precipitate overnight at 4°C. The precipitates were washed with 10% TCA and dissolved in 1 ml of 0.1 M NaOH. Protein was assayed using Coomassie plus protein reagent (Pierce) using BSA as standard. Mucins were assayed as previously described (12) using an antibody raised against human intestinal mucin that recognizes both glycosylated and nonglycosylated MUC2 (22).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

PMA treatment of T84 cells stimulates mucin gene expression. T84 human colonic cells were initially used to assess the effect of PMA on the steady-state mucin mRNA levels. Cells at 80-90% confluency were exposed to the PKC activator PMA at a concentration of 100 nM for 0-6 h, total RNA was extracted, and RNA slot-blot assays were performed. Figure 1 shows the slot-blot hybridization analysis of the effect of PMA treatment on the levels of the housekeeping gene GAPDH and three mucin genes: MUC1, encoding a membrane-anchored mucin, and MUC2 and MUC5AC, genes that encode secretory mucins. The level of MUC1 mRNA showed a minimal change over 6 h. However, the expression of both MUC2 and MUC5AC was considerably enhanced, particularly at 6 h. PMA treatment did not change the levels of the GAPDH housekeeping gene. These results were quantitated by comparing density ratios of mucin mRNA to GAPDH mRNA. MUC2 expression increased almost 4-fold, and MUC5AC mRNA levels increased by 25-fold relative to the housekeeping gene, whereas MUC1 mRNA levels increased by <1.5-fold. In T84 cells the mRNA levels of two other secretory mucins, MUC5B and MUC6, were barely detectable and did not change during exposure to PMA (data not shown). Enhanced gene expression was also not produced by refreshing the culture medium at the time of adding PMA. These findings support the previous results of Velcich and Augenlicht (37), which indicated that PMA treatment enhanced the mRNA levels of MUC2 and importantly establish that a second secretory mucin gene, MUC5AC, was even more dramatically regulated by a PMA-activated PKC.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1.   Exposure of T84 cells to phorbol 12-myristate 13-acetate (PMA) stimulates mucin gene expression. Autoradiograms show effects of exposure of T84 cells to 100 nM PMA for times indicated on levels of MUC1, MUC2, MUC5AC, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-specific mRNAs. Total RNA was prepared at each time point and analyzed by hybridization with specific cDNA probes as described in MATERIALS AND METHODS, employing an RNA slot-blot assay.

PMA treatment of HT29/A1 cells also stimulates mucin gene expression. Experiments identical to those described above were performed with HT29/A1 cells, a mucin-producing human colonic cell line known to express mucin at a relatively high level. The induction kinetics of HT29/A1 mucin mRNAs were similar to those found with T84 cells. Figure 2 shows a time course of mucin gene expression in response to PMA treatment. Of the five mucin genes examined, only the expression of MUC2 and MUC5AC was increased more than twofold. In contrast to T84 cells, baseline mRNA levels in HT29/A1 cells for MUC5B and MUC6 were detectable and were either minimally increased (MUC6) or reduced (MUC5B) by exposure of these cells to PMA. Similar to the results obtained with T84 cells, the levels of MUC1 mRNA were only minimally affected in HT29/A1 cells.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 2.   Exposure of HT29/A1 cells to PMA stimulates mucin gene expression. Autoradiograms show effects of PMA (100 nM) treatment of HT29/A1 cells for indicated times on mucin mRNA levels. Slot-blot hybridization was carried out as in Fig. 1.

Overexpression of dominant-negative PKC-epsilon K437R selectively blocks PMA-induced MUC2 and MUC5AC gene expression. Previously, we suggested that PKC-epsilon is the most likely PKC isoform involved in regulating PMA-dependent mucin secretion in colonic cancer cell lines (12) because LS-180 cells, which are selectively low in PKC-epsilon when compared with T84 and HT29/A1 cells, also responded poorly to PMA. Although baseline expression of MUC2 and MUC5AC mRNAs were ample in LS-180 cells, we could find little evidence of induced gene expression when PMA was added (data not shown). PKC-epsilon therefore appeared to be a likely candidate for stimulating mucin gene expression in T84 and HT29 cells.

To investigate this possibility, the inactive dominant-negative mutant PKC-epsilon K437R was constructed with an amino acid substitution at Lys-437 in the catalytic domain to prevent ATP binding (see MATERIALS AND METHODS). This construct was inserted into the epsilon MTH vector containing a zinc-inducible metallothionein promoter. HT29/A1 cells were transfected with empty vector and with the epsilon MTH dominant-negative construct. Figure 3 demonstrates the zinc inducibility of PKC-epsilon K437R protein in these cells. HT29/A1 cells were incubated with and without zinc acetate (75 µM) overnight and harvested, and lysates were analyzed by immunoblotting. The intensity of the protein band recognized by PKC-epsilon -specific antibody was increased at least 10-fold in the presence of zinc. Control HT29/A1 cell lines stably transfected with empty vector contained only normal amounts of endogenous wild-type PKC-epsilon and the level of expression was not altered with exposure to zinc.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 3.   Expression and inducibility of dominant-negative protein kinase C (PKC)-epsilon K437R mutant protein in HT29/A1 cells transfected with empty vector (control) and with mammalian epitope tagging expression vector (epsilon MTH) PKC-epsilon K437R. Cells were exposed to 75 µM zinc acetate overnight as noted (+) to induce synthesis of recombinant PKC-epsilon K437R mutant protein and lysed, and protein electrophoresis and Western blot analysis were performed as described in MATERIALS AND METHODS. Constitutive and mutant PKC-epsilon were detected by immunoblotting with anti-PKC-epsilon antibody.

To determine if overexpression of the dominant-negative PKC-epsilon mutant would inhibit PMA-induced expression of MUC2 and MUC5AC mRNA, HT29/A1 cells stably transfected with PKC-epsilon K437R or empty vector were incubated with and without zinc acetate overnight as noted in Fig. 3 and then exposed to 100 nM PMA for 6 h. PMA-mediated mucin gene induction was analyzed by slot-blot assay. In the absence of zinc, PMA induced MUC5AC and MUC2 mRNA expression in both K437R and empty vector cells (Fig. 4). In the presence of zinc, MUC2 mRNA levels were increased on densitometric analysis to 219% of starting levels at 3 h, to 143% at 6 h of PMA treatment in empty vector cells, and to 118% and 108% at the same times in K437R cells, representing a reduction of 85% and 81%, respectively. Induction of MUC5AC mRNA by PMA was completely inhibited in K437R cells. GAPDH expression was the same at all times and conditions. Thus the zinc-induced overexpression of the PKC-epsilon dominant-negative mutant protein inhibited PMA-induced MUC2 and MUC5AC mucin gene expression. Unlike MUC5AC mRNA, MUC2 mRNA content was increased in unstimulated K437R cells over that of empty vector cells in the presence and absence of zinc. The explanation is not readily apparent but could represent synthetic upregulation related to the site of insertion of the construct or some other chance variation.


View larger version (39K):
[in this window]
[in a new window]
 
Fig. 4.   Overexpression of dominant-negative PKC-epsilon K437R mutant blocks PMA-induced increase in MUC2 and MUC5AC mRNA levels in HT29/A1 cells. As in Fig. 3, control (Cont) cells were transfected with empty vector. Zinc acetate (75 µM) was added to medium overnight where indicated (+Zn). RNA was analyzed as in Fig. 1.

Overexpression of wild-type holo PKC-epsilon does not prevent PMA-mediated induction of MUC2 and MUC5AC gene expression. To exclude the possibility that overexpression of the dominant-negative PKC-epsilon protein might have nonspecific effects on mucin gene expression other than by acting to compete with active endogenous PKC-epsilon , we also stably transfected HT29/A1 cells with an epsilon MTH expression vector containing wild-type holo PKC-epsilon to generate cells that would overexpress PKC-epsilon when treated with zinc (Fig. 5A). Exposure of these PKC-epsilon overexpressor cells to PMA for 3 h resulted in an increase in MUC2 and MUC5AC gene expression (Fig. 5B), as in wild-type cells. These results indicate that the endogenous level of PKC-epsilon is sufficient to mediate PMA induction of mucin gene expression and that significant overexpression of the PKC-epsilon protein itself does not interfere with the effects noted with PMA treatment.


View larger version (36K):
[in this window]
[in a new window]
 
Fig. 5.   PMA induces mucin gene expression in cells that overexpress wild-type holo PKC-epsilon . A: Western blot showing overexpression of PKC-epsilon protein in cells transfected with epsilon MTH vector containing wild-type holo PKC-epsilon after incubation with 75 µM zinc acetate overnight. PKC-epsilon was detected by immunoblotting with anti-PKC-epsilon antibody. Western blots were performed as indicated in Fig. 3. B: Increased expression of MUC2 and MUC5AC mucin MRNA after incubation of overexpressing cells with PMA (100 nM) for 3 h. RNA was analyzed as in Fig. 1.

Overexpression of the dominant-negative PKC-epsilon K437R mutant blocks the PMA-induced increase in mucin secretion in HT29/A1 cells. Because we had previously obtained strong indirect evidence that PKC-epsilon mediated PMA-dependent mucin secretion in HT29/A1 cells (12), we compared the secretory response to a standard 100 nM PMA stimulus between cells infected with PKC-epsilon K437R and two sets of controls, i.e., cells transfected with the epsilon MTH empty vector and parental nontransfected cells. Zinc acetate (75 µM) was added to all cultures 6 h before adding PMA to ensure maximal expression of PKC-epsilon K437R. As in our previous study, the antibody used in the immunoassay was specific for MUC2 (see MATERIALS AND METHODS). As shown in Fig. 6, the presence of the dominant-negative PKC-epsilon K437R mutant virtually eliminated the secretory response. These results strongly support and confirm a critical role for PKC-epsilon in mediating MUC2 mucin secretion. Furthermore, the results provide an important validation of the specificity of action of the dominant-negative PKC-epsilon , because the role of PKC-epsilon in mediating mucin secretion is strongly supported by independent evidence (12).


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6.   Overexpression of dominant-negative PKC-epsilon K437R mutant blocks PMA-induced increase in mucin secretion in HT29/A1 cells. Cells were incubated with or without 100 nM PMA for 30 min at 37°C. Mucin released into medium during 30-min period was measured by immunoassay as described in MATERIALS AND METHODS. Mucin secretion is shown as mean ± SE for 3 incubations. Studies were carried out with wild-type HT29/A1 cells (WT), cells transfected with empty vector epsilon MTH, and cells overexpressing dominant-negative PKC-epsilon K437R.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Our results show that the expression of two mucin genes, MUC5AC and MUC2, is induced by the phorbol ester PMA. Both genes are located on chromosome 11p15.5 in a 400-kb region that also includes the genes for MUC5B and MUC6 (27). The four gene products have considerable sequence homology, particularly in their cysteine-rich carboxy-terminal regions, and their genes are thought to have evolved from a common ancestor. PMA had much less effect on the expression of MUC5B or MUC6, however, and may even decrease the expression of MUC5B, indicating that all genes in the cluster are unlikely to be controlled in the same manner by PMA. The two genes that do respond strongly are interesting, however, in that they are frequently coexpressed in goblet cells in the presence of duodenal and colonic inflammation (29). MUC2 is the dominant mucin in the normal intestine and is the major mucin expressed in colitis (34). However, when tissues are stained immunohistochemically for specific antigens, goblet cells that contain both MUC2 and MUC5AC are seen in areas of significant inflammation (29). Also, these two genes are coexpressed in many cells in areas of gastric metaplasia, an inflammatory response characterized by the appearance of cells with gastric phenotype in which the dominant mucin is MUC5AC (unpublished observations). Thus there is pathological evidence to suggest that intracellular stored amounts of these two gene products are regulated by inflammatory stimuli in intestinal cells.

PKC is a potentially important mediator of gene expression under these conditions because it could be activated by a number of inflammatory agents. The proinflammatory cytokine tumor necrosis factor-alpha (TNF-alpha ) stimulates PKC activity, for example, in bovine bronchial epithelial cells as part of the physiological response to wound healing (39). In macrophages, PKC-epsilon is activated by bacterial lipopolysaccharide (LPS) and is the major isoform involved in the LPS-induced secretion of TNF-alpha and other cytokines (30). PKC-epsilon is also induced by TNF-alpha to mediate inhibition of insulin signaling in HEK-293 cells (13). As yet, the role of inflammatory agents in regulating mucin gene expression is largely unexplored. TNF-alpha and LPS have been shown to upregulate MUC2 in human airway epithelial cells (20). TNF-alpha -mediated MUC2 gene expression was inhibited by calphostin C and genistein, suggesting that signal transduction was dependent on both PKC and tyrosine kinases.

In the present study, overexpression of a dominant-negative PKC-epsilon mutant in HT29/A1 cells prevented the increase in MUC5AC and MUC2 mRNA normally seen on exposure of these cells to phorbol ester. At the same time, overexpression of wild-type PKC-epsilon did not alter the increase in mRNA levels for these two mucins when the cells were exposed to PMA, indicating that endogenous PKC-epsilon was sufficient for induction. These results indicate that the inhibition of the PMA-induced increase in MUC5AC and MUC2 mRNA levels by the dominant-negative PKC-epsilon is not due to overexpression of other domains of the PKC-epsilon polypeptide.

The intestinal goblet cell secretes mucin by two processes, an unregulated constitutive pathway that depends on the continuous movement of mucin granules from the Golgi to the apex of the cell and a second regulated process that depends on the sudden release of mucin from central storage granules (21). The first is directly related to the rate of mucin synthesis and hence to mucin gene expression. The second is independent of synthesis in the short term and is measured as the increase in mucin output over baseline output that follows an appropriate stimulus. We have now shown that PMA stimulates both responses by activation of the same PKC isoform. In previous work we demonstrated that PMA was able to stimulate mucin secretion [subsequently identified as MUC2 secretion (22)] in T84 cells in a Ca2+-independent manner (9). Later results pointed to mediation by the Ca2+-independant isoform of PKC, PKC-epsilon , because in three cell lines (LS-180, T84, and HT29/A1) the secretory response to PMA correlated with the level and activation time of PKC-epsilon (12). Inhibition of PMA-regulated mucin secretion by a dominant-negative PKC-epsilon mutant in HT29/A1 cells, as demonstrated in this study, provides the final confirmation that PKC-epsilon mediates PMA-dependent exocytosis of MUC2. PKC-epsilon appears to mediate a variety of secretory processes. For example, we have also shown in studies in NIH/3T3 cells that PKC-epsilon is involved in regulating the secretion of glycosaminoglycans (18). Phorbol ester-dependent secretion of prolactin was also increased by overproduction of PKC-epsilon (2).

There are at least 12 closely related PKC isozymes that exhibit distinct enzymological properties, differential tissue expression with specific subcellular localization, and different modes of cellular regulation (24). In HT29 and T84 cells, the major isoforms are PKC-epsilon , PKC-alpha , and PKC-zeta (12), and of these only PKC-alpha and PKC-epsilon are activated by PMA. The role of PKC-alpha , which is abundantly expressed in these cells, is not yet clear. However, it may be involved in regulating cell differentiation, because it has been shown to modulate growth and differentiation in the enterocyte colonic adenocarcinoma cell line Caco-2 (1). The Caco-2 cell line differentiates into cells of the enterocyte lineage, however, rather than into mucus-secreting cells. Thus these findings may not be applicable to the HT29/A1 cells used in the present study.

It is important to emphasize that our results do not discriminate between an increase in transcription rate and mRNA stabilization. A previous study (37) failed to determine conclusively whether phorbol ester or forskolin acted to increase MUC2 transcription rates or stabilize mRNA. Protein synthesis seemed to be required, suggesting that activation of a rapidly degraded transcription factor such as the activator protein-1 complex could be involved. Further studies now are required to better define the mechanism(s) involved in mediating the noted PKC-epsilon -dependent changes in mucin gene expression.


    FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: G. Forstner, The Hospital for Sick Children, 555 Univ. Ave., Rm. 3423, Toronto, ON, Canada M5G 1X8 (E-mail: gforst{at}sickkids.on.ca).

Received 16 March 1999; accepted in final form 2 August 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Abraham, C., B. Scaglione-Sewell, S. F. Skarosi, W. Qin, M. Bissonnette, and T. A. Brasitus. Protein kinase C alpha  modulates growth and differentiation in Caco-2 cells. Gastroenterology 114: 503-509, 1998[Medline].

2.   Akita, Y., S. Ohno, Y. Yajima, Y. Konno, T. C. Saido, K. Mizuno, K. Chida, S. Osada, T. Kurok, S. Kawashima, and K. Suzuki. Overproduction of a Ca2+-independent protein kinase C isozyme, nPKCepsilon , increases the secretion of prolactin from thyrotropin-releasing hormone-stimulated rat pituitary GH4C1 cells. J. Biol. Chem. 269: 4653-4660, 1994[Abstract/Free Full Text].

3.   Carrato, C., C. Balague, C. De Bolos, E. Gonzalez, G. Gambus, J. Planas, J. M. Perini, D. Andreu, and F. X. Real. Differential apomucin expression in normal and neoplastic human gastrointestinal tissues. Gastroenterology 107: 160-172, 1994[Medline].

4.   Chambers, J. A., and S. Harris. Expression of the cystic fibrosis gene and the major panceatic mucin gene MUC1 in human ductal epithelial cells. J. Cell Sci. 105: 417-422, 1993[Abstract].

5.   Chomzynski, P., and N. Sacchi. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159, 1987[Medline].

6.   Desseyn, J.-L., V. Guyonnet-Duperat, N. Porchet, J.-P. Aubert, and A. Laine. Human mucin gene MUC5B, the 10.7-kb large central exon encodes various alternate subdomains resulting in a super-repeat. J. Biol. Chem. 272: 3168-3178, 1997[Abstract/Free Full Text].

7.   Dufosse, J., N. Porchet, J. Audie, V. Guyonnet Duperat, A. Laine, I. Van-Seuningen, S. Marrakchi, P. Degand, and J. Aubert. Degenerate 87-base-pair tandem repeats create hydrophilic/hydrophobic alternating domains in human mucin peptides mapped to 11p15. Biochem. J. 293: 329-337, 1993.

8.   Forstner, G. Signal transduction, packaging and secretion of mucins. Annu. Rev. Physiol. 57: 585-605, 1995[Medline].

9.   Forstner, G., Y. Zhang, D. McCool, and J. Forstner. Mucin secretion by T84 cells: stimulation by PKC, Ca2+, and a protein kinase activated by Ca2+ ionophore. Am. J. Physiol. 264 (Gastrointest. Liver Physiol. 27): G1096-G1102, 1993[Abstract/Free Full Text].

10.   Gum, J. R., J. J. L. Ho, W. S. Pratt, J. W. Hicks, A. S. Hill, L. E. Vinall, A. M. Roberton, D. M. Swallow, and Y. S. Kim. Muc3 human intestinal mucin: analysis of gene structure, the carboxyl terminus, and a novel upstream repetitive region. J. Biol. Chem. 272: 26678-26686, 1997[Abstract/Free Full Text].

11.   Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. Site-directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77: 51-59, 1989[Medline].

12.   Hong, D.-H., J. F. Forstner, and G. Forstner. Protein kinase C-epsilon is the likely mediator of mucin exocytosis in human colonic cell lines. Am. J. Physiol. 272 (Gastrointest. Liver Physiol. 35): G31-G37, 1997[Abstract/Free Full Text].

13.   Kellerer, M., J. Mushack, H. Mischak, and H. U. Haring. Protein kinase C (PKC) epsilon  enhances the inhibitory effect of TNFalpha on insulin signaling in HEK293 cells. FEBS Lett. 418: 119-122, 1997[Medline].

14.   Khatri, I. A., G. G. Forstner, and J. F. Forstner. The carboxyl-terminal sequence of rat intestinal mucin RMuc3 contains a putative transmembrane region and two EGF-like motifs. Biochim. Biophys. Acta 1326: 7-11, 1997[Medline].

15.   Kreusel, K.-M., M. Fromm, J. Schultzke, and U. Hegel. Cl- secretion in epithelial monolayers of mucus-forming human colon cells (HT-29/B6). Am. J. Physiol. 261 (Cell Physiol. 30): C574-C582, 1991[Abstract/Free Full Text].

16.   Laemmli, U. K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680-685, 1970[Medline].

17.   Lan, M. S., S. K. Batra, W.-N. Qi, R. S. Metzgar, and M. A. Hollingsworth. Cloning and sequencing of a human pancreatic tumor mucin cDNA. J. Biol. Chem. 265: 15294-15299, 1990[Abstract/Free Full Text].

18.   Lehel, C., Z. Olah, G. Jakab, and W. B. Anderson. Protein kinase Cepsilon is localized to the golgi via its zinc-finger domain and modulates golgi function. Proc. Natl. Acad. Sci. USA 92: 1406-1410, 1995[Abstract/Free Full Text].

19.   Lesuffleur, T., N. Porchet, J.-P. Aubert, D. Swallow, J. R. Gum, Y. S. Kim, F. X. Real, and A. Zweibaum. Differential expression of the human mucin genes MUC1 to MUC5 in relation to growth and differentiation of different mucus-secreting HT-29 cell populations. J. Cell Sci. 106: 771-783, 1993[Abstract].

20.   Levine, S. J., P. Larivee, C. Logun, C. W. Angus, F. P. Ognibene, and J. H. Shelhamer. Tumor necrosis factor-alpha induces mucin hypersecretion and MUC-2 gene expression by human airway epithelial cells. Am. J. Respir. Cell Mol. Biol. 12: 196-204, 1995[Abstract].

21.   McCool, D. J., J. F. Forstner, and G. G. Forstner. Regulated and unregulated pathways for MUC2 mucin secretion in human colonic LS180 adenocarcinoma cells are distinct. Biochem. J. 312: 125-133, 1995.

22.   McCool, D. J., J. F. Forstner, and G. G. Forstner. Synthesis and secretion of mucin by the human colonic tumour cell line LS180. Biochem. J. 302: 111-118, 1994.

23.   Moniaux, N., S. Nollet, N. Porchet, P. Degand, A. Laine, and J. P. Aubert. Complete sequence of the human mucin MUC4: a putative cell membrane-associated mucin. Biochem. J. 338: 325-333, 1999.

24.   Newton, A. C. Protein kinase C: structure, function, and regulation. J. Biol. Chem. 270: 28495-28498, 1995[Free Full Text].

25.   Olah, Z., C. Lehel, G. Jakab, and W. B. Anderson. A cloning and epsilon -epitope-tagging insert for the expression of polymerase chain reaction-generated cDNA fragments in Escherichia coli and mammalian cells. Anal. Biochem. 221: 94-102, 1994[Medline].

26.   Petrovics, G., C. Lehel, T. Oravecz, and W. B. Anderson. Protein kinase epsilon -mediated growth inhibition of NIH 373 cells. Proc. Am. Assoc. Cancer Res. 39: 339, 1998.

27.  Pigny, P., V. Guyonnet-Duperat, A. S. Hill, W. S. Pratt, S. Galiegue-Zouitina, M. D'Hooge, J.-P. Laine, I. Van-Seuningen, P. Degand, J. R. Gum, Y. S. Kim, D. M. Swallow, J.-P. Aubert, and N. Porchet. Human mucin genes assigned to 11p15. 5: identification and organization of a cluster of genes. Genomics: 340-352, 1996.

28.   Porchet, N., P. Pigny, M.-P. Buisine, V. Debailleul, P. Degand, A. Laine, and J.-P. Aubert. Human mucin genes: genomic organization and expression of MUC4, MUC5AC and MUC5B. Biochem. Soc. Trans. 23: 800-805, 1995[Medline].

29.   Shaoul, R., P. Marcon, Y. Okada, E. Cutz, and G. Forstner. Colonic expression of MUC2 and MUC5AC in inflammatory bowel disease (Abstract). J. Pediatr. Gastroenterol. Nutr. 26: 565, 1998.

30.   Shapira, L., V. L. Sylvia, A. Halabi, W. A. Soskolne, T. E. Van Dyke, D. D. Dean, B. D. Boyan, and Z. Schwartz. Bacterial lipopolysaccharide induces early and late activation of protein kinase C in inflammatory macrophages by selective activation of PKC-epsilon . Biochem. Biophys. Res. Commun. 240: 629-634, 1997[Medline].

31.   Toribara, N. W., A. M. Robertson, S. B. Ho, W. Kuo, E. Gum, J. W. Hicks, J. R. Gum, J. C. Byrd, B. Siddiki, and Y. S. Kim. Human gastric mucin. J. Biol. Chem. 268: 5879-5885, 1993[Abstract/Free Full Text].

32.   Towbin, H., T. Staehelin, and J. Gordon. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and applications. Proc. Natl. Acad. Sci. USA 76: 4350-4354, 1979[Abstract/Free Full Text].

33.   Tso, J. Y., X.-H. Sun, T.-H. Kao, K. S. Reece, and R. Wu. Isolation and character of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic complexity and molecular evolution of the gene. Nucleic Acids Res. 13: 2485-2502, 1985[Abstract/Free Full Text].

34.   Tytgat, K. M., F. J. Opdam, A. W. Einerhand, and J. Dekker. MUC2 is the prominent colonic mucin expressed in ulcerative colitis. Gut 38: 554-563, 1996[Abstract/Free Full Text].

35.   Van Klinken, B. J., J. Dekker, H. A. Buller, C. De Bolos, and A. W. C. Einerhand. Biosynthesis of mucins (MUC2-6) along the longitudinal axis of the human gastrointestinal tract. Am. J. Physiol. 273 (Gastrointest. Liver Physiol. 36): G296-G302, 1997[Abstract/Free Full Text].

36.   Van Klinken, B. J., E. Oussoren, J.-J. Weenink, G. J. Strous, H. A. Buller, J. Dekker, and A. W. C. Einerhand. The human intestinal cell lines Caco-2 and LS174T as models to study cell-type specific mucin expression. Glycoconj. J. 13: 757-768, 1996[Medline].

37.   Velcich, A., and L. H. Augenlicht. Regulated expression of an intestinal mucin gene in HT29 colonic carcinoma cells. J. Biol. Chem. 268: 13956-13961, 1993[Abstract/Free Full Text].

38.   Voynow, J. A., and M. C. Rose. Quantitation of mucin RNA in respiratory and intestinal epithelial cells. Am. J. Respir. Cell Mol. Biol. 11: 742-750, 1994[Abstract].

39.   Wyatt, T., H. Ito, T. S. Veys, and J. R. Spurzem. Stimulation of protein kinase C activity by tumor necrosis factor-alpha in bovine bronchial epithelial cells. Am. J. Physiol. 273 (Lung Cell. Mol. Physiol. 17): L1007-L1012, 1997.

40.   Xu, G., L. Huan, I. Khatri, U. S. Sajjan, D. McCool, D. Wang, C. Jones, G. Forstner, and J. Forstner. Human intestinal mucin-like protein (MLP) is homologous with rat MLP in the C-terminal region and is encoded by a gene on chromosome 11 p 15.5. Biochem. Biophys. Res. Commun. 183: 821-828, 1992[Medline].


Am J Physiol Gastroint Liver Physiol 277(5):G1041-G1047



This article has been cited by other articles:


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
T. A. Wyatt, R. E. Slager, J. DeVasure, B. W. Auvermann, M. L. Mulhern, S. Von Essen, T. Mathisen, A. A. Floreani, and D. J. Romberger
Feedlot dust stimulation of interleukin-6 and -8 requires protein kinase C{varepsilon} in human bronchial epithelial cells
Am J Physiol Lung Cell Mol Physiol, November 1, 2007; 293(5): L1163 - L1170.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. Ehre, Y. Zhu, L. H. Abdullah, J. Olsen, K. I. Nakayama, K. Nakayama, R. O. Messing, and C. W. Davis
nPKC{varepsilon}, a P2Y2-R downstream effector in regulated mucin secretion from airway goblet cells
Am J Physiol Cell Physiol, November 1, 2007; 293(5): C1445 - C1454.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. R. Broughman, L. Sun, S. Umar, J. Scott, J. H. Sellin, and A. P. Morris
Chronic PKC-beta activation in HT-29 Cl.19a colonocytes prevents cAMP-mediated ion secretion by inhibiting apical membrane current generation
Am J Physiol Gastrointest Liver Physiol, August 1, 2006; 291(2): G318 - G330.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
P. Plaisancie, R. Ducroc, M. E. Homsi, A. Tsocas, S. Guilmeau, S. Zoghbi, O. Thibaudeau, and A. Bado
Luminal leptin activates mucin-secreting goblet cells in the large bowel
Am J Physiol Gastrointest Liver Physiol, April 1, 2006; 290(4): G805 - G812.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
Y. Zen, K. Harada, M. Sasaki, K. Tsuneyama, K. Katayanagi, Y. Yamamoto, and Y. Nakanuma
Lipopolysaccharide Induces Overexpression of MUC2 and MUC5AC in Cultured Biliary Epithelial Cells : Possible Key Phenomenon of Hepatolithiasis
Am. J. Pathol., October 1, 2002; 161(4): 1475 - 1484.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
J. C. Braz, O. F. Bueno, L. J. De Windt, and J. D. Molkentin
PKC{alpha} regulates the hypertrophic growth of cardiomyocytes through extracellular signal-regulated kinase1/2 (ERK1/2)
J. Cell Biol., March 4, 2002; (2002) 200108062.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
K. B. Adler and Y. Li
Airway Epithelium and Mucus . Intracellular Signaling Pathways for Gene Expression and Secretion
Am. J. Respir. Cell Mol. Biol., October 1, 2001; 25(4): 397 - 400.
[Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
B. Deplancke and H R. Gaskins
Microbial modulation of innate defense: goblet cells and the intestinal mucus layer
Am. J. Clinical Nutrition, June 1, 2001; 73 (6): 1131S - 1141S.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Perrais, P. Pigny, M.-P. Buisine, N. Porchet, J.-P. Aubert, and I. Van Seuningen-Lempire
Aberrant Expression of Human Mucin Gene MUC5B in Gastric Carcinoma and Cancer Cells. IDENTIFICATION AND REGULATION OF A DISTAL PROMOTER
J. Biol. Chem., April 27, 2001; 276(18): 15386 - 15396.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
J. C. Braz, O. F. Bueno, L. J. De Windt, and J. D. Molkentin
PKC{alpha} regulates the hypertrophic growth of cardiomyocytes through extracellular signal-regulated kinase1/2 (ERK1/2)
J. Cell Biol., March 4, 2002; 156(5): 905 - 919.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hong, D.-H.
Right arrow Articles by Forstner, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hong, D.-H.
Right arrow Articles by Forstner, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online