|
|
||||||||
1 Department of Internal
Medicine, Biliary cirrhosis
in the rat triggers intrapulmonary vasodilatation and gas exchange
abnormalities that characterize the hepatopulmonary syndrome. This
vasodilatation correlates with increased levels of pulmonary
microcirculatory endothelial nitric oxide synthase (eNOS) and hepatic
and plasma endothelin-1 (ET-1). Prehepatic portal hypertension induced
by portal vein ligation (PVL) does not cause similar changes,
suggesting that ET-1 in cirrhosis may modulate pulmonary eNOS and
vascular tone. We assessed whether ET-1 altered eNOS expression and
nitric oxide production in bovine pulmonary artery endothelial cells
(BPAECs) and if a 2-wk low-level intravenous ET-1 infusion in PVL
animals modulated pulmonary eNOS levels, microcirculatory tone, and gas
exchange. ET-1 caused a 2.5-fold increase in eNOS protein in BPAECs,
inhibitable with an endothelin B receptor antagonist, and an increase
in eNOS mRNA and nitrite production. ET-1 infusion in PVL animals
caused increased pulmonary eNOS levels, intrapulmonary vasodilatation,
and gas exchange abnormalities without increasing pulmonary arterial
pressure. ET-1 produced during hepatic injury may contribute to the
hepatopulmonary syndrome by modulating eNOS and inducing pulmonary
microcicrulatory vasodilatation.
endothelium; vasorelaxation; pulmonary; cirrhosis; expression
DYSREGULATION OF the vascular endothelium plays a
fundamental role in a number of cardiovascular diseases (39) and in the altered vascular tone associated with cirrhosis and portal hypertension (37). An imbalance in the local production and/or activity of potent
vasoactive agents, including nitric oxide (NO) and endothelin-1 (ET-1),
in the vessel wall is thought to underlie endothelial dysfunction and
contribute to changes in vascular tone (8, 15, 28, 38). In models of
chronic liver disease, splanchnic vasodilatation is accompanied by
elevated endothelial nitric oxide synthase (eNOS) levels (28) and
enhanced NO activity (30), although the stimuli responsible for
increasing nitric oxide synthase (NOS) expression and NO production
remain controversial (37). Plasma ET-1 levels are also increased in
some forms of experimental and human cirrhosis and are postulated to
result from enhanced production in the damaged liver (3, 25, 26, 29,
31). ET-1 is a potent vasoconstrictor when acting through the
ETA receptor on the vascular
smooth muscle cells, although elevated levels in cirrhosis occur in the
setting of systemic vasodilatation and are not associated with
measurable vasoconstrictive effects (25). These observations suggest
that the effects mediated by ET-1 in chronic liver disease may include
stimulation of NOS activity through the
ETB receptor on endothelial cells
(17) or modulation of vasoactive peptide expression (4, 5).
The hepatopulmonary syndrome (HPS) is one well- recognized complication
of chronic liver disease that occurs in the setting of cirrhosis with
portal hypertension. It is characterized by intrapulmonary
vasodilatation, which results in altered arterial oxygenation
independent of intrinsic cardiopulmonary disease (23). In previous
studies, we have established chronic common bile duct ligation (CBDL)
in the rat as a model of HPS in which intrapulmonary vasodilatation
occurs in the setting of hepatic injury and portal hypertension (11).
In contrast, portal hypertension induced by partial portal vein
ligation (PVL) does not cause hepatic injury or HPS, suggesting that
portal hypertension alone may be a necessary but insufficient factor in
the development of HPS. In CBDL animals, the degree of intrapulmonary
vasodilatation and gas exchange abnormalities correlate with a
progressive increase in pulmonary vascular eNOS protein levels and
enhanced production and activity of NO in intralobar pulmonary rings
(10). Recently, we have also observed a progressive increase in hepatic
production and plasma levels of ET-1 after CBDL in the absence of
altered pulmonary ET-1 levels, which correlate with pulmonary eNOS
alterations and gas exchange abnormalities (26). These studies suggest
that enhanced ET-1 production during chronic hepatic injury may alter
pulmonary eNOS production and contribute to the onset of intrapulmonary
vasodilatation in experimental HPS.
In the present study, we test the hypothesis that low levels of
circulating ET-1, arising during chronic hepatic injury, induce pulmonary eNOS expression and increased NO production and contribute to
the development of intrapulmonary vasodilatation and HPS. Bovine pulmonary artery endothelial cells (BPAECs) are used to assess whether
ET-1 administration can trigger eNOS expression and enhanced NO
production in vitro and to assess the receptor specificity of the
effect. Chronic low-dose intravenous infusion of ET-1 is administered
to PVL animals to determine if ET-1 exposure, in the presence of portal
hypertension alone, results in increased pulmonary eNOS levels,
intrapulmonary vasodilatation, and arterial gas exchange abnormalities
consistent with the development of HPS.
Animal models.
PVL was performed as previously described (7) using male Sprague-Dawley
rats (Charles River, Wilmington, MA) weighing 200-250 g. At the
time of surgery, a miniosmotic pump (ALZET Model 2002, ALZA, Palo Alto,
CA) was inserted into the femoral vein. Rats were infused with 3 ng · 200 g body
wt Microsphere protocol.
Size assessment of the pulmonary microcirculation was performed as
previously described in awake unsedated animals (11). Forty-eight hours
before microsphere injection, animals underwent the placement of
indwelling PE-50 femoral arterial and venous catheters. On the day of
measurement, 45 min after arterial blood gas determination, 2.5 × 10 custom mixed and counted cross-linked polystyrene-divinylbenzene
microspheres labeled red (size range 6.5-10 µm; Interactive
Medical Technologies, Los Angeles, CA) in 0.20 ml of sterile PBS were
injected over 2-4 s through the femoral vein catheter, which was
immediately flushed with 0.2 ml of sterile PBS over 2-4 s. An
aliquot of microspheres was removed from the injection syringe
immediately before injection and counted to verify the numbers and
sizes of microspheres injected. A reference blood sample was withdrawn
from the femoral arterial catheter beginning at the time of femoral
vein injection for a total of 90 s at a constant rate of 1.0 ml/min.
The volume removed was replaced with an equal volume of sterile PBS.
Microsphere counting/intrapulmonary shunt calculations.
Samples of beads before venous injection and reference blood samples
were coded, and counting suspensions were prepared using the E-Z Trac
method as outlined by the manufacturer. Numbers and sizes of
microspheres in each sample were assessed using a Leica DMRE microscope (Wetzlar, Germany) with a color video
imaging system combined with image analysis software (Pro 3.0 Media
Cybernetics, Silver Spring, MD) with area, shape factor, and aspect
ratios set to distinguish microsphere sizes. Total numbers of
microspheres passing through the pulmonary microcirculation were
calculated as reference blood sample microspheres per milliliter times
estimated blood volume. Blood volume of each animal was derived from
the following formula: blood volume (ml) = 0.06 × body wt (g) + 0.77 (see Ref. 24). Intrapulmonary shunting was calculated as an intrapulmonary shunt fraction (%) = (total number of microspheres passing through the pulmonary microcirculation/total beads injected into the venous circulation) × 100.
Cell culture.
BPAECs [American Type Culture Collection (ATCC), Manassas,
VA] were maintained and passaged in EGM-MV complete
media (Clonetics, San Diego, CA) at 37°C with 5%
CO2 on 100-mm Falcon cell culture dishes (Becton Dickinson Labware, Lincoln Park, NJ), and cells of
passages 3-10 were used in the
study. When cells reached 70% confluence, they were incubated in 4 ml
of minimal media containing 0.5% FBS without supplements and
stimulated by ET-1 at various concentrations (0.01, 0.1, and 1 µM)
for various times (12, 24, and 48 h). In a set of experiments,
endothelin receptor antagonists including TBC3214Na for
ETA (kind gift from Dr. Y. F. Chen, University of Alabama at Birmingham), BQ-788 for
ETB (Peptides International, Louisville, KY), or Bosentan for
ETA and
ETB (Roche, Basel, Switzerland) were applied at 10 µM to cells in the presence or absence of ET-1 treatment. To assess cell proliferation, cells were incubated on a
96-well plate (Nalge Nunc, Naperville, IL) at 2,000 cells/well in
minimal media containing 0.5% FBS in the presence or absence of 0.1 µM ET-1 for 12, 24, and 48 h. A standard curve was constructed by
using a defined cell number in the assay. At each time point, 20 µl
of freshly made MTS/phenazine methosulfate (PMS) mixture (10:1 vol/vol,
Promega, Madison, WI) was added into each well containing 100 µl of
media and was incubated at 37°C in a humidified 5%
CO2 atmosphere for 1 h. After the
absorbance at 490 nm was recorded using an ELISA microplate reader
(Molecular Devices, Sunnyvale, CA), cell number was calculated
according to the standard curve.
Western blot analysis.
BPAECs or lung tissue was prepared by lysis or Dounce homogenization
respectively in radioimmunoprecipitation buffer (10) in the presence of
protease inhibitors. Fifteen micrograms of protein from homogenates,
quantified by protein assay (Bio-Rad, Hercules, CA), were fractionated
on a 7.5% SDS-PAGE gel and then transferred to a Hybond enhanced
chemiluminescence nitrocellulose membrane (Amersham, Arlington Heights,
IL). Incubation with an eNOS monoclonal antibody (Transduction
Laboratories, Lexington, KY) was followed by extensive washing and
incubation with a horseradish peroxidase-conjugated sheep anti-mouse
secondary antibody (Amersham) and development by enhanced
chemiluminescence (Amersham) on Kodak X-ray film (Sigma, St. Louis, MO).
Northern blot analysis.
Total RNA from BPAECs was prepared by lysis in TRIzol reagent on the
basis of a standard protocol (GIBCO, Grand Island, NY). RNA (20 µg) was subjected to agarose gel electrophoresis and blotted onto a Nytran membrane (Schleicher & Schuell, Keene, NH) as described (26), followed by a quick hybridization procedure (Stratagene, La
Jolla, CA) with a 4.0-kb bovine eNOS cDNA probe (kind gift of Dr.
William Sessa, Yale University) or a 0.5-kb rat
glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA (ATCC) labeled
with the Prime-a-Gene labeling system (Promega). Blots were then
exposed to Kodak X-ray film.
RT-PCR.
First strand cDNA was synthesized from 2 µg of total RNA of BPAECs by
oligo(dT) primer using the SuperScript preamplification system (GIBCO)
and then subjected to subsequent PCR analysis. PCR was carried out
using appropriate primers in 50 µl of buffer containing 0.2 mM each
dNTP, 3.0 mM MgCl2, 0.5 µM each
primer, and 2.5 U/100 µl recombinant
Taq DNA polymerase (GIBCO) using 25 amplification cycles of 94°C for 30 s, 55°C for 30 s, and
72°C for 1 min in a Perkin-Elmer 2400 PCR machine (Foster City,
CA). The reaction mixture was then resolved by agarose gel
electrophoresis. PCR primers for detecting eNOS mRNA were designed
based on the published eNOS cDNA sequence to yield a ~380-bp DNA
fragment (20) and were also used in subsequent sequence analysis. The
5' primer was AGTAACACAGACAGTGCAGGG, and the 3' primer was
GTAGCCTGGAACATCTTCCG. Primers for detecting NO detection assay.
Aliquots of media (150 µl) from BPAEC culture in the presence or
absence of 0.1 µM ET-1 for 0, 12, and 24 h were incubated with 10 µl of Escherichia coli nitrate
reductase preparation (no. 25922, ATCC) at 37°C for 1 h to convert
NO Densitomertry and statistics.
The density of autoradiographic signals was quantitated with a GS-670
imaging densitometer (Bio-Rad) and expressed as multiples of control in
which the density was designated as onefold in control experimental
group. Data were analyzed using Student's
t-test or ANOVA with Bonferroni
correction for multiple comparisons between groups. All measurements
are expressed as means ± SE. Statistical significance was
designated as P < 0.05 unless
otherwise indicated.
ET-1 increases eNOS protein levels in BPAECs.
To determine if ET-1 can induce eNOS protein expression, BPAECs were
treated with synthetic ET-1 peptide in a minimal medium containing
0.5% FBS in the absence of other growth factor supplements. A
progressive dose- and time-dependent increase in eNOS protein (140 kDa)
levels was observed by Western blotting after ET-1 stimulation. The
maximal increase occurred at 24 h after the addition of 0.1 µM ET-1 (Fig. 1,
A and
B) and represented a significant
2.5-fold increase in eNOS protein production (Fig.
1C).
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES
1 · h
1
of synthetic ET-1 peptide (Peninsula Laboratories, Belmont, CA) or
0.9% saline for 2 wk based on the hepatic venous and plasma ET-1 concentration previously observed in 2-wk CBDL animals (26) and on
pilot studies. In pilot studies, the acute effects of ET-1 infusion
using 3 ng · 200 g body
wt
1 · h
1
was compared with an infusion of 30 ng · 200 g body
wt
1 · h
1.
The lower dose resulted in a mild transient hypotensive effect as
previously seen using physiological doses of ET-1, and the higher dose
resulted in well-described vasoconstriction (21). ET-1 delivery was
monitored by ensuring that the pump was empty and the delivery catheter
was positioned in the femoral vein at the termination of the
experiment. The stability of ET-1 in miniosmotic pumps over 2 wk was
documented by placing a known concentration of ET-1 in four miniosmotic
pumps under sterile conditions and incubating these pumps for 2 wk at
37°C. Subsequent RIA for ET-1 revealed a concentration of ET-1 in
the pumps within 10-15% of initial values. The development of
portal hypertension was confirmed by portal pressure and spleen weight
measurements. Arterial gas exchange was evaluated as described by
arterial blood gas analysis (11), and the alveolar-arterial oxygen
gradient was calculated as
150
(PCO2/0.8)
PO2.
Lung tissue was collected after perfusion with PBS for histology and
eNOS detection by Western blot analysis (10). Mean pulmonary arterial
pressure was measured by insertion of an indwelling pulmonary arterial
catheter, and mean systemic arterial pressure was measured by insertion
of an indwelling femoral arterial catheter both placed 48 h before
death as previously described (9). Pressure measurements were made at
rest on the day of death. Five to six animals were used in each group.
The study was approved by the Institutional Animal Care and Use
Committee of the University of Alabama at Birmingham and conforms to
the National Institutes of Health Guidelines for the
Care and Use of Laboratory Animals.
-actin message were used
as an internal control to amplify a ~400-bp DNA fragment. The
5' primer was GACCTGACAGACTACCTCAT, and the 3' primer was
AGACAGCACTGTGTTGGCAT. Where indicated, PCR products were sequenced
using an ABI PRISM Model 377 automated sequencer (University of Alabama
at Birmingham Sequencing Facility).
3 in samples to
NO
2, followed by centrifugation at
15,000 g for 5 min. Supernatants (150 µl) were then analyzed by the Greiss reaction (14) in 75 µl of 1%
sulfanilamide and 7 µl of naphthylethylene-diamine
dihydrochloride at room temperature for 10 min. The absorbance at 550 nm was measured using an ELISA microplate reader, and net NO production
was calculated according to a standard curve prepared by using
NaNO3 ranging from 0 to 100 µM
in culture media.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (15K):
[in a new window]
Fig. 1.
Endothelin (ET)-1 induction of endothelial nitric oxide synthase (eNOS)
protein levels in bovine pulmonary artery endothlial cells (BPAECs).
BPAECs (70% confluent) were treated with ET-1 peptide of varying doses
and for various times and then lysed in radioimmunoprecipitation (RIPA)
buffer. Equal amounts of lysates were resolved on 7.5% SDS-PAGE gels
and transferred to Hybond ECL membranes. eNOS was detected with a
monoclonal antibody and visualized by enhanced chemiluminescence (ECL).
A: BPAECs stimulated with 0.1 µM
ET-1 for 0, 12, 24, or 48 h demonstrated an increase in eNOS protein
levels. B: BPAECs stimulated with ET-1
at 0, 0.01, 0.1, or 1 µM for 24 h demonstrated a dose-dependent
increase in eNOS protein levels. C:
summary of BPAEC stimulation for 24 h in presence and absence of 0.1 µM ET-1 (n = 5 plates for each
group). eNOS protein was quantitated by desitometry, and values are
expressed as means ± SE. Mean for non-ET-1-treated cells was
arbitrarily set at 1. * P < 0.05.
ET-1-mediated effects on eNOS protein are mediated through the
ETB receptor in BPAECs.
The effects of ET-1 on vascular tone are mediated through two distinct
receptors, the ETA receptor and
the ETB receptor, which differ in
their tissue and cell-type specificity (19). The
ETB receptor predominates on
endothelial cells. To determine the role of ET receptors in
ET-1-mediated alterations in eNOS protein levels, BPAECs were
stimulated with 0.1 µM ET-1 for 24 h and eNOS protein levels were
assessed in the presence or absence of ET receptor antagonists (Fig.
2). The eNOS protein levels in these cells
were compared with control levels in untreated BPAECs, which were
arbitrarily set at one. The addition of ET receptor antagonists alone,
including TBC3214Na, a selective
ETA receptor antagonist (1.0 ± 0.2-fold control), BQ-788, a selective
ETB receptor antagonist (1.2 ± 0.06-fold control), and Bosentan, a mixed
ETA and
ETB receptor antagonist (1.1 ± 0.2-fold control), had no significant effect on eNOS protein levels
(n = 4 in each group and in subsequent
receptor antagonist studies; differences were not significant for each
group relative to untreated controls). The addition of the
ETA receptor antagonist did not
inhibit the ET-1-mediated increase in eNOS protein (2.3 ± 0.2-fold
control; P < 0.05 relative to
control untreated cells), which was similar to that seen in control
BPAECs treated with ET-1 alone. In contrast, the ET-1-mediated
increase in eNOS protein was abolished and was significantly
different from ETA receptor antagonist-treated cells when the
ETB receptor antagonist (1.03 ± 0.3-fold control) or Bosentan (1.03 ± 0.04-fold control) was added to the culture medium (P < 0.05 relative to ETA receptor antagonist-treated cells). These findings indicate that ET-1-mediated changes in eNOS protein levels are mediated through the
ETB receptor on BPAECs.
|
ET-1 upregulates eNOS mRNA in BPAECs.
To further evaluate the mechanism of the ET-1-mediated increase in eNOS
protein, we measured steady-state eNOS mRNA levels by Northern blotting
in BPAECs after ET-1 exposure (Fig.
3A). The
eNOS mRNA levels normalized to GAPDH levels after ET-1 exposure were
compared with control levels in untreated BPAECs incubated for the same
time as treated cells and arbitrarily set at 1 (n = 4 for each group). There was an
increase in the ~5.0-kb eNOS signal (2) that was statistically
significant within 12 h of 0.1 µM ET-1 stimulation (2.3 ± 0.6-fold control) and was maximal by 24 h (3.6 ± 1.2-fold control).
The increase was maintained at 48 h (2.9 ± 0.6-fold control). No
change in the GAPDH control signal was observed on these blots. The
ET-1-mediated increase in eNOS mRNA was confirmed by RT-PCR analysis
using eNOS-specific primers. An increase in a ~380-bp fragment
amplified with eNOS primers, but not an
-actin control message, was
observed after ET-1 stimulation (Fig.
3B). The ~380-bp PCR product was
confirmed to be eNOS by direct sequencing and comparison with the
published eNOS sequence (data not shown) (20). The temporal association between the increase in eNOS mRNA and protein levels after ET-1 exposure is consistent with the hypothesis that ET-1 alters eNOS expression in endothelial cells.
|
ET-1 stimulates NO production in BPAECs.
To confirm that ET-1 stimulation of BPAECs and the subsequent increase
in eNOS protein levels result in enhanced NO production, we measured NO
levels in BPAEC culture media in the presence and absence of exogenous
ET-1. ET-1 administration (0.1 µM) significantly stimulated net NO
production (2.8-fold) from cells after 24 h (Fig.
4), as has been previously observed (17).
The maximal increase in culture medium NO levels correlated temporally
with increased eNOS levels in BPAECs, suggesting that enhanced eNOS expression may contribute to increased NO production.
|
ET-1 does not induce BPAEC proliferation over 24 h.
To exclude the possibility that the mitogenic properties of ET-1 caused
BPAEC proliferation and resulted in increased eNOS mRNA and protein
levels over the time course studied here, we measured BPAEC
proliferation by the MTS/PMS assay in the presence and absence of
exogenous ET-1. Cells incubated as above and not exposed to ET-1 were
compared with cells exposed to 0.1 µM ET-1 for 12, 24, and 48 h. Cell
number was measured at each time point. There was no significant
difference in cell number after 24 h between exposed and unexposed
cells (Fig. 5). After 48 h, ET-1 treatment
resulted in a modest increase in cell number, though the magnitude of
the increase relative to untreated cells at 48 h (1.2-fold untreated)
was substantially less than the increase in eNOS mRNA and protein
levels over the same time frame. These results demonstrate that the
increase in eNOS levels in BPAECs after ET-1 stimulation cannot be
explained by enhancement of cell proliferation over the time frame
studied here.
|
Chronic intravenous ET-1 administration increases lung eNOS levels,
results in intrapulmonary shunting, and impairs gas exchange after PVL.
To determine if ET-1 contributes to the development of HPS, we
delivered an ET-1 or saline infusion through the femoral vein over 2 wk
via a miniosmotic pump in PVL animals. Liver and lung histology, portal
vein pressure, mean systemic and pulmonary arterial blood pressure,
lung eNOS levels, microsphere assessment of the pulmonary
microcirculation, and arterial gas exchange were evaluated. Pressure
measurements and arterial blood gas results are summarized in Table
1. All animals developed significant portal
hypertension compared with values previously observed in normal rats
(11), and the degree of portal hypertension at 2 wk was not different in saline- and ET-1-treated animals. Serum aspartate aminotransferase and total bilirubin levels and hepatic histology were also normal in
the saline and ET-1 groups (data not shown), suggesting that low-dose
ET-1 infusion had no measurable effects on the liver. Mean systemic
arterial pressures were similar in saline- and ET-1-treated animals and
were lower than values we have observed in normal animals (9),
reflecting the development of a hyperdynamic state as previously
described after PVL (36). Mean pulmonary arterial pressures were also
similar in both groups and remained within the range observed in normal
animals (9), demonstrating that the doses of exogenous ET-1
administered here had no significant vasoconstrictive effect in the
lung.
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Reciprocal paracrine and autocrine interactions between ET-1 and NO are important in mediating endothelium-dependent regulation of vascular tone (8, 15, 38, 39). An imbalance in these mediators has been implicated in the pathogenesis of several vascular disorders (13, 18, 39). The present study extends this concept on the basis of our previous observations, which suggest a pathogenetic association between elevated circulating ET-1 levels, increased pulmonary vascular eNOS levels, and functional alterations in the pulmonary vasculature in an animal model of HPS (26). In the present study, we document that administration of ET-1 stimulates increased eNOS protein and mRNA levels in BPAECs through an ETB receptor-mediated effect, which correlates with increased NO production in these cells. In addition, chronic low-dose intravenous infusion of ET-1 in PVL animals triggers an increase in lung eNOS levels, alterations in the pulmonary microcirculation, and an impairment in arterial gas exchange similar to that observed in animals with HPS, without increasing pulmonary arterial pressure. These studies provide direct evidence that circulating ET-1 may increase eNOS production in endothelial cells and contribute to the pathogenesis of HPS.
We and others have demonstrated that hepatic production of ET-1 increases after CBDL (26, 34) and likely results in release into the venous system with circulation to the pulmonary vasculature. The increase in circulating ET-1 correlates with increased eNOS levels, enhanced NO activity, and gas exchange abnormalities in the lung in these animals that develop HPS (26) and implies that ET-1 may contribute to the development of pulmonary abnormalities. Our in vitro studies demonstrate the novel observation that exposure to ET-1 does increase eNOS mRNA and protein levels in BPAECs in a dose- and time-dependent fashion, supporting a role for ET-1 in altering eNOS expression. This effect occurs through the ETB receptor. Although the molecular mechanism through which ET-1 alters eNOS production remains under study, the hypothesis that ET-1 alters eNOS expression in the pulmonary vasculature is consistent with the observation that ET-1 can alter vasoactive mediator expression in other cell types (4, 5) and with the finding that a variety of agents are now known to influence the expression of the eNOS gene (6, 16, 22, 32). The potential physiological significance of this effect is highlighted by our in vivo observation that chronic low-dose intravenous ET-1 infusion also increases pulmonary eNOS levels and is associated with vascular and gas exchange abnormalities in the lung.
ET-1 has potent vasoconstrictive properties when released from vascular endothelial cells and targeted to the ETA receptor on vascular smooth muscle cells or when administered intravenously in pharmacological doses (35). However, this effect is not observed when doses closer to levels found in vivo are administered (21). The ET-1 peptide also exerts an autocrine vasodilatory effect by increasing eNOS activity through the ETB receptor on vascular endothelial cells (17) and alters the gene expression of other vasoactive peptides in smooth muscle cells (4, 5). Liver injury with portal hypertension appears to represent a unique pathological situation where elevated circulating ET-1 levels (3, 26, 29), derived from increased hepatic production (26, 31, 34), occur in the setting of systemic vasodilatation. In this situation, systemic vascular tone is not altered by the addition of ET receptor antagonists (25), suggesting that ET-1 production does not simply reflect a response to vasodilatation. Our in vivo findings demonstrate that low-dose intravenous ET-1 infusion in the setting of portal hypertension does not significantly alter systemic or pulmonary arterial pressure, confirming that vasoconstrictive effects of ET-1 are not detectable. The attenuated vasoconstrictive effect of circulating ET-1 in portal hypertension is unexplained but may be contributed to by the relatively low circulating levels observed, which are generally below levels associated with significant vasoconstriction (27). Alternatively, flow-mediated changes in ET receptor expression in the vasculature (33) or alterations in the levels of other vasoactive substances observed during the development of the hyperdynamic circulation of portal hypertension could influence the effects of ET-1 on the vasculature. Our studies also do not support that circulating ET-1 contributes to the development or maintenance of systemic vasodilatation in portal hypertension, as saline- and ET-1-treated PVL animals develop a similar degree of systemic hypotension. Thus ET-1 appears to exert a selective vasodilatory effect in the pulmonary vasculature in our system.
The observation that low levels of circulating ET-1 may have a localized effect in the pulmonary vasculature that alters eNOS levels and influences the pulmonary microcirculation is perhaps not unexpected. ET-1 released into the circulation during hepatic injury or infused intravenously will first encounter the pulmonary vasculature. In addition, significant clearance of ET-1 from the circulation occurs in the lung, in large part through an ETB receptor-mediated effect (12). Thus ET-1 may influence pulmonary vascular NO production by increasing eNOS levels and by increasing eNOS enzyme activity, effects that are each mediated through the ETB receptor. Our in vitro and in vivo studies support this concept. However, we cannot be certain that eNOS is not also produced in cell types other than endothelial cells in the vascular wall or may increase in cell types outside the vasculature in the lung. In addition, we have not completely excluded that other forms of nitric oxide synthase may be contributing to changes in pulmonary vascular tone, although we have not found detectable levels of iNOS in the lung in the present studies. Finally, the increase in lung eNOS levels observed after ET-1 infusion is less than that observed in CBDL animals despite the development of a similar degree of vasodilatation and gas exchange abnormalities. This observation suggests that ET-1 may also contribute to intrapulmonary vasodilatation through effects distinct from nitric oxide production in the pulmonary vasculature.
In humans and animals the presence of portal hypertension appears to be required for the development of HPS. Thus we designed our in vivo studies to administer low-dose intravenous ET-1 to animals that normally develop portal hypertension in the absence of pulmonary vascular or hepatic changes to provide a direct means of analyzing whether ET-1 triggers changes in the pulmonary microcirculation in the setting of portal hypertension. We have evaluated the effects of chronic intravenous ET-1 infusion on the liver as well as the lung in PVL animals and have observed no effect on portal venous pressure, liver tests, or hepatic histology. These results confirm a lack of measurable effects of exogenous low-level ET-1 infusion in the liver in PVL animals. Our findings in the lung are consistent with the concept that chronic ET-1 infusion, in the setting of portal hypertension, causes intrapulmonary vasodilatation. Studies evaluating ET-1 infusion in normal animals will define whether portal hypertension is required for ET-1 to alter pulmonary microvascular tone.
Our microsphere assessment of the pulmonary microcirculation provides a direct assessment of small vessel tone and intrapulmonary shunting in unsedated animals. The technique is an adaptation of methods used to evaluate intrapulmonary shunting in humans with HPS (1) and portosystemic shunting in anesthetized rats (7) and has been previously employed in PVL animals (11). Results in our saline-treated PVL animals in the present study are similar to those observed in PVL animals previously (11), confirming the reproducibility of this technique. Our ET-1-treated animals shunted significantly more and larger microspheres across pulmonary microcirculation, similar to changes previously observed in CBDL animals with HPS (11). One limitation of this technique is the inability to discriminate between intrapulmonary and intracardiac shunting of microspheres. Thus if ET-1 infusion resulted in a significant selective increase in pulmonary arterial pressures, a gradient for right-to-left intracardiac shunting of microspheres through potential intracardiac septal defects could be created. We did not observe a significant rise in pulmonary arterial pressures in ET-1-treated PVL animals and could find no gross anatomical evidence for the presence of intracardiac septal defects in previous studies (11) or in our present animals.
Our current findings, in conjunction with previous observations, suggest that increased ET-1 production found during certain forms of hepatic injury may stimulate pulmonary vascular eNOS expression and activity and contribute to the pathogenesis of HPS. In vitro studies demonstrate that this effect may be mediated through the ETB receptor on pulmonary vascular endothelial cells. Together, these observations provide a novel pathogenetic mechanism for the development of HPS. In addition, they provide a direction for future investigation in humans and imply that unique therapeutic approaches focused on inhibiting the pulmonary vascular ETB receptor or on modulating hepatic ET-1 production may provide useful medical therapies for this disorder.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by a Merit Award from the Department of Veterans Affairs (M. B. Fallon) and a Grant In Aid from the Alabama affiliate of the American Heart Association (M. B. Fallon).
| |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: M. B. Fallon, Univ. of Alabama at Birmingham, 410 LHRB, 701 South 19th St., Birmingham, AL 35294-0007 (E-mail: mfallon{at}uab.edu).
Received 25 February 1999; accepted in final form 26 July 1999.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abrams, G. A.,
C. C. Jaffe,
P. B. Hoffer,
H. J. Binder,
and
M. B. Fallon.
Diagnostic utility of contrast echocardiography and lung perfusion scan in patients with hepatopulmonary syndrome.
Gastroenterology
109:
1283-1288,
1995[Medline].
2.
Arnai, J.,
J. Yamin,
S. Dockery,
and
D. Harrison.
Regulation of endothelial nitric oxide synthase mRNA, protein and activity during cell growth.
Am. J. Physiol.
207 (Cell Physiol. 0):
C1381-C1388,
1994.
3.
Asbert, M.,
A. Gines,
P. Gines,
W. Jimenez,
J. Claria,
J. Salo,
V. Arroyo,
F. Rivera,
and
J. Rodes.
Circulating levels of endothelin in cirrhosis.
Gastroenterology
104:
1485-1491,
1993[Medline].
4.
Bezie, Y.,
L. Mesnard,
D. Longrois,
F. Samson,
C. Perret,
J. J. Mercadier,
and
S. Laurent.
Interactions between endothelin-1 and atrial natriuretic peptide influence cultured chick cardiac myocyte.
Eur. J. Pharmacol.
311:
241-248,
1996[Medline].
5.
Bruneau, B. G.,
and
A. J. de Bold.
Selective changes in natriuretic peptide and early response gene expression in isolated rat atria following stimulation by stretch or endothelin-1.
Cardiovasc. Res.
28:
1519-1525,
1994[Medline].
6.
Bucher, M.,
K. Ittner,
M. Zimmermann,
K. Wolf,
J. Hobbhahn,
and
A. Kurtz.
Nitric oxide synthase isoform III gene expression in rat liver is up-regulated by lipopolysaccharide and lipoteichoic acid.
FEBS Lett.
412:
511-514,
1997[Medline].
7.
Chojkier, M.,
and
R. J. Groszmann.
Measurement of portal systemic shunting using gamma-labeled microspheres.
Am. J. Physiol.
240 (Gastrointest. Liver Physiol. 3):
G371-G375,
1981
8.
Clement, M.,
and
M. Albertini.
Differential release of prostacyclin and nitric oxide evoked from pulmonary and systemic vascular beds of the pig by endothelin-1.
Prostaglandins Leukot. Essent. Fatty Acids
55:
279-285,
1990.
9.
Fallon, M.,
G. Abrams,
T. Abdel-Razek,
J. Dai,
S. Chen,
Y. Chen,
B. Luo,
S. Oparil,
and
D. Ku.
Garlic prevents hypoxic pulmonary hypertension in rats.
Am. J. Physiol.
275 (Lung Cell. Mol. Physiol. 19):
L283-L287,
1998
10.
Fallon, M. B.,
G. A. Abrams,
B. Luo,
Z. Hou,
J. Dai,
and
D. D. Ku.
The role of endothelial nitric oxide synthase in the pathogenesis of a rat model of hepatopulmonary syndrome.
Gastroenterology
113:
606-614,
1997[Medline].
11.
Fallon, M. B.,
G. A. Abrams,
J. W. McGrath,
Z. Hou,
and
B. Luo.
Common bile duct ligation in the rat: a model of intrapulmonary vasodilatation and the hepatopulmonary syndrome.
Am. J. Physiol.
272 (Gastrointest. Liver Physiol. 35):
G779-G784,
1997
12.
Fukuroda, T.,
T. Fujikawa,
S. Ozaki,
K. Ishikawa,
M. Yano,
and
M. Nishikibe.
Clearance of circulating endothelin-1 by ETB receptors in rats.
Biochem. Biophys. Res. Commun.
199:
1461-1465,
1994[Medline].
13.
Giaid, A.,
and
D. Saleh.
Reduced expression of endothelial nitric oxide synthase in the lungs of patients with pulmonary hypertension.
N. Engl. J. Med.
333:
214-221,
1995
14.
Green, L.,
D. Wagner,
J. Glogowski,
P. Skipper,
J. Wishnok,
and
S. Tannenbaum.
Analysis of nitrate, nitrite and [15N] nitrite in biological fluids.
Anal. Biochem.
120:
131-138,
1982.
15.
Haynes, W.,
and
D. Webb.
Contribution of endogenous generation of endothelin-1 to basal vascular tone.
Lancet
344:
852-854,
1994[Medline].
16.
Hennington, B.,
H. Zhang,
T. Miller,
J. Granger,
and
J. Reckelhoff.
Angiotensin II stimulates syntesis of endothelial nitric oxide synthase.
Hypertension.
31:
283-288,
1998
17.
Hirata, Y.,
T. Emori,
S. Eguchi,
K. Kanno,
T. Imai,
K. Ohta,
and
F. Marumo.
Endothelin receptor subtype B mediates synthesis of nitric oxide by cultured bovine endothelial cells.
J. Clin. Invest.
91:
1367-1371,
1993.
18.
Hirata, Y.,
H. Hayakawa,
E. Suzuki,
K. Kimura,
K. Kikuchi,
T. Nagano,
M. Hirobe,
and
M. Omata.
Direct measurements of endothelium-derived nitric oxide release by stimulation of endothelin receptors in rat kidney and its alteration in salt-induced hypertension.
Circulation
91:
1229-1235,
1995
19.
Huggins, J. P.,
J. T. Pelton,
and
R. C. Miller.
The structure and specificity of endothelin receptors: Their importance in physiology and medicine.
Pharmacol. Ther.
59:
55-123,
1993[Medline].
20.
Janssens, S.,
A. Shimoushi,
T. Quertermous,
D. Bolch,
and
K. Blach.
Cloning and expression of a cDNA encoding human endothelium-derived relaxing factor/nitric oxide synthase.
J. Biol. Chem.
207:
14519-14522,
1992.
21.
King, A. J.,
J. A. Pfeffer,
M. A. Pfeffer,
and
B. M. Brenner.
Systemic hemodynamic effects of endothelin in rats.
Am. J. Physiol.
258 (Heart Circ. Physiol. 27):
H787-H792,
1990
22.
Kleinert, H.,
T. Wallerath,
C. Euchenhofer,
I. Ihrig-Beidert,
H. Li,
and
U. Forstermann.
Estrogens increase transcription of the human endothelial NO synthase gene: analysis of transcription factors involved.
Hypertension
31:
582-588,
1998
23.
Lange, P. A.,
and
J. K. Stoller.
The hepatopulmonary syndrome.
Ann. Intern. Med.
122:
521-529,
1995
24.
Lee, H. B.,
and
M. D. Blaufox.
Blood volume in the rat.
J. Nucl. Med.
26:
72-76,
1985
25.
Leivas, A.,
W. Jimenez,
S. Lamas,
M. Bosch-Marce,
J. Oriola,
J. Claria,
V. Arroyo,
F. Rivera,
and
J. Rodes.
Endothelin 1 does not play a major role in the homeostasis of arterial pressure in cirrhotic rats with ascites.
Gastroenterology
108:
1842-1848,
1995[Medline].
26.
Luo, B.,
G. Abrams,
and
M. Fallon.
Endothelin-1 in the bile duct ligation model of hepatopulmonary syndrome: correlation with pulmonary dysfunction.
J. Hepatol.
29:
571-578,
1998[Medline].
27.
Mallat, A.,
and
S. Lotersztajn.
Multiple hepatic functions of endothelin-1: physiopathological relevance.
J. Hepatol.
25:
405-413,
1996[Medline].
28.
Martin, P.,
D. Li Xu,
M. Niederberger,
A. Weigert,
P. Tsai,
J. John,
and
R. Schrier.
Upregulation of endothelial constituitive NOS: a major role in the increased NO production in cirrhotic rats.
Am. J. Physiol.
270 (Renal Fluid Electrolyte Physiol. 39):
F494-F499,
1996
29.
Moore, K.,
J. Wendon,
M. Frazer,
J. Krani,
R. Williams,
and
K. Badr.
Plasma endothelin immunoreactivity in liver disease and the hepatorenal syndrome.
N. Engl. J. Med.
327:
1774-1777,
1992[Abstract].
30.
Niederberger, M.,
P. Martin,
P. Gines,
K. Morris,
P. Tsai,
D. L. Xu,
I. Mcmurtry,
and
R. Schrier.
Normalization of nitric oxide production corrects arterial vasodilatation and hyperdynamic circulation in cirrhotic rats.
Gastroenterology
109:
1624-1630,
1995[Medline].
31.
Pinzani, M.,
S. Milani,
R. DeFranco,
C. Grappone,
A. Caligiuri,
A. Gentilini,
C. Tosti-Guerra,
M. Maggi,
P. Failli,
C. Ruocco,
and
P. Gentilini.
Endothelin 1 is overexpressed in human cirrhotic liver and exerts multiple effects on activated hepatic stellate cells.
Gastroenterology
110:
534-548,
1996[Medline].
32.
Ramasamy, S.,
S. Parthasarathy,
and
D. Harrison.
Regulation of endothelial nitric oxide syntase gene expression by oxidized linoleic acid.
J. Lipid Res.
39:
268-276,
1998
33.
Redmond, E.,
P. Cahill,
and
J. Sitzmann.
Flow-mediated regulation of endothelin receptors in cocultured vascular smooth muscle cells: an endothelium-dependent effect.
J. Vasc. Res.
34:
425-435,
1997[Medline].
34.
Rockey, D.,
L. Fouassier,
J. Chung,
A. Carayon,
P. Vallee,
C. Rey,
and
C. Housset.
Cellular localization of endothelin-1 and increased production in liver injury in the rat: potential for autocrine and paracrine effects on stellate cells.
Hepatology
27:
472-480,
1998[Medline].
35.
Rubanyi, G. M.,
and
M. A. Polokoff.
Endothelins: molecular biology, biochemistry, pharmacology, physiology and pathophysiology.
Pharmacol. Rev.
46:
325-351,
1994[Medline].
36.
Sikuler, E.,
D. Kravetz,
and
R. J. Groszman.
Evolution of portal hypertension and mechanisms involved in its maintenance in a rat model.
Am. J. Physiol.
248 (Gastrointest. Liver Physiol. 11):
G618-G625,
1985
37.
Sogni, P.,
R. Moreau,
A. Gadano,
and
D. Lebrec.
The role of nitric oxide in the hyperdynamic circulatory syndrome associated with portal hypertension.
J. Hepatol.
23:
218-224,
1995[Medline].
38.
Vallance, P.,
J. Collier,
and
S. Moncada.
Effects of endothelium-derived nitric oxide on peripheral arteriolar tone in man.
Lancet
2:
997-1000,
1989[Medline].
This article has been cited by other articles:
![]() |
J. Zhang, Y. Ling, L. Tang, B. Luo, B. K. Chacko, R. P. Patel, and M. B. Fallon Pentoxifylline attenuation of experimental hepatopulmonary syndrome J Appl Physiol, March 1, 2007; 102(3): 949 - 955. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Herrera and J. L. Garvin A high-salt diet stimulates thick ascending limb eNOS expression by raising medullary osmolality and increasing release of endothelin-1 Am J Physiol Renal Physiol, January 1, 2005; 288(1): F58 - F64. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Herrera and J. L. Garvin Endothelin stimulates endothelial nitric oxide synthase expression in the thick ascending limb Am J Physiol Renal Physiol, August 1, 2004; 287(2): F231 - F235. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.T. Dinh-Xuan and R. Naeije The hepatopulmonary syndrome: NO way out? Eur. Respir. J., May 1, 2004; 23(5): 661 - 662. [Full Text] [PDF] |
||||
![]() |
B. Luo, L. Liu, L. Tang, J. Zhang, Y. Ling, and M. B. Fallon ET-1 and TNF-{alpha} in HPS: analysis in prehepatic portal hypertension and biliary and nonbiliary cirrhosis in rats Am J Physiol Gastrointest Liver Physiol, February 1, 2004; 286(2): G294 - G303. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Schultz, X. Su, C.-C. Wei, S. P. Bishop, P. Powell, G. H. Hankes, A. R. Dillon, P. Rynders, F. G. Spinale, G. Walcott, et al. Downregulation of ANG II receptor is associated with compensated pressure-overload hypertrophy in the young dog Am J Physiol Heart Circ Physiol, February 1, 2002; 282(2): H749 - H756. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Ivy, I. F. McMurtry, M. Yanagisawa, C. E. Gariepy, T. D. Le Cras, S. A. Gebb, K. G. Morris, R. C. Wiseman, and S. H. Abman Endothelin B receptor deficiency potentiates ET-1 and hypoxic pulmonary vasoconstriction Am J Physiol Lung Cell Mol Physiol, May 1, 2001; 280(5): L1040 - L1048. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. P. Carter, K. Sato, Y. Morio, and I. F. McMurtry Inhibition of KCa channels restores blunted hypoxic pulmonary vasoconstriction in rats with cirrhosis Am J Physiol Lung Cell Mol Physiol, November 1, 2000; 279(5): L903 - L910. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |