AJP - GI Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 277: G944-G952, 1999;
0193-1857/99 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, M.
Right arrow Articles by Fallon, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, M.
Right arrow Articles by Fallon, M. B.
Vol. 277, Issue 5, G944-G952, November 1999

Endothelin-1 stimulation of endothelial nitric oxide synthase in the pathogenesis of hepatopulmonary syndrome

Ming Zhang1, Bao Luo1, Shi-Juan Chen2, Gary A. Abrams1, and Michael B. Fallon1

1 Department of Internal Medicine, Liver Center, and 2 Vascular Biology and Hypertension Program, University of Alabama at Birmingham, Birmingham, Alabama 35294


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Biliary cirrhosis in the rat triggers intrapulmonary vasodilatation and gas exchange abnormalities that characterize the hepatopulmonary syndrome. This vasodilatation correlates with increased levels of pulmonary microcirculatory endothelial nitric oxide synthase (eNOS) and hepatic and plasma endothelin-1 (ET-1). Prehepatic portal hypertension induced by portal vein ligation (PVL) does not cause similar changes, suggesting that ET-1 in cirrhosis may modulate pulmonary eNOS and vascular tone. We assessed whether ET-1 altered eNOS expression and nitric oxide production in bovine pulmonary artery endothelial cells (BPAECs) and if a 2-wk low-level intravenous ET-1 infusion in PVL animals modulated pulmonary eNOS levels, microcirculatory tone, and gas exchange. ET-1 caused a 2.5-fold increase in eNOS protein in BPAECs, inhibitable with an endothelin B receptor antagonist, and an increase in eNOS mRNA and nitrite production. ET-1 infusion in PVL animals caused increased pulmonary eNOS levels, intrapulmonary vasodilatation, and gas exchange abnormalities without increasing pulmonary arterial pressure. ET-1 produced during hepatic injury may contribute to the hepatopulmonary syndrome by modulating eNOS and inducing pulmonary microcicrulatory vasodilatation.

endothelium; vasorelaxation; pulmonary; cirrhosis; expression


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

DYSREGULATION OF the vascular endothelium plays a fundamental role in a number of cardiovascular diseases (39) and in the altered vascular tone associated with cirrhosis and portal hypertension (37). An imbalance in the local production and/or activity of potent vasoactive agents, including nitric oxide (NO) and endothelin-1 (ET-1), in the vessel wall is thought to underlie endothelial dysfunction and contribute to changes in vascular tone (8, 15, 28, 38). In models of chronic liver disease, splanchnic vasodilatation is accompanied by elevated endothelial nitric oxide synthase (eNOS) levels (28) and enhanced NO activity (30), although the stimuli responsible for increasing nitric oxide synthase (NOS) expression and NO production remain controversial (37). Plasma ET-1 levels are also increased in some forms of experimental and human cirrhosis and are postulated to result from enhanced production in the damaged liver (3, 25, 26, 29, 31). ET-1 is a potent vasoconstrictor when acting through the ETA receptor on the vascular smooth muscle cells, although elevated levels in cirrhosis occur in the setting of systemic vasodilatation and are not associated with measurable vasoconstrictive effects (25). These observations suggest that the effects mediated by ET-1 in chronic liver disease may include stimulation of NOS activity through the ETB receptor on endothelial cells (17) or modulation of vasoactive peptide expression (4, 5).

The hepatopulmonary syndrome (HPS) is one well- recognized complication of chronic liver disease that occurs in the setting of cirrhosis with portal hypertension. It is characterized by intrapulmonary vasodilatation, which results in altered arterial oxygenation independent of intrinsic cardiopulmonary disease (23). In previous studies, we have established chronic common bile duct ligation (CBDL) in the rat as a model of HPS in which intrapulmonary vasodilatation occurs in the setting of hepatic injury and portal hypertension (11). In contrast, portal hypertension induced by partial portal vein ligation (PVL) does not cause hepatic injury or HPS, suggesting that portal hypertension alone may be a necessary but insufficient factor in the development of HPS. In CBDL animals, the degree of intrapulmonary vasodilatation and gas exchange abnormalities correlate with a progressive increase in pulmonary vascular eNOS protein levels and enhanced production and activity of NO in intralobar pulmonary rings (10). Recently, we have also observed a progressive increase in hepatic production and plasma levels of ET-1 after CBDL in the absence of altered pulmonary ET-1 levels, which correlate with pulmonary eNOS alterations and gas exchange abnormalities (26). These studies suggest that enhanced ET-1 production during chronic hepatic injury may alter pulmonary eNOS production and contribute to the onset of intrapulmonary vasodilatation in experimental HPS.

In the present study, we test the hypothesis that low levels of circulating ET-1, arising during chronic hepatic injury, induce pulmonary eNOS expression and increased NO production and contribute to the development of intrapulmonary vasodilatation and HPS. Bovine pulmonary artery endothelial cells (BPAECs) are used to assess whether ET-1 administration can trigger eNOS expression and enhanced NO production in vitro and to assess the receptor specificity of the effect. Chronic low-dose intravenous infusion of ET-1 is administered to PVL animals to determine if ET-1 exposure, in the presence of portal hypertension alone, results in increased pulmonary eNOS levels, intrapulmonary vasodilatation, and arterial gas exchange abnormalities consistent with the development of HPS.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Animal models. PVL was performed as previously described (7) using male Sprague-Dawley rats (Charles River, Wilmington, MA) weighing 200-250 g. At the time of surgery, a miniosmotic pump (ALZET Model 2002, ALZA, Palo Alto, CA) was inserted into the femoral vein. Rats were infused with 3 ng · 200 g body wt-1 · h-1 of synthetic ET-1 peptide (Peninsula Laboratories, Belmont, CA) or 0.9% saline for 2 wk based on the hepatic venous and plasma ET-1 concentration previously observed in 2-wk CBDL animals (26) and on pilot studies. In pilot studies, the acute effects of ET-1 infusion using 3 ng · 200 g body wt-1 · h-1 was compared with an infusion of 30 ng · 200 g body wt-1 · h-1. The lower dose resulted in a mild transient hypotensive effect as previously seen using physiological doses of ET-1, and the higher dose resulted in well-described vasoconstriction (21). ET-1 delivery was monitored by ensuring that the pump was empty and the delivery catheter was positioned in the femoral vein at the termination of the experiment. The stability of ET-1 in miniosmotic pumps over 2 wk was documented by placing a known concentration of ET-1 in four miniosmotic pumps under sterile conditions and incubating these pumps for 2 wk at 37°C. Subsequent RIA for ET-1 revealed a concentration of ET-1 in the pumps within 10-15% of initial values. The development of portal hypertension was confirmed by portal pressure and spleen weight measurements. Arterial gas exchange was evaluated as described by arterial blood gas analysis (11), and the alveolar-arterial oxygen gradient was calculated as 150-(PCO2/0.8)-PO2. Lung tissue was collected after perfusion with PBS for histology and eNOS detection by Western blot analysis (10). Mean pulmonary arterial pressure was measured by insertion of an indwelling pulmonary arterial catheter, and mean systemic arterial pressure was measured by insertion of an indwelling femoral arterial catheter both placed 48 h before death as previously described (9). Pressure measurements were made at rest on the day of death. Five to six animals were used in each group. The study was approved by the Institutional Animal Care and Use Committee of the University of Alabama at Birmingham and conforms to the National Institutes of Health Guidelines for the Care and Use of Laboratory Animals.

Microsphere protocol. Size assessment of the pulmonary microcirculation was performed as previously described in awake unsedated animals (11). Forty-eight hours before microsphere injection, animals underwent the placement of indwelling PE-50 femoral arterial and venous catheters. On the day of measurement, 45 min after arterial blood gas determination, 2.5 × 10 custom mixed and counted cross-linked polystyrene-divinylbenzene microspheres labeled red (size range 6.5-10 µm; Interactive Medical Technologies, Los Angeles, CA) in 0.20 ml of sterile PBS were injected over 2-4 s through the femoral vein catheter, which was immediately flushed with 0.2 ml of sterile PBS over 2-4 s. An aliquot of microspheres was removed from the injection syringe immediately before injection and counted to verify the numbers and sizes of microspheres injected. A reference blood sample was withdrawn from the femoral arterial catheter beginning at the time of femoral vein injection for a total of 90 s at a constant rate of 1.0 ml/min. The volume removed was replaced with an equal volume of sterile PBS.

Microsphere counting/intrapulmonary shunt calculations. Samples of beads before venous injection and reference blood samples were coded, and counting suspensions were prepared using the E-Z Trac method as outlined by the manufacturer. Numbers and sizes of microspheres in each sample were assessed using a Leica DMRE microscope (Wetzlar, Germany) with a color video imaging system combined with image analysis software (Pro 3.0 Media Cybernetics, Silver Spring, MD) with area, shape factor, and aspect ratios set to distinguish microsphere sizes. Total numbers of microspheres passing through the pulmonary microcirculation were calculated as reference blood sample microspheres per milliliter times estimated blood volume. Blood volume of each animal was derived from the following formula: blood volume (ml) = 0.06 × body wt (g) + 0.77 (see Ref. 24). Intrapulmonary shunting was calculated as an intrapulmonary shunt fraction (%) = (total number of microspheres passing through the pulmonary microcirculation/total beads injected into the venous circulation) × 100.

Cell culture. BPAECs [American Type Culture Collection (ATCC), Manassas, VA] were maintained and passaged in EGM-MV complete media (Clonetics, San Diego, CA) at 37°C with 5% CO2 on 100-mm Falcon cell culture dishes (Becton Dickinson Labware, Lincoln Park, NJ), and cells of passages 3-10 were used in the study. When cells reached 70% confluence, they were incubated in 4 ml of minimal media containing 0.5% FBS without supplements and stimulated by ET-1 at various concentrations (0.01, 0.1, and 1 µM) for various times (12, 24, and 48 h). In a set of experiments, endothelin receptor antagonists including TBC3214Na for ETA (kind gift from Dr. Y. F. Chen, University of Alabama at Birmingham), BQ-788 for ETB (Peptides International, Louisville, KY), or Bosentan for ETA and ETB (Roche, Basel, Switzerland) were applied at 10 µM to cells in the presence or absence of ET-1 treatment. To assess cell proliferation, cells were incubated on a 96-well plate (Nalge Nunc, Naperville, IL) at 2,000 cells/well in minimal media containing 0.5% FBS in the presence or absence of 0.1 µM ET-1 for 12, 24, and 48 h. A standard curve was constructed by using a defined cell number in the assay. At each time point, 20 µl of freshly made MTS/phenazine methosulfate (PMS) mixture (10:1 vol/vol, Promega, Madison, WI) was added into each well containing 100 µl of media and was incubated at 37°C in a humidified 5% CO2 atmosphere for 1 h. After the absorbance at 490 nm was recorded using an ELISA microplate reader (Molecular Devices, Sunnyvale, CA), cell number was calculated according to the standard curve.

Western blot analysis. BPAECs or lung tissue was prepared by lysis or Dounce homogenization respectively in radioimmunoprecipitation buffer (10) in the presence of protease inhibitors. Fifteen micrograms of protein from homogenates, quantified by protein assay (Bio-Rad, Hercules, CA), were fractionated on a 7.5% SDS-PAGE gel and then transferred to a Hybond enhanced chemiluminescence nitrocellulose membrane (Amersham, Arlington Heights, IL). Incubation with an eNOS monoclonal antibody (Transduction Laboratories, Lexington, KY) was followed by extensive washing and incubation with a horseradish peroxidase-conjugated sheep anti-mouse secondary antibody (Amersham) and development by enhanced chemiluminescence (Amersham) on Kodak X-ray film (Sigma, St. Louis, MO).

Northern blot analysis. Total RNA from BPAECs was prepared by lysis in TRIzol reagent on the basis of a standard protocol (GIBCO, Grand Island, NY). RNA (20 µg) was subjected to agarose gel electrophoresis and blotted onto a Nytran membrane (Schleicher & Schuell, Keene, NH) as described (26), followed by a quick hybridization procedure (Stratagene, La Jolla, CA) with a 4.0-kb bovine eNOS cDNA probe (kind gift of Dr. William Sessa, Yale University) or a 0.5-kb rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA (ATCC) labeled with the Prime-a-Gene labeling system (Promega). Blots were then exposed to Kodak X-ray film.

RT-PCR. First strand cDNA was synthesized from 2 µg of total RNA of BPAECs by oligo(dT) primer using the SuperScript preamplification system (GIBCO) and then subjected to subsequent PCR analysis. PCR was carried out using appropriate primers in 50 µl of buffer containing 0.2 mM each dNTP, 3.0 mM MgCl2, 0.5 µM each primer, and 2.5 U/100 µl recombinant Taq DNA polymerase (GIBCO) using 25 amplification cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min in a Perkin-Elmer 2400 PCR machine (Foster City, CA). The reaction mixture was then resolved by agarose gel electrophoresis. PCR primers for detecting eNOS mRNA were designed based on the published eNOS cDNA sequence to yield a ~380-bp DNA fragment (20) and were also used in subsequent sequence analysis. The 5' primer was AGTAACACAGACAGTGCAGGG, and the 3' primer was GTAGCCTGGAACATCTTCCG. Primers for detecting alpha -actin message were used as an internal control to amplify a ~400-bp DNA fragment. The 5' primer was GACCTGACAGACTACCTCAT, and the 3' primer was AGACAGCACTGTGTTGGCAT. Where indicated, PCR products were sequenced using an ABI PRISM Model 377 automated sequencer (University of Alabama at Birmingham Sequencing Facility).

NO detection assay. Aliquots of media (150 µl) from BPAEC culture in the presence or absence of 0.1 µM ET-1 for 0, 12, and 24 h were incubated with 10 µl of Escherichia coli nitrate reductase preparation (no. 25922, ATCC) at 37°C for 1 h to convert NO-3 in samples to NO-2, followed by centrifugation at 15,000 g for 5 min. Supernatants (150 µl) were then analyzed by the Greiss reaction (14) in 75 µl of 1% sulfanilamide and 7 µl of naphthylethylene-diamine dihydrochloride at room temperature for 10 min. The absorbance at 550 nm was measured using an ELISA microplate reader, and net NO production was calculated according to a standard curve prepared by using NaNO3 ranging from 0 to 100 µM in culture media.

Densitomertry and statistics. The density of autoradiographic signals was quantitated with a GS-670 imaging densitometer (Bio-Rad) and expressed as multiples of control in which the density was designated as onefold in control experimental group. Data were analyzed using Student's t-test or ANOVA with Bonferroni correction for multiple comparisons between groups. All measurements are expressed as means ± SE. Statistical significance was designated as P < 0.05 unless otherwise indicated.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

ET-1 increases eNOS protein levels in BPAECs. To determine if ET-1 can induce eNOS protein expression, BPAECs were treated with synthetic ET-1 peptide in a minimal medium containing 0.5% FBS in the absence of other growth factor supplements. A progressive dose- and time-dependent increase in eNOS protein (140 kDa) levels was observed by Western blotting after ET-1 stimulation. The maximal increase occurred at 24 h after the addition of 0.1 µM ET-1 (Fig. 1, A and B) and represented a significant 2.5-fold increase in eNOS protein production (Fig. 1C).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1.   Endothelin (ET)-1 induction of endothelial nitric oxide synthase (eNOS) protein levels in bovine pulmonary artery endothlial cells (BPAECs). BPAECs (70% confluent) were treated with ET-1 peptide of varying doses and for various times and then lysed in radioimmunoprecipitation (RIPA) buffer. Equal amounts of lysates were resolved on 7.5% SDS-PAGE gels and transferred to Hybond ECL membranes. eNOS was detected with a monoclonal antibody and visualized by enhanced chemiluminescence (ECL). A: BPAECs stimulated with 0.1 µM ET-1 for 0, 12, 24, or 48 h demonstrated an increase in eNOS protein levels. B: BPAECs stimulated with ET-1 at 0, 0.01, 0.1, or 1 µM for 24 h demonstrated a dose-dependent increase in eNOS protein levels. C: summary of BPAEC stimulation for 24 h in presence and absence of 0.1 µM ET-1 (n = 5 plates for each group). eNOS protein was quantitated by desitometry, and values are expressed as means ± SE. Mean for non-ET-1-treated cells was arbitrarily set at 1. * P < 0.05.

ET-1-mediated effects on eNOS protein are mediated through the ETB receptor in BPAECs. The effects of ET-1 on vascular tone are mediated through two distinct receptors, the ETA receptor and the ETB receptor, which differ in their tissue and cell-type specificity (19). The ETB receptor predominates on endothelial cells. To determine the role of ET receptors in ET-1-mediated alterations in eNOS protein levels, BPAECs were stimulated with 0.1 µM ET-1 for 24 h and eNOS protein levels were assessed in the presence or absence of ET receptor antagonists (Fig. 2). The eNOS protein levels in these cells were compared with control levels in untreated BPAECs, which were arbitrarily set at one. The addition of ET receptor antagonists alone, including TBC3214Na, a selective ETA receptor antagonist (1.0 ± 0.2-fold control), BQ-788, a selective ETB receptor antagonist (1.2 ± 0.06-fold control), and Bosentan, a mixed ETA and ETB receptor antagonist (1.1 ± 0.2-fold control), had no significant effect on eNOS protein levels (n = 4 in each group and in subsequent receptor antagonist studies; differences were not significant for each group relative to untreated controls). The addition of the ETA receptor antagonist did not inhibit the ET-1-mediated increase in eNOS protein (2.3 ± 0.2-fold control; P < 0.05 relative to control untreated cells), which was similar to that seen in control BPAECs treated with ET-1 alone. In contrast, the ET-1-mediated increase in eNOS protein was abolished and was significantly different from ETA receptor antagonist-treated cells when the ETB receptor antagonist (1.03 ± 0.3-fold control) or Bosentan (1.03 ± 0.04-fold control) was added to the culture medium (P < 0.05 relative to ETA receptor antagonist-treated cells). These findings indicate that ET-1-mediated changes in eNOS protein levels are mediated through the ETB receptor on BPAECs.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 2.   Effects of endothelin receptor antagonists on ET-1-induced eNOS protein levels in BPAECs. Representative Western blot for eNOS obtained from 70% confluent BPAECs treated with 10 µM of endothelin receptor antagonists for 24 h in presence or absence of 0.1 µM ET-1 and analyzed as described in Fig. 1. TBC3214Na is ETA receptor antagonist, BQ-788 is ETB receptor antagonist and Bosentan is ETA and ETB receptor antagonist. Experiments were repeated (n = 4 for each condition) for statistical analysis. Second, fourth, and sixth lanes from left represent cells incubated with ET receptor antagonists alone. No difference in eNOS levels was observed in these cells compared with untreated control cells (first lane from left). Incubation of cells with a selective ETA receptor antagonist and ET-1 did not block ET-1-mediated increase in eNOS protein levels (third lane from left). In contrast, both ETB-selective and mixed ETA and ETB receptor antagonists abolished ET-1-mediated increase in eNOS protein levels (fifth and seventh lanes from left), establishing that ET-1 alters eNOS protein levels in BPAECs through ETB receptor.

ET-1 upregulates eNOS mRNA in BPAECs. To further evaluate the mechanism of the ET-1-mediated increase in eNOS protein, we measured steady-state eNOS mRNA levels by Northern blotting in BPAECs after ET-1 exposure (Fig. 3A). The eNOS mRNA levels normalized to GAPDH levels after ET-1 exposure were compared with control levels in untreated BPAECs incubated for the same time as treated cells and arbitrarily set at 1 (n = 4 for each group). There was an increase in the ~5.0-kb eNOS signal (2) that was statistically significant within 12 h of 0.1 µM ET-1 stimulation (2.3 ± 0.6-fold control) and was maximal by 24 h (3.6 ± 1.2-fold control). The increase was maintained at 48 h (2.9 ± 0.6-fold control). No change in the GAPDH control signal was observed on these blots. The ET-1-mediated increase in eNOS mRNA was confirmed by RT-PCR analysis using eNOS-specific primers. An increase in a ~380-bp fragment amplified with eNOS primers, but not an alpha -actin control message, was observed after ET-1 stimulation (Fig. 3B). The ~380-bp PCR product was confirmed to be eNOS by direct sequencing and comparison with the published eNOS sequence (data not shown) (20). The temporal association between the increase in eNOS mRNA and protein levels after ET-1 exposure is consistent with the hypothesis that ET-1 alters eNOS expression in endothelial cells.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 3.   ET-1 induction of eNOS mRNA in BPAECs. BPAECs (70% confluent) were stimulated with 0.1 µM ET-1 peptide for 0, 12, 24, or 48 h, and total RNA was extracted using TRIzol reagent. A: representative Northern blot of 20 µg of total RNA fractionated on a 0.75% formaldehyde-agarose gel, transferred to nitrocellulose, and detected with a 4.0-kb eNOS probe. A glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA probe was used as an internal control. The ~5.0-kb eNOS mRNA increased maximally by 24 h with no change in GAPDH signal. B: 2 µg of total RNA from BPAECs stimulated by 0.1 µM ET-1 for 0, 12, 24, or 48 h were subjected to RT-PCR using specific primers for eNOS or alpha -actin and then resolved on a 0.75% agarose gel. The 380-bp eNOS PCR product also increased after ET-1 stimulation, with no change in alpha -actin PCR product.

ET-1 stimulates NO production in BPAECs. To confirm that ET-1 stimulation of BPAECs and the subsequent increase in eNOS protein levels result in enhanced NO production, we measured NO levels in BPAEC culture media in the presence and absence of exogenous ET-1. ET-1 administration (0.1 µM) significantly stimulated net NO production (2.8-fold) from cells after 24 h (Fig. 4), as has been previously observed (17). The maximal increase in culture medium NO levels correlated temporally with increased eNOS levels in BPAECs, suggesting that enhanced eNOS expression may contribute to increased NO production.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4.   ET-1 induction of nitrite production in BPAECs. After incubation in presence or absence of 0.1 µM ET-1 for 0, 12, or 24 h, NO-3 in BPAEC culture media was converted to NO-2 by nitrate reductase and then analyzed by Greiss reaction. Absorbance at 550 nm was measured to calculate net NO production according to a standard curve. A significant increase in nitrite was observed at 24 h after ET-1 induction (n = 4 at each time point in each group). * P < 0.05.

ET-1 does not induce BPAEC proliferation over 24 h. To exclude the possibility that the mitogenic properties of ET-1 caused BPAEC proliferation and resulted in increased eNOS mRNA and protein levels over the time course studied here, we measured BPAEC proliferation by the MTS/PMS assay in the presence and absence of exogenous ET-1. Cells incubated as above and not exposed to ET-1 were compared with cells exposed to 0.1 µM ET-1 for 12, 24, and 48 h. Cell number was measured at each time point. There was no significant difference in cell number after 24 h between exposed and unexposed cells (Fig. 5). After 48 h, ET-1 treatment resulted in a modest increase in cell number, though the magnitude of the increase relative to untreated cells at 48 h (1.2-fold untreated) was substantially less than the increase in eNOS mRNA and protein levels over the same time frame. These results demonstrate that the increase in eNOS levels in BPAECs after ET-1 stimulation cannot be explained by enhancement of cell proliferation over the time frame studied here.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of ET-1 on proliferation of BPAECs. Two thousand cells/well in a 96-well plate were incubated at 37°C and 5% CO2 atmosphere in a growth factor-deficient minimal medium for 0, 12, 24, or 48 h in presence or absence of 0.1 µM ET-1. Cell numbers were measured by MTS/phenazine methosulfate assay and were calculated according to a standard curve for each time point (n = 4 at each time point).

Chronic intravenous ET-1 administration increases lung eNOS levels, results in intrapulmonary shunting, and impairs gas exchange after PVL. To determine if ET-1 contributes to the development of HPS, we delivered an ET-1 or saline infusion through the femoral vein over 2 wk via a miniosmotic pump in PVL animals. Liver and lung histology, portal vein pressure, mean systemic and pulmonary arterial blood pressure, lung eNOS levels, microsphere assessment of the pulmonary microcirculation, and arterial gas exchange were evaluated. Pressure measurements and arterial blood gas results are summarized in Table 1. All animals developed significant portal hypertension compared with values previously observed in normal rats (11), and the degree of portal hypertension at 2 wk was not different in saline- and ET-1-treated animals. Serum aspartate aminotransferase and total bilirubin levels and hepatic histology were also normal in the saline and ET-1 groups (data not shown), suggesting that low-dose ET-1 infusion had no measurable effects on the liver. Mean systemic arterial pressures were similar in saline- and ET-1-treated animals and were lower than values we have observed in normal animals (9), reflecting the development of a hyperdynamic state as previously described after PVL (36). Mean pulmonary arterial pressures were also similar in both groups and remained within the range observed in normal animals (9), demonstrating that the doses of exogenous ET-1 administered here had no significant vasoconstrictive effect in the lung.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Effects of chronic ET-1 infusion on pressure measurements and arterial blood gases in PVL animals

Western blot analysis of pulmonary eNOS protein levels demonstrated a small but significant 1.5-fold increase in whole lung eNOS levels in ET-1-treated lung relative to saline-treated lung (Fig. 6). This increase is similar but slightly less than that observed in 2-wk CBDL animals with HPS as previously described (10). Western blot for inducible nitric oxide synthase was performed and revealed no detectable signal in lung in either group (data not shown) as observed previously in CBDL animals (10). The increase in pulmonary eNOS levels in ET-1-treated animals was accompanied by increased shunting of microspheres across the pulmonary microcirculation and significant alterations in arterial gas exchange. Figure 7A demonstrates that similar numbers and sizes of microspheres were injected into the venous system in saline- and ET-1-treated animals. Figure 7B shows the results of arterial counts of microspheres after venous injection, reflecting passage through the pulmonary microcirculation. Saline-treated PVL animals demonstrated a similar pattern of microsphere passage through the lungs as previously observed in normal and PVL animals (11). ET-1-treated animals demonstrated a significant increase in the size and number of microspheres passing through the lungs relative to saline-treated animals, as evidenced by a rightward shift in the microspheres recovered from the femoral artery in these animals. Saline-treated PVL animals had a shunt fraction of 2.6 ± 0.8%, similar to shunt values found for 6.5 × 10 µm microspheres in normal and PVL animals in previous studies (11). In contrast, ET-1-treated animals had a significantly increased shunt fraction of 14.7 ± 2% (P < 0.05) similar to that previously observed in CBDL animals with HPS (11), reflecting intrapulmonary vasodilatation and enhanced passage of microspheres through the lung.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 6.   Effect of chronic ET-1 infusion on lung eNOS protein levels in PVL rats. Lung tissue from PVL rats receiving intravenous saline or low-dose ET-1 (3 ng · 200 g body wt-1 · h-1) through miniosmotic pumps for 2 wk were homogenized in RIPA buffer, and 15 µg of total lysates were subjected to immunoblotting as described in Fig. 1. Specific eNOS protein signal was quantified by densitometry and expressed as mean ± SE. Mean from saline-treated rats was arbitrarily set at 1, and ET-1-treated values were expressed as fold control (n = 4 in each group). A significant increase in lung eNOS protein levels occurred after ET-1 infusion. * P < 0.05.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 7.   Effect of chronic ET-1 infusion on pulmonary micro-circulation as measured using microsphere analysis. PVL rats that had received chronic saline or ET-1 intravenous infusions through miniosmotic pumps for 2 wk were injected with 2.5 × 106 custom mixed and counted cross-linked polystyrene-divinylbenzene microspheres labeled red (size range 6.5-10 µm) via an indwelling femoral vein catheter, followed by collection of blood from an indwelling femoral arterial catheter. Numbers and sizes of microspheres were assessed using a microscope equipped with a color video imaging system and image analysis software. A: numbers and sizes of microspheres injected into femoral vein measured by counting an aliquot of microspheres removed from syringe immediately before injection. Similar numbers and sizes of microspheres were injected in both groups. B: numbers and sizes of microspheres collected from femoral artery over 90 s after venous injection. A significant increase in numbers and sizes of microspheres were recovered in femoral artery in ET-1-infused animals compared with saline-infused animals, reflecting increased passage through dilated pulmonary microcirculation. * P < 0.05 (n = 4).

Evidence of dilatation of the pulmonary microcirculation was also accompanied by abnormalities in arterial oxygenation in ET-1-treated animals (Table 1). Compared with animals without liver disease and to untreated PVL animals (11), each ET-1-treated PVL animal developed a respiratory alkalosis, relative hypoxemia, and a widened alveolar-arterial oxygen gradient, similar to changes observed in animals and humans with HPS (10). An arterial blood gas was available from one saline-treated PVL animal, and values from this animal were within the normal range that we have previously observed (11). These observations demonstrate that chronic low-dose ET-1 infusion in PVL animals results in the development of molecular alterations in lung eNOS, dilatation of the pulmonary microcirculation, and gas exchange abnormalities similar to changes observed in animals with HPS.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Reciprocal paracrine and autocrine interactions between ET-1 and NO are important in mediating endothelium-dependent regulation of vascular tone (8, 15, 38, 39). An imbalance in these mediators has been implicated in the pathogenesis of several vascular disorders (13, 18, 39). The present study extends this concept on the basis of our previous observations, which suggest a pathogenetic association between elevated circulating ET-1 levels, increased pulmonary vascular eNOS levels, and functional alterations in the pulmonary vasculature in an animal model of HPS (26). In the present study, we document that administration of ET-1 stimulates increased eNOS protein and mRNA levels in BPAECs through an ETB receptor-mediated effect, which correlates with increased NO production in these cells. In addition, chronic low-dose intravenous infusion of ET-1 in PVL animals triggers an increase in lung eNOS levels, alterations in the pulmonary microcirculation, and an impairment in arterial gas exchange similar to that observed in animals with HPS, without increasing pulmonary arterial pressure. These studies provide direct evidence that circulating ET-1 may increase eNOS production in endothelial cells and contribute to the pathogenesis of HPS.

We and others have demonstrated that hepatic production of ET-1 increases after CBDL (26, 34) and likely results in release into the venous system with circulation to the pulmonary vasculature. The increase in circulating ET-1 correlates with increased eNOS levels, enhanced NO activity, and gas exchange abnormalities in the lung in these animals that develop HPS (26) and implies that ET-1 may contribute to the development of pulmonary abnormalities. Our in vitro studies demonstrate the novel observation that exposure to ET-1 does increase eNOS mRNA and protein levels in BPAECs in a dose- and time-dependent fashion, supporting a role for ET-1 in altering eNOS expression. This effect occurs through the ETB receptor. Although the molecular mechanism through which ET-1 alters eNOS production remains under study, the hypothesis that ET-1 alters eNOS expression in the pulmonary vasculature is consistent with the observation that ET-1 can alter vasoactive mediator expression in other cell types (4, 5) and with the finding that a variety of agents are now known to influence the expression of the eNOS gene (6, 16, 22, 32). The potential physiological significance of this effect is highlighted by our in vivo observation that chronic low-dose intravenous ET-1 infusion also increases pulmonary eNOS levels and is associated with vascular and gas exchange abnormalities in the lung.

ET-1 has potent vasoconstrictive properties when released from vascular endothelial cells and targeted to the ETA receptor on vascular smooth muscle cells or when administered intravenously in pharmacological doses (35). However, this effect is not observed when doses closer to levels found in vivo are administered (21). The ET-1 peptide also exerts an autocrine vasodilatory effect by increasing eNOS activity through the ETB receptor on vascular endothelial cells (17) and alters the gene expression of other vasoactive peptides in smooth muscle cells (4, 5). Liver injury with portal hypertension appears to represent a unique pathological situation where elevated circulating ET-1 levels (3, 26, 29), derived from increased hepatic production (26, 31, 34), occur in the setting of systemic vasodilatation. In this situation, systemic vascular tone is not altered by the addition of ET receptor antagonists (25), suggesting that ET-1 production does not simply reflect a response to vasodilatation. Our in vivo findings demonstrate that low-dose intravenous ET-1 infusion in the setting of portal hypertension does not significantly alter systemic or pulmonary arterial pressure, confirming that vasoconstrictive effects of ET-1 are not detectable. The attenuated vasoconstrictive effect of circulating ET-1 in portal hypertension is unexplained but may be contributed to by the relatively low circulating levels observed, which are generally below levels associated with significant vasoconstriction (27). Alternatively, flow-mediated changes in ET receptor expression in the vasculature (33) or alterations in the levels of other vasoactive substances observed during the development of the hyperdynamic circulation of portal hypertension could influence the effects of ET-1 on the vasculature. Our studies also do not support that circulating ET-1 contributes to the development or maintenance of systemic vasodilatation in portal hypertension, as saline- and ET-1-treated PVL animals develop a similar degree of systemic hypotension. Thus ET-1 appears to exert a selective vasodilatory effect in the pulmonary vasculature in our system.

The observation that low levels of circulating ET-1 may have a localized effect in the pulmonary vasculature that alters eNOS levels and influences the pulmonary microcirculation is perhaps not unexpected. ET-1 released into the circulation during hepatic injury or infused intravenously will first encounter the pulmonary vasculature. In addition, significant clearance of ET-1 from the circulation occurs in the lung, in large part through an ETB receptor-mediated effect (12). Thus ET-1 may influence pulmonary vascular NO production by increasing eNOS levels and by increasing eNOS enzyme activity, effects that are each mediated through the ETB receptor. Our in vitro and in vivo studies support this concept. However, we cannot be certain that eNOS is not also produced in cell types other than endothelial cells in the vascular wall or may increase in cell types outside the vasculature in the lung. In addition, we have not completely excluded that other forms of nitric oxide synthase may be contributing to changes in pulmonary vascular tone, although we have not found detectable levels of iNOS in the lung in the present studies. Finally, the increase in lung eNOS levels observed after ET-1 infusion is less than that observed in CBDL animals despite the development of a similar degree of vasodilatation and gas exchange abnormalities. This observation suggests that ET-1 may also contribute to intrapulmonary vasodilatation through effects distinct from nitric oxide production in the pulmonary vasculature.

In humans and animals the presence of portal hypertension appears to be required for the development of HPS. Thus we designed our in vivo studies to administer low-dose intravenous ET-1 to animals that normally develop portal hypertension in the absence of pulmonary vascular or hepatic changes to provide a direct means of analyzing whether ET-1 triggers changes in the pulmonary microcirculation in the setting of portal hypertension. We have evaluated the effects of chronic intravenous ET-1 infusion on the liver as well as the lung in PVL animals and have observed no effect on portal venous pressure, liver tests, or hepatic histology. These results confirm a lack of measurable effects of exogenous low-level ET-1 infusion in the liver in PVL animals. Our findings in the lung are consistent with the concept that chronic ET-1 infusion, in the setting of portal hypertension, causes intrapulmonary vasodilatation. Studies evaluating ET-1 infusion in normal animals will define whether portal hypertension is required for ET-1 to alter pulmonary microvascular tone.

Our microsphere assessment of the pulmonary microcirculation provides a direct assessment of small vessel tone and intrapulmonary shunting in unsedated animals. The technique is an adaptation of methods used to evaluate intrapulmonary shunting in humans with HPS (1) and portosystemic shunting in anesthetized rats (7) and has been previously employed in PVL animals (11). Results in our saline-treated PVL animals in the present study are similar to those observed in PVL animals previously (11), confirming the reproducibility of this technique. Our ET-1-treated animals shunted significantly more and larger microspheres across pulmonary microcirculation, similar to changes previously observed in CBDL animals with HPS (11). One limitation of this technique is the inability to discriminate between intrapulmonary and intracardiac shunting of microspheres. Thus if ET-1 infusion resulted in a significant selective increase in pulmonary arterial pressures, a gradient for right-to-left intracardiac shunting of microspheres through potential intracardiac septal defects could be created. We did not observe a significant rise in pulmonary arterial pressures in ET-1-treated PVL animals and could find no gross anatomical evidence for the presence of intracardiac septal defects in previous studies (11) or in our present animals.

Our current findings, in conjunction with previous observations, suggest that increased ET-1 production found during certain forms of hepatic injury may stimulate pulmonary vascular eNOS expression and activity and contribute to the pathogenesis of HPS. In vitro studies demonstrate that this effect may be mediated through the ETB receptor on pulmonary vascular endothelial cells. Together, these observations provide a novel pathogenetic mechanism for the development of HPS. In addition, they provide a direction for future investigation in humans and imply that unique therapeutic approaches focused on inhibiting the pulmonary vascular ETB receptor or on modulating hepatic ET-1 production may provide useful medical therapies for this disorder.


    ACKNOWLEDGEMENTS

This work was supported by a Merit Award from the Department of Veterans Affairs (M. B. Fallon) and a Grant In Aid from the Alabama affiliate of the American Heart Association (M. B. Fallon).


    FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: M. B. Fallon, Univ. of Alabama at Birmingham, 410 LHRB, 701 South 19th St., Birmingham, AL 35294-0007 (E-mail: mfallon{at}uab.edu).

Received 25 February 1999; accepted in final form 26 July 1999.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Abrams, G. A., C. C. Jaffe, P. B. Hoffer, H. J. Binder, and M. B. Fallon. Diagnostic utility of contrast echocardiography and lung perfusion scan in patients with hepatopulmonary syndrome. Gastroenterology 109: 1283-1288, 1995[Medline].

2.   Arnai, J., J. Yamin, S. Dockery, and D. Harrison. Regulation of endothelial nitric oxide synthase mRNA, protein and activity during cell growth. Am. J. Physiol. 207 (Cell Physiol. 0): C1381-C1388, 1994.

3.   Asbert, M., A. Gines, P. Gines, W. Jimenez, J. Claria, J. Salo, V. Arroyo, F. Rivera, and J. Rodes. Circulating levels of endothelin in cirrhosis. Gastroenterology 104: 1485-1491, 1993[Medline].

4.   Bezie, Y., L. Mesnard, D. Longrois, F. Samson, C. Perret, J. J. Mercadier, and S. Laurent. Interactions between endothelin-1 and atrial natriuretic peptide influence cultured chick cardiac myocyte. Eur. J. Pharmacol. 311: 241-248, 1996[Medline].

5.   Bruneau, B. G., and A. J. de Bold. Selective changes in natriuretic peptide and early response gene expression in isolated rat atria following stimulation by stretch or endothelin-1. Cardiovasc. Res. 28: 1519-1525, 1994[Medline].

6.   Bucher, M., K. Ittner, M. Zimmermann, K. Wolf, J. Hobbhahn, and A. Kurtz. Nitric oxide synthase isoform III gene expression in rat liver is up-regulated by lipopolysaccharide and lipoteichoic acid. FEBS Lett. 412: 511-514, 1997[Medline].

7.   Chojkier, M., and R. J. Groszmann. Measurement of portal systemic shunting using gamma-labeled microspheres. Am. J. Physiol. 240 (Gastrointest. Liver Physiol. 3): G371-G375, 1981[Abstract/Free Full Text].

8.   Clement, M., and M. Albertini. Differential release of prostacyclin and nitric oxide evoked from pulmonary and systemic vascular beds of the pig by endothelin-1. Prostaglandins Leukot. Essent. Fatty Acids 55: 279-285, 1990.

9.   Fallon, M., G. Abrams, T. Abdel-Razek, J. Dai, S. Chen, Y. Chen, B. Luo, S. Oparil, and D. Ku. Garlic prevents hypoxic pulmonary hypertension in rats. Am. J. Physiol. 275 (Lung Cell. Mol. Physiol. 19): L283-L287, 1998[Abstract/Free Full Text].

10.   Fallon, M. B., G. A. Abrams, B. Luo, Z. Hou, J. Dai, and D. D. Ku. The role of endothelial nitric oxide synthase in the pathogenesis of a rat model of hepatopulmonary syndrome. Gastroenterology 113: 606-614, 1997[Medline].

11.   Fallon, M. B., G. A. Abrams, J. W. McGrath, Z. Hou, and B. Luo. Common bile duct ligation in the rat: a model of intrapulmonary vasodilatation and the hepatopulmonary syndrome. Am. J. Physiol. 272 (Gastrointest. Liver Physiol. 35): G779-G784, 1997[Abstract/Free Full Text].

12.   Fukuroda, T., T. Fujikawa, S. Ozaki, K. Ishikawa, M. Yano, and M. Nishikibe. Clearance of circulating endothelin-1 by ETB receptors in rats. Biochem. Biophys. Res. Commun. 199: 1461-1465, 1994[Medline].

13.   Giaid, A., and D. Saleh. Reduced expression of endothelial nitric oxide synthase in the lungs of patients with pulmonary hypertension. N. Engl. J. Med. 333: 214-221, 1995[Abstract/Free Full Text].

14.   Green, L., D. Wagner, J. Glogowski, P. Skipper, J. Wishnok, and S. Tannenbaum. Analysis of nitrate, nitrite and [15N] nitrite in biological fluids. Anal. Biochem. 120: 131-138, 1982.

15.   Haynes, W., and D. Webb. Contribution of endogenous generation of endothelin-1 to basal vascular tone. Lancet 344: 852-854, 1994[Medline].

16.   Hennington, B., H. Zhang, T. Miller, J. Granger, and J. Reckelhoff. Angiotensin II stimulates syntesis of endothelial nitric oxide synthase. Hypertension. 31: 283-288, 1998[Abstract/Free Full Text].

17.   Hirata, Y., T. Emori, S. Eguchi, K. Kanno, T. Imai, K. Ohta, and F. Marumo. Endothelin receptor subtype B mediates synthesis of nitric oxide by cultured bovine endothelial cells. J. Clin. Invest. 91: 1367-1371, 1993.

18.   Hirata, Y., H. Hayakawa, E. Suzuki, K. Kimura, K. Kikuchi, T. Nagano, M. Hirobe, and M. Omata. Direct measurements of endothelium-derived nitric oxide release by stimulation of endothelin receptors in rat kidney and its alteration in salt-induced hypertension. Circulation 91: 1229-1235, 1995[Abstract/Free Full Text].

19.   Huggins, J. P., J. T. Pelton, and R. C. Miller. The structure and specificity of endothelin receptors: Their importance in physiology and medicine. Pharmacol. Ther. 59: 55-123, 1993[Medline].

20.   Janssens, S., A. Shimoushi, T. Quertermous, D. Bolch, and K. Blach. Cloning and expression of a cDNA encoding human endothelium-derived relaxing factor/nitric oxide synthase. J. Biol. Chem. 207: 14519-14522, 1992.

21.   King, A. J., J. A. Pfeffer, M. A. Pfeffer, and B. M. Brenner. Systemic hemodynamic effects of endothelin in rats. Am. J. Physiol. 258 (Heart Circ. Physiol. 27): H787-H792, 1990[Abstract/Free Full Text].

22.   Kleinert, H., T. Wallerath, C. Euchenhofer, I. Ihrig-Beidert, H. Li, and U. Forstermann. Estrogens increase transcription of the human endothelial NO synthase gene: analysis of transcription factors involved. Hypertension 31: 582-588, 1998[Abstract/Free Full Text].

23.   Lange, P. A., and J. K. Stoller. The hepatopulmonary syndrome. Ann. Intern. Med. 122: 521-529, 1995[Abstract/Free Full Text].

24.   Lee, H. B., and M. D. Blaufox. Blood volume in the rat. J. Nucl. Med. 26: 72-76, 1985[Abstract/Free Full Text].

25.   Leivas, A., W. Jimenez, S. Lamas, M. Bosch-Marce, J. Oriola, J. Claria, V. Arroyo, F. Rivera, and J. Rodes. Endothelin 1 does not play a major role in the homeostasis of arterial pressure in cirrhotic rats with ascites. Gastroenterology 108: 1842-1848, 1995[Medline].

26.   Luo, B., G. Abrams, and M. Fallon. Endothelin-1 in the bile duct ligation model of hepatopulmonary syndrome: correlation with pulmonary dysfunction. J. Hepatol. 29: 571-578, 1998[Medline].

27.   Mallat, A., and S. Lotersztajn. Multiple hepatic functions of endothelin-1: physiopathological relevance. J. Hepatol. 25: 405-413, 1996[Medline].

28.   Martin, P., D. Li Xu, M. Niederberger, A. Weigert, P. Tsai, J. John, and R. Schrier. Upregulation of endothelial constituitive NOS: a major role in the increased NO production in cirrhotic rats. Am. J. Physiol. 270 (Renal Fluid Electrolyte Physiol. 39): F494-F499, 1996[Abstract/Free Full Text].

29.   Moore, K., J. Wendon, M. Frazer, J. Krani, R. Williams, and K. Badr. Plasma endothelin immunoreactivity in liver disease and the hepatorenal syndrome. N. Engl. J. Med. 327: 1774-1777, 1992[Abstract].

30.   Niederberger, M., P. Martin, P. Gines, K. Morris, P. Tsai, D. L. Xu, I. Mcmurtry, and R. Schrier. Normalization of nitric oxide production corrects arterial vasodilatation and hyperdynamic circulation in cirrhotic rats. Gastroenterology 109: 1624-1630, 1995[Medline].

31.   Pinzani, M., S. Milani, R. DeFranco, C. Grappone, A. Caligiuri, A. Gentilini, C. Tosti-Guerra, M. Maggi, P. Failli, C. Ruocco, and P. Gentilini. Endothelin 1 is overexpressed in human cirrhotic liver and exerts multiple effects on activated hepatic stellate cells. Gastroenterology 110: 534-548, 1996[Medline].

32.   Ramasamy, S., S. Parthasarathy, and D. Harrison. Regulation of endothelial nitric oxide syntase gene expression by oxidized linoleic acid. J. Lipid Res. 39: 268-276, 1998[Abstract/Free Full Text].

33.   Redmond, E., P. Cahill, and J. Sitzmann. Flow-mediated regulation of endothelin receptors in cocultured vascular smooth muscle cells: an endothelium-dependent effect. J. Vasc. Res. 34: 425-435, 1997[Medline].

34.   Rockey, D., L. Fouassier, J. Chung, A. Carayon, P. Vallee, C. Rey, and C. Housset. Cellular localization of endothelin-1 and increased production in liver injury in the rat: potential for autocrine and paracrine effects on stellate cells. Hepatology 27: 472-480, 1998[Medline].

35.   Rubanyi, G. M., and M. A. Polokoff. Endothelins: molecular biology, biochemistry, pharmacology, physiology and pathophysiology. Pharmacol. Rev. 46: 325-351, 1994[Medline].

36.   Sikuler, E., D. Kravetz, and R. J. Groszman. Evolution of portal hypertension and mechanisms involved in its maintenance in a rat model. Am. J. Physiol. 248 (Gastrointest. Liver Physiol. 11): G618-G625, 1985[Abstract/Free Full Text].

37.   Sogni, P., R. Moreau, A. Gadano, and D. Lebrec. The role of nitric oxide in the hyperdynamic circulatory syndrome associated with portal hypertension. J. Hepatol. 23: 218-224, 1995[Medline].

38.   Vallance, P., J. Collier, and S. Moncada. Effects of endothelium-derived nitric oxide on peripheral arteriolar tone in man. Lancet 2: 997-1000, 1989[Medline].


Am J Physiol Gastroint Liver Physiol 277(5):G944-G952
0002-9513/99 $5.00 Copyright © 1999 the American Physiological Society



This article has been cited by other articles:


Home page
J. Appl. Physiol.Home page
J. Zhang, Y. Ling, L. Tang, B. Luo, B. K. Chacko, R. P. Patel, and M. B. Fallon
Pentoxifylline attenuation of experimental hepatopulmonary syndrome
J Appl Physiol, March 1, 2007; 102(3): 949 - 955.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Herrera and J. L. Garvin
A high-salt diet stimulates thick ascending limb eNOS expression by raising medullary osmolality and increasing release of endothelin-1
Am J Physiol Renal Physiol, January 1, 2005; 288(1): F58 - F64.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
M. Herrera and J. L. Garvin
Endothelin stimulates endothelial nitric oxide synthase expression in the thick ascending limb
Am J Physiol Renal Physiol, August 1, 2004; 287(2): F231 - F235.
[Abstract] [Full Text] [PDF]


Home page
Eur Respir JHome page
A.T. Dinh-Xuan and R. Naeije
The hepatopulmonary syndrome: NO way out?
Eur. Respir. J., May 1, 2004; 23(5): 661 - 662.
[Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
B. Luo, L. Liu, L. Tang, J. Zhang, Y. Ling, and M. B. Fallon
ET-1 and TNF-{alpha} in HPS: analysis in prehepatic portal hypertension and biliary and nonbiliary cirrhosis in rats
Am J Physiol Gastrointest Liver Physiol, February 1, 2004; 286(2): G294 - G303.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. Schultz, X. Su, C.-C. Wei, S. P. Bishop, P. Powell, G. H. Hankes, A. R. Dillon, P. Rynders, F. G. Spinale, G. Walcott, et al.
Downregulation of ANG II receptor is associated with compensated pressure-overload hypertrophy in the young dog
Am J Physiol Heart Circ Physiol, February 1, 2002; 282(2): H749 - H756.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D. D. Ivy, I. F. McMurtry, M. Yanagisawa, C. E. Gariepy, T. D. Le Cras, S. A. Gebb, K. G. Morris, R. C. Wiseman, and S. H. Abman
Endothelin B receptor deficiency potentiates ET-1 and hypoxic pulmonary vasoconstriction
Am J Physiol Lung Cell Mol Physiol, May 1, 2001; 280(5): L1040 - L1048.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
E. P. Carter, K. Sato, Y. Morio, and I. F. McMurtry
Inhibition of KCa channels restores blunted hypoxic pulmonary vasoconstriction in rats with cirrhosis
Am J Physiol Lung Cell Mol Physiol, November 1, 2000; 279(5): L903 - L910.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, M.
Right arrow Articles by Fallon, M. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, M.
Right arrow Articles by Fallon, M. B.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online