|
|
||||||||
Departments of 1 Surgery and 2 Respiratory Medicine, Monash University Medical School, Alfred Hospital, Prahran, Victoria 3181, Australia
| |
ABSTRACT |
|---|
|
|
|---|
Prostaglandins play a critical role in gastric mucosal cytoprotection and decrease progressively with age. Cyclooxygenase (COX), the rate-limiting enzyme for prostaglandin synthesis, exists in two isoforms, COX-1 and COX-2. The rat COX-1 gene expresses an alternatively spliced mRNA COX-1 splice variant (SV) that may, at best, code for a truncated COX-1 protein. With the use of competitive PCR, we determined whether COX gene expression was altered in the stomach with increasing age and after gastric ulcer induction. COX-1 mRNA was significantly reduced in the aged, and COX-1SV mRNA was significantly higher in the adults compared with the young and aged stomach. Levels of COX-1 and COX-2 were similarly expressed in the normal stomach. In acute gastric ulcers, only COX-2 mRNA levels were significantly elevated. When ulcers were undergoing healing and repair, COX-1 and COX-2 mRNA levels were significantly elevated. Age-related changes in COX-1 and COX-1SV but not COX-2 mRNA may alter gastric mucosal cytoprotection. Furthermore, COX-1 and COX-2 may both contribute to the healing of a gastric ulcer.
splice variant; competitive PCR; gene expression; gastric ulcer; ulcer healing
| |
INTRODUCTION |
|---|
|
|
|---|
AGING IS ASSOCIATED WITH FUNCTIONAL and morphological changes in the stomach (15). In particular, prostaglandins (PGs), which protect the gastric mucosa against injury, decrease progressively with age in humans (4, 5) and rats (22). The suppression of PG synthesis by nonsteroidal anti-inflammatory drugs (NSAIDs) through the inhibition of the enzyme cyclooxygenase (COX) is a major component underlying gastric damage (39). Epidemiological data suggest that aging may be an independent risk factor for the development of NSAID-induced gastric injury (2, 21, 36). Two isoforms of COX have been identified, COX-1 and COX-2, which are products of different genes sharing 60% identity at the amino acid level (11). COX-1 is considered to be the constitutive isoform, and prostanoids synthesized via the COX-1 pathway are responsible for a variety of physiological functions, including cytoprotection of the stomach (42). In contrast, COX-2 is an inducible immediate-early gene associated with inflammation (40, 43), ovulation (7), and carcinogenesis (33). It is, however, important to emphasize that both COX-1 and COX-2 mRNA are constitutively expressed in a variety of human tissues, including the stomach, small intestine, kidney, and brain (18, 27, 31, 44). There is also evidence of COX-1 mRNA inducibility in vitro and in vivo (3, 10).
Standard NSAIDs (predominant COX-1 inhibitors) are initiators of gastric ulceration and delay ulcer healing (34, 36). Selective COX-2 inhibitors spare the gastrointestinal tract from injury (24), but, like their COX-1 counterparts, they impair ulcer healing (25). To elucidate the role of COX in gastric damage, investigators have demonstrated COX-1 and COX-2 expression in acetic acid-induced rodent gastric ulcers. Elevated levels of COX-2 mRNA and protein were found in acute ulcers, which correlated well with the degree of mucosal injury (25). This suggests that PGs produced through COX-2 are important in promoting wound healing. Interestingly, a role for COX-1 in the regulation of stem cell proliferation and wound repair was indicated when COX-1, but not COX-2, mRNA expression increased in regenerating mouse intestinal stem cells after radiation injury (3).
The COX-1 gene expresses an alternatively spliced mRNA COX-1 splice variant (SV) that was cloned from an immortalized rat tracheal epithelial cell line (17). COX-1SV does not code for a full-length protein, and it is not known whether a truncated protein is synthesized. This alternatively spliced mRNA is the same length as that encoding COX-1 and only distinguishable in the first 150 bp, in which a sequence thought to originate from the second intron is substituted for the first two exons. In rat tracheal epithelial cells, >90% of total COX-1 mRNA was identified as COX-1SV (17). No other study has investigated COX-1SV mRNA expression. COX-1 expression has been examined in the rat using Northern blot analysis, RNAse protection, or RT-PCR techniques with primers and/or probes designed downstream of the splice junction (8-10, 16, 25, 37). However, none of these techniques allows distinction between COX-1 and COX-1SV mRNA. It is well established that alternative splicing is biologically significant (1). Furthermore, if COX-1SV mRNA is present and unaccounted for, it will lead to an overestimation of functional COX-1 mRNA that codes for functional protein.
The objective of this study was to investigate the effect of aging on COX gene expression in the normal rat stomach. COX-1 is considered to be expressed constitutively. However, COX-1SV has never been identified or measured in vivo and it is not known whether the ratio of COX-1 to COX-1SV changes under different physiological or inflammatory conditions. Therefore, we also investigated the expression and inducibility of COX-1, COX-1SV, and COX-2 in experimentally induced acute gastric ulcers.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Tissue collection.
Experiments were approved by the Monash University Animal
Experimentation and Ethics Committee. Male Sprague-Dawley rats of three
different age groups, young (9 wk, 310 ± 6 g), adult (12 mo, 628 ± 19 g), and aged (24 mo, 717 ± 33 g) had access to rat chow (GR2+
pellets; Clark King, Melbourne, Australia) and water ad libitum.
Animals were maintained on 12:12-h light-dark cycles and fasted (24 h)
before each experiment in which tissue was collected. Rats were
anesthetized by intraperitoneal injection of pentobarbital (pentobarbitone) sodium, and acute gastric ulcers were induced in young
and adult rats, as described previously (30). Briefly, the stomach was
exposed via a midline incision and acetic acid (100%, 50 µl) was
applied (25 s) to the serosal surface at the antral/corpus junction
using a tube (6-mm internal diameter). The acid was blotted dry, and
the incision was closed (day 0, ulcer induction). A
macroscopically visible ulcer was present at day 2 (acute
ulcer), and the defect was almost healed at day 12 and
completely healed at day 14. Animals were killed at day 2 or day 12, and the ulcerated area (mm2)
was determined under a stereo microscope (Olympus, Tokyo, Japan). Stomachs from untreated (control) rats of three different age groups
were also collected. Each stomach was removed, opened along the greater
curvature, and rinsed with saline before tissue collection. Wedges of
the stomach (mucosa, submucosa, muscle layer, and serosa) were
collected from the antral/corpus junction. Normal or ulcerated tissue
samples were divided into two; one was snap frozen in liquid nitrogen
(stored at
80°C), and the other was fixed in formalin for 14 h before processing.
RNA extraction. Total RNA was isolated from samples with the RNeasy mini kit (Qiagen, Melbourne, Australia). After tissue homogenization with RNeasy lysis buffer, samples were passed through a 21-gauge syringe 10 times to shear chromosomal DNA. The concentration of each 4-µl RNA sample was determined by capillary spectrophotometry (Helix, San Diego, CA) using a Cary 1 spectrophotometer (Varian, Melbourne, Australia).
Primers. For the specific detection of COX-1 mRNA, which is translated to functional COX-1 protein and COX-1SV using competitive PCR, primers must be designed to span the splice junction located in exons 1 and 2. We designed one set of primers downstream of the splice junction to detect total COX-1 mRNA (functional COX-1 and COX-1SV). A second set of primers were designed specifically to span the COX-1SV splice junction as demonstrated by Kitzler et al. (17). For each RNA sample, functional COX-1 mRNA was determined by subtracting COX-1SV mRNA from total COX-1 mRNA.
All primers and competitive templates were designed using Oligo 5.0 Primer Analysis software (National Biosciences, Plymouth, MI) and synthesized by Bresatec (Adelaide, Australia). The COX-1 primers were CCTTCCGTGTGCCAGATTAC (upper primer) and TCACCCGCCAGATAGTCAAC (lower primer), which amplify a 645-bp product. The COX-1SV primers were AGCAGGCCCAACGGGAGATG (upper primer) and CTGCTTCTTCCCTTTGGTTC (lower primer), which amplify a 445-bp product. The COX-2 primers were TGCCGGGTCTGATGATGTA (upper primer) and TTCAGGGAGAAGCGTTTGC (lower primer), which amplify a 535-bp product. PCR products were verified by sequencing and analysis using Basic Local Alignment search tool (National Centre for Biotechnology Information). COX-1SV primers gave a PCR product of predicted size, which was sequenced in both directions. The sequence downstream of the splice junction was identical to that of rat COX-1, and the sequence upstream of the splice junction matched that reported by Kitzler et al. (17).Construction of competitors. Competitive templates for COX-1, COX-1SV, and COX-2 were designed by PCR-mediated mutagenesis. Each competitive template is 20-30% shorter yet otherwise identical to the target sequence, to allow distinction and quantitation of the amplified sequences. Briefly, for the COX-1 competitor, reverse transcription of 1 µg RNA in 20 µl was performed as for samples, except that 0.75 µM of the COX-1 lower primer was utilized instead of 2.5 units random hexamers. A composite primer, CCTTCCGTGTGCCAGATTACTTGCCATTTTAGGATGCTGA, that incorporated the COX-1 upper primer was designed to create a 197-bp deletion. The COX-1 composite primer was used in the primary PCR with 2 µl of cDNA and a thermocycling program of 94°C for 8 min, then 35 cycles of 94°C for 1 min, 60°C for 1 min, 72°C for 1 min, 72°C for 7 min, and 4°C for 1 min. A 1-µl aliquot of the 448-bp PCR product was diluted 1/100, and a secondary PCR was performed with COX-1 upper and lower primers with the previous thermocycling program for 40 cycles. The final PCR product was purified using the QIAquick PCR purification kit (Qiagen) and quantitated using a capillary spectrophotometer. The COX-1 competitor (448 bp) was diluted in 10 mM Tris · HCl, pH 7.5, to the required competitor copies. COX-1SV (445 bp) and COX-2 (357 bp) competitors were made in the same way. The COX-1SV composite primer, AGCAGGCCCAACGGGAGATGTCGGGCCCCAACTGTA, which incorporated the COX-1SV upper primer, was designed to create a 108-bp deletion. The COX-2 composite primer, TGCCGGGTCTGATGATGTATTCGACCCAGACCTGCTTT, which incorporated the COX-2 upper primer, was designed to create a 197-bp deletion.
Reverse transcription. Up to 1 µg of RNA was reverse transcribed in a volume of 20 µl containing 1 × GeneAmp PCR buffer, 5 mmol/l MgCl2, 1 mmol/l dNTP, 1 unit RNase inhibitor, 2.5 units murine leukemia virus RT, and 2.5 units random hexamers (all from Perkin-Elmer). Reactions were incubated at 15°C for 1 min, and the temperature was increased to 42°C over 9 min followed by 42°C for 1 h, 85°C for 5 min, and 4°C for 1 min in a thermal cycler (MJ Research, Watertown, MA).
Competitive PCR. Each aliquot of cDNA used in the three competitive PCR assays originated from the same reverse transcription reaction. Competitive PCR was performed using 2 µl (for COX-1), 4 µl (for COX-1SV), and 2 µl (for COX-2) cDNA in a total volume of 50 µl per reaction. The reaction consisted of 2 units AmpliTaq Gold, 1 × GeneAmp PCR Buffer, 2.5 mmol/l MgCl2, and 200 µmol/l dNTP (all from Perkin-Elmer), 0.2 µmol/l of upper and lower primers, and 1,000 (COX-1), 100 (COX-1SV), or 10,000 (COX-2) copies of competitor. The thermocycling program was 94°C for 8 min, then 40 cycles of 94°C for 1 min, 60°C for 1 min, 72°C for 1 min, 72°C for 7 min, and 4°C for 1 min. The PCR products were visualized on ethidium bromide-stained 2% agarose gels and then scanned using a FluorImager 575 (Molecular Dynamics, Sunnyvale, CA). PCR product band volumes were quantitated with ImageQuantNT software (Molecular Dynamics). Native-competitor product ratios were calculated, and the levels of gene expression were reported as copies of mRNA per microgram of total RNA.
Validation of competitive PCR. To ensure that competitor and target sequences compete equally in the PCR, increasing concentrations of each competitor were titrated against a constant aliquot of target cDNA known to be positive for the gene of interest.
Immunohistochemistry. Deparaffinized sections 3-µm thick were treated with 3% (vol/vol) H2O2 for 5 min and, after washing, were incubated with 20% (vol/vol) normal rabbit serum (NRS) in PBS for 30 min. The sections were incubated in PBS and 1% NRS with primary antibodies at 1:2,000 for COX-1 or COX-2 (polyclonal antiserum raised in a goat against the mouse COX-1 protein or the rat COX-2 protein; Santa Cruz Biotechnology, Santa Cruz, CA) overnight at 4°C. On each slide two sections were present; one was exposed to primary antiserum and one was exposed to PBS with 1% (vol/vol) NRS. After washing in PBS three times for 5 min, sections were incubated with rabbit anti-goat IgG (Dako) for 1 h at room temperature, washed with PBS, and incubated for a further 30 min with goat peroxidase-anti-peroxidase complex (1:60 in PBS and 1% NRS). After washing, sections were incubated with diaminobenzidine tetrahydrochloride (Sigma, St. Louis, MO) for 10 min, rinsed in distilled water for 5 min, counterstained with Harris hematoxylin (Sigma) for 15 s, and then rehydrated and mounted.
Statistical analysis. Values are expressed as means ± SE. Differences between groups were compared using the Mann-Whitney U nonparametric test.
| |
RESULTS |
|---|
|
|
|---|
Competitive PCR: quantitative analysis.
When increasing amounts of COX-2 competitor were titrated against a
constant aliquot of target cDNA (Fig.
1A), the changing ratio generated
from the experimental data closely followed the expected values (Fig.
1B). Thus both the COX-2 competitor and the COX-2 target
sequence show similar amplification efficiencies and compete equally in
the PCR. COX-1 (Fig. 1C) and COX-1SV (Fig. 1D) changing
input ratio experiments showed similar results.
|
|
COX mRNA expression in the normal rat stomach with increasing age.
COX-1 was significantly reduced in the aged rat stomach (mean = 1.1 × 104 copies/µg RNA; P < 0.001) compared
with young (mean = 1.96 × 104 copies/µg RNA) and
adult (mean = 2 × 104 copies/µg RNA) rats (Fig.
3A). COX-1SV (Fig. 3B) was
significantly higher in the adult rats (mean = 1.6 × 103 copies/µg RNA; P < 0.05) compared with
young and aged rats (mean = 6 × 102 copies/µg RNA).
|
COX mRNA expression in day 2 and day 12 ulcers.
Young and adult rats developed acute ulcers of similar size when
examined two days after ulcer induction (mean = 20 ± 4.3 mm2). Twelve days after induction, ulcers from young and
adult rats were undergoing healing and repair, with a size of 2 ± 0.95 mm2. In day 2 ulcers, COX-1 mRNA levels from
young and adult rats were similar to those observed in controls (mean
2 × 104 copies/µg RNA), whereas in day
12 ulcers a significant (3.5-fold) elevation in COX-1 mRNA (mean = 6.8 × 104 copies/µg RNA) was observed (Fig.
4A). COX-1SV mRNA levels did not
change in ulcer tissue (Fig. 4B). However, adult rats expressed significantly more COX-1SV than young rats, consistent with the results
observed in control rats (Fig. 3).
|
Histological assessment and immunohistochemical localization of COX-1 and COX-2 in experimentally induced acute gastric ulcers. The ulcer model used in this study results in the production of penetrating well-defined ulcers that consistently heal within 14 days of induction. Therefore, by definition these ulcers undergo an acute inflammatory reaction and only become chronic in the presence of a damaging stimulus that delays healing. This model has been incorrectly classified previously as a chronic ulcer model (19, 30). It is also important to note that Mizuno et al. (25) and Takahashi et al. (37) demonstrated COX expression in gastric ulcers using a different acetic acid ulcer model. This involved injecting 20% acetic acid into the gastric subserosa of the stomach; the ulcers produced by this method took 30 days to heal. In humans, chronic peptic ulcers are characterized by tissue damage, acute inflammation, granulation tissue formation, and attempts at fibrous repair (41). These events proceed concurrently in humans rather than sequentially as demonstrated in rodent ulcer models.
Histological examination of tissues revealed a lesion penetrating the full thickness of the gastric wall (mucosa to serosa) two days after serosal acetic acid application. Acute inflammation was observed that was characterized by the production of a protein-rich fluid exudate infiltrated by leukocytes (predominantly neutrophils). Necrotic tissue was also present at this stage, whereas gastric tissue around the ulcer margin remained unchanged. COX-2-positive cells were demonstrated immunohistochemically in the infiltrating cells and were absent in the gastric glands of the ulcer margin (Fig. 5A), whereas COX-1-immunopositive cells were absent at this stage (Fig. 5B). Adjacent to the lesion, we observed immunoreactive COX-1 in the gastric glands and mucous neck cells, as demonstrated by Iseki (13) in the normal gastric mucosa, whereas COX-2-immunopositive cells were located in the fibroblasts of the serosa (data not shown).
|
| |
DISCUSSION |
|---|
|
|
|---|
We have reported the mRNA expression of COX-1, COX-1SV, and COX-2 in the rat stomach using competitive PCR. In histologically normal specimens from rats of three different age groups, COX-1 and COX-1SV levels were variably expressed, whereas COX-2 mRNA remained unchanged. This is the first study that has distinguished COX-1 and COX-1SV mRNA in vivo, and although COX-1SV levels were somewhat lower than those observed for COX-1, previous studies would have reported additive results. Our findings also demonstrate that reduced COX-1 mRNA may contribute to reduced levels of gastric mucosal cytoprotection in aged rats. Surprisingly, COX-1 and COX-2 mRNA were expressed at similar copy numbers in the stomach of young rats. Furthermore, only COX-1 and COX-2 mRNA levels were differentially expressed during acute gastric ulceration and healing, indicating that both isoforms contribute to this process. Both COX isoforms were also immunolocalized to the fibroblasts of the granulation tissue in ulcers undergoing healing and repair.
Aging may be an independent risk factor for the development of gastric injury in humans and rodents (22, 36). After submucosal injections of acetic acid or aspirin, aged rats have increased susceptibility to mucosal injury and gastric ulcerations (22, 38). Gastric mucosal PG, but not leukotriene formation, decreases with increasing age in the rat stomach, indicating that mucosal content of arachidonic acid in membrane phospholipids, the common precursor for PG and leukotriene biosynthesis, is unlikely to alter with increasing age (22). We have shown that COX-1, but not COX-2, mRNA is significantly reduced in the aged stomach. Therefore, reduced PG formation in aged rats may occur as a direct result of reduced COX-1 activity.
We observed elevated levels of COX-1SV mRNA in adult rats, and
alternative splicing has been demonstrated to change during aging in
other physiological systems (23). A biological role for COX-1SV has not
been established. COX-1SV mRNA can at best code for a truncated
protein, since it is missing the open reading frame normally located in
exon 1 (17). Attempts by these previous investigators to assay for
COX-1SV protein by Western blotting were hindered by low levels of
protein expression and the lack of a specific COX-1 antibody. In
addition, induction of COX-1 mRNA levels by serum-treated 3T3 cells
showed no concomitant increase in COX-1 protein, suggesting specific
induction of COX-1SV (6). Recently, Western blot analysis of rat and
mouse stomach lysates in three separate studies (11, 14, 25) have
demonstrated two distinct COX-1 protein bands: a 72-kDa band
corresponding to the full-length COX-1 protein and a second 50- to
60-kDa unidentified protein that may be a good candidate for COX-1SV.
Alternative splicing for a large variety of cytokines and growth
factors has been described (1). In chicken embryo fibroblasts, the
COX-2 gene has a mRNA containing an unspliced intron, which on
mitogenic stimulation is removed, resulting in fully spliced COX-2 mRNA (43). The human interleukin-4 (IL-4) gene expresses a splice variant,
IL-4
2, that has been identified as an IL-4-receptor antagonist (12).
Therefore, alternative splicing has potentially important biological
roles in physiological systems. To date, the role of COX-1SV remains
unknown and will only be established if COX-1SV mRNA codes for an
alternative COX-1 protein.
We have demonstrated similar levels of COX-1 and COX-2 mRNA in young histologically normal rat stomachs. Iseki (13) demonstrated strong immunoreactivity for COX-1 in the mucous neck cells of the gastric gland, and COX-2 was immunolocalized to the surface mucous cells in both the fundic and pyloric regions of the stomach. Elsewhere, under physiological conditions or in unstimulated cell lines, COX-2 is considered to be undetectable or expressed at low levels. With the use of Northern blot analysis (37) and semiquantitative RT-PCR (25), COX-2 mRNA was not detected in the normal stomach of rodents yet was highly elevated in gastric ulcers. In situations where the mucosa is inflamed or damaged, COX-2 can increase to levels of 20-fold or higher (29). When comparing samples with extremely varied COX-2 levels, low or undetectable mRNA expression in normal tissues may be attributed to the low sensitivity or the detection limit of the assay utilized. Interestingly, the COX-2 inhibitor NS-398 did not reduce PGE2 levels in the normal stomach of rats (37), suggesting that COX-1 is the predominant isoform. However, it is possible that NS-398 is reducing the PGE2 levels produced through COX-2 and at the same time increasing the levels of PGE2 produced through COX-1. Our study is in accord with previous findings demonstrating COX-1 and COX-2 mRNA transcripts (27) and proteins (13, 45) in the normal human and rat stomach. Together, these findings demonstrate that COX-1 is not the predominant isoform expressed and implicate a physiological role for COX-2 in the normal stomach.
The 3'-untranslated region of COX-2 contains several copies of the Shaw-Kamen instability sequence (9, 43). These sequences are found in many immediate-early genes and confer enhanced mRNA degradation (35). Under normal physiological conditions, COX-2 mRNA transcripts are prone to degrading rapidly, whereas COX-1 mRNA is more stable, indicating that PGs derived from COX-1 may predominate even when transcripts from COX-1 and COX-2 are coexpressed. Both of the COX isoforms have been located in the endoplasmic reticulum (28). Additionally, COX-2 is located in the nuclear membrane, where it is ideally positioned to participate in mitogenesis under physiological or pathophysiological conditions (26, 32).
We also investigated the role of COX-1 and COX-1SV during ulcer induction, healing, and repair. Two days after experimentally induced gastric ulceration, acute inflammation occurred, which was characterized by the production of a protein-rich fluid exudate infiltrated by leukocytes (predominantly neutrophils) and COX-2, but no COX-1, -immunopositive cells were present in the infiltrating cells. Consistent with previous studies (25, 37) we observed significantly elevated COX-2 mRNA levels in young rats with acute gastric ulcers. COX-1 and COX-1SV mRNA expression remained unchanged at this stage. When ulcers were undergoing healing and repair, COX-2 mRNA was reduced yet still above that of normal gastric tissue. This corresponded with an elevation of COX-1 mRNA in healing ulcers, with no alteration in COX-1SV mRNA. Immunoreactive COX-1 and COX-2 were localized to the fibroblasts of the granulation tissue, and COX-1 was also located in the gastric glands. Thus, like COX-2, COX-1 may contribute to the late stage of gastric ulcer healing. The differences observed between this and previous studies, which demonstrated constitutive COX-1 mRNA expression during ulcer healing and repair (25, 37), may be due to the distinct ulcer models used. Furthermore, the roles for COX-1 and COX-2 in chronic human peptic ulceration, in which the injurious agent (usually gastric acid) persists and hinders the repair sequence, remain to be determined. The results of the present study are consistent with the findings that predominant COX-1 inhibitors delay ulcer healing in rodents and humans (34, 36). A role for COX-1 in wound repair has also been demonstrated in regenerating mouse intestinal stem cells after radiation injury (3).
With gene knockout technology, mice unable to express either COX-1 or COX-2 have been developed and show surprisingly little gastrointestinal pathology (7, 20). The PGE2 levels in the stomach of COX-1-null mice represented <1% of the levels observed in wild-type mice. In this model compensation by COX-2 is unlikely, due to the low levels of PGE2 and the inability to detect COX-2 protein in the COX-1-deficient mice (20). This is in contrast to our demonstration of relatively high levels of COX-2 mRNA in the stomach, in which COX-2 mRNA appears to be increasing with age, whereas COX-1 mRNA is significantly decreased. It is important to note that knockout mice that lack a functional COX-1 or COX-2 gene in utero develop to adulthood without the gene of interest; thus the effects observed in such mice may be a result of adaptation or differences initiated during development. Conditional gene targeting may be a way to circumvent this issue. Furthermore, it is possible that mice heterozygous for one or both COX isoforms may more closely mimic the effects observed by NSAIDs.
The results of the present study suggest that both COX isoforms play a physiological role in the stomach and that decreased expression of COX-1 mRNA may contribute to the development of gastric injury in the aging rat. The exact mechanisms involved in the regulation of COX-1 alternative splicing have yet to be established. COX-1SV mRNA is differentially expressed in the aging stomach but is not induced after acute gastric injury. Finally, the differential expression of COX-1 and COX-2 during gastric ulceration and healing suggests that each enzyme makes a separate and important contribution in the concerted effort to heal a gastric ulcer.
| |
ACKNOWLEDGEMENTS |
|---|
We would like to thank C. Malcontenti-Wilson for animal handling assistance and Dr. L. A. Salamonsen (Prince Henry's Institute of Medical Research, Victoria, Australia) and Prof. Kerin O'Dea (Institute of Public Health and Health Services, Victoria, Australia) for critical reading of the manuscript.
| |
FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Address for reprint requests and other correspondence: D. Vogiagis, Dept. of Surgery, Monash Univ. Medical School, Alfred Hospital, Prahran, Victoria 3181, Australia.
Received 11 November 1999; accepted in final form 5 January 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Atamas, S.
Alternative splice variants of cytokines
making a list.
Life Sci
61:
1105-1112,
1997[ISI][Medline].
2.
Bak Andersen, I,
Bonnevie O,
Jorgensen T,
and
Sorensen T.
Time trends for peptic ulcer disease in Denmark, 1981-1993.
Scand J Gastroenterol
33:
260-266,
1998[ISI][Medline].
3.
Cohn, S,
Schloemann S,
Tessner T,
Siebert K,
and
Stenson W.
Crypt stem cell survival in the mouse intestinal epithelium is regulated by prostaglandins synthesized through cyclooxygenase-1.
J Clin Invest
99:
1367-1379,
1997[ISI][Medline].
4.
Cryer, B,
Lee E,
and
Feldman M.
Factors influencing gastroduodenal mucosal prostaglandin concentrations in humans: relationship with gastric acid secretion.
Ann Intern Med
116:
636-640,
1992.
5.
Cryer, B,
Redfern J,
Goldshmiedt M,
Lee E,
and
Fledman M.
Effect of aging on gastric and duodenal mucosal prostaglandin concentrations in humans.
Gastroenterology
102:
1118-1123,
1992[ISI][Medline].
6.
De Witt, D,
and
Meade E.
Serum and glucocorticoid regulation of gene transcription and expression of prostaglandin H synthase-1 and prostaglandin H synthase-2 isozymes.
Arch Biochem Biophys
306:
94-102,
1993[ISI][Medline].
7.
Dinchuk, J,
Car B,
Focht R,
Johnston J,
Jaffee B,
Covington M,
Contel N,
Eng V,
Collins R,
Czerniak P,
Gorry S,
and
Trzaskos J.
Renal abnormalities and an altered inflammatory response in mice lacking cyclooxygenase II.
Nature
378:
406-409,
1995[Medline].
8.
DuBois, R,
Radhika A,
Reddy B,
and
Entingh A.
Increased cyclooxygenase-2 levels in carcinogen-induced rat colonic tumours.
Gastroenterology
110:
1259-1262,
1996[ISI][Medline].
9.
Feng, L,
Sun W,
Xia Y,
Tang W,
Chanmugam P,
Soyoola E,
Wilson C,
and
Hwang D.
Cloning two isoforms of rat cyclooxygenase: differential regulation of their expression.
Arch Biochem Biophys
307:
361-368,
1993[ISI][Medline].
10.
Ferraz, J-G,
Sharkey K,
Reuter B,
Asfaha S,
Tigley A,
Brown M,
McKnight W,
and
Wallace J.
Induction of cyclooxygenase 1 and 2 in the rat stomach during endotoxemia: role in resistance to damage.
Gastroenterology
113:
195-204,
1997[ISI][Medline].
11.
Fletcher, B,
Kujubu D,
Perrin D,
and
Herschman H.
Structure of the mitogen-inducible TIS10 gene and demonstration that the TIS10 encoded protein is a functional prostaglandin G/H synthase.
J Biol Chem
267:
4338-4344,
1992
12.
Glare, E,
Divjak M,
Rolland J,
and
Walters E.
Asthmatic airway biopsy specimens are more likely to express the IL-4 alternative splice variant IL-4
2.
J Allergy Clin Immunol.
104:
978-982,
1999[ISI][Medline].
13.
Iseki, I.
Immunocytochmical localization of cyclooxygenase-1 and cyclooxygenase-2 in the rat stomach.
Histochem J
27:
323-328,
1995[ISI][Medline].
14.
Kargman, S,
Charleson S,
Cartwright M,
Frank J,
Riendeau D,
Mancini J,
Evans J,
and
O'Neill G.
Characterization of prostaglandin G/H synthase 1 and 2 in rat, dog, monkey and human gastrointestinal tracts.
Gastroenterology
111:
445-454,
1996[ISI][Medline].
15.
Kimura, K.
Chronological transition of the fundic-pyloric border determined by stepwise biopsy of the lesser and greater curvatures of the stomach.
Gastroenterology
63:
584-592,
1972[ISI][Medline].
16.
Kishimoto, Y,
Wada K,
Nakamoto K,
Kawasaki H,
and
Hasegawa J.
Levels of cyclooxygenase-1 and -2 mRNA expression at various stages of acute gastric injury induced by ischemia-reperfusion in rats.
Arch Biochem Biophys
352:
153-157,
1998[ISI][Medline].
17.
Kitzler, J,
Hill E,
Hardman R,
Reddy N,
Philpot R,
and
Eling T.
Analysis and quantitation of splicing variants of the TPA-inducible PGHS-1 mRNA in rat tracheal epithelial cells.
Arch Biochem Biophys
316:
856-863,
1995[ISI][Medline].
18.
Komhoff, M,
Grone H-J,
Klein T,
Seyberth H,
and
Nusing R.
Localization of cyclooxygenase-1 and -2 in adult and fetal human kidney: implication for renal function.
Am J Physiol Renal Physiol
272:
F460-F468,
1997
19.
Konturek, S,
Stachura J,
Radecki T,
Drozdowicz D,
and
Brzozowski T.
Cytoprotective and ulcer healing properties of prostaglandin E2, colloidal bismuth and sucralfate in rats.
Digestion
38:
103-113,
1987[ISI][Medline].
20.
Langenbach, R,
Morham S,
Tiano H,
Loftin C,
Ghanayem B,
Chulada P,
Mahler J,
Lee C,
Goulding E,
Kluckman K,
Kim H,
and
Smithies O.
Prostaglandin synthase 1 gene disruption in mice reduces arachidonic acid-induced inflammation and indomethacin-induced gastric ulceration.
Cell
83:
483-492,
1995[ISI][Medline].
21.
Lee, M.
Prevention and treatment of nonsteroidal anti-inflammatory drug-induced gastropathy.
South Med J
88:
507-513,
1995[ISI][Medline].
22.
Lee, M,
and
Feldman M.
Age-related reductions in gastric mucosal prostaglandin levels increase susceptibility to aspirin-induced injury in rats.
Gastroenterology
107:
1746-1750,
1994[ISI][Medline].
23.
Magnuson, V,
Young M,
Schattenberg D,
Mancini M,
Chen D,
Steffensen B,
and
Klebe R.
The alternative splicing of fibronectin pre-mRNA is altered during aging and in response to growth factors.
J Biol Chem
266:
14654-14662,
1991
24.
Masferrer, J,
Zweifel B,
Manning P,
Hauser S,
Leahy K,
Smith W,
Isakson P,
and
Seibert K.
Selective inhibition of inducible cyclooxygenase 2 in vivo is antiinflammatory and nonulcerogenic.
Proc Natl Acad Sci USA
91:
3228-3232,
1994
25.
Mizuno, H,
Sakamoto C,
Matsuda K,
Wada K,
Uchida T,
Noguchi H,
Akamatsu T,
and
Kasuga M.
Induction of cyclooxygenase 2 in gastric mucosal lesions and its inhibition by the specific antagonist delays healing in mice.
Gastroenterology
112:
387-397,
1997[ISI][Medline].
26.
Morita, I,
Schindler M,
Regier M,
Otto J,
Hori T,
DeWitt D,
and
Smith W.
Different intracellular locations for prostaglandin endoperoxide H synthase-1 and -2.
J Biol Chem
270:
10902-10908,
1995
27.
O'Neill, G,
and
Ford-Hutchinson A.
Expression of mRNA for cyclooxygenase-1 and cyclooxygenase-2 in human tissues.
FEBS Lett
330:
156-160,
1993[ISI][Medline].
28.
Otto, J,
and
Smith W.
The orientation of endoperoxide synthases-1 and -2 in the endoplasmic reticulum.
J Biol Chem
269:
19868-19875,
1994
29.
Pairet, M,
and
Engelhardt G.
Distinct isoforms (COX-1 and COX-2) of cyclooxygenase: possible physiological and therapeutic implications.
Fundam Clin Pharmacol
10:
1-15,
1996[ISI][Medline].
30.
Penney, A,
Andrews F,
and
O'Brien P.
Effects of misoprostol on delayed ulcer healing induced by aspirin.
Dig Dis Sci
39:
943-939,
1994.
31.
Peri, K,
Hardy P,
Li D,
Varma D,
and
Chemtob S.
Prostaglandin G/H synthase-2 is a major contributor of brain prostaglandins in newborn.
J Biol Chem
270:
24615-24620,
1995
32.
Regier, M,
De Witt D,
Schnider M,
and
Smith W.
Subcellular localization of prostaglandin endoperoxide synthase-2 in murine 3T3 cells.
Arch Biochem Biophys
301:
439-444,
1993[ISI][Medline].
33.
Ristimaki, A,
Honkanen N,
Jankala H,
Sipponen P,
and
Harkonen M.
Expression of cyclooxygenase-2 in human gastric carcinoma.
Cancer Res
57:
1276-1280,
1997
34.
Schmassmann, A,
Peskar B,
Stettler C,
Netzer P,
Stroff T,
Flogerzi B,
and
Halter F.
Effects of inhibition of prostaglandin endoperoxide synthase-2 in chronic gastro-intestinal ulcers models in rats.
Br J Pharmacol
123:
795-804,
1998[ISI][Medline].
35.
Shaw, G,
and
Kamen R.
A conserved AU sequence from the 3'-untranslated region of GM-CSF mRNA mediates selective mRNA degradation.
Cell
46:
659-667,
1986[ISI][Medline].
36.
Soll, A,
Weinstein W,
Kurata J,
and
McCarthy D.
Nonsteroidal antiinflammatory drugs and peptic ulcer disease.
Ann Intern Med
114:
307-319,
1991.
37.
Takahashi, S,
Shigeta J-I,
Inoue H,
Tanabe T,
and
Okabe S.
Localization of cyclooxygenase-2 and regulation of its mRNA expression in gastric ulcers in rats.
Am J Physiol Gastrointest Liver Physiol
275:
G1137-G1145,
1998
38.
Uchida, M,
Kawano O,
Misaki N,
Saitoh K,
and
Irino O.
Healing of acetic acid-induced gastric ulcer and gastric mucosal PGI2 level in rats.
Dig Dis Sci
35:
80-85,
1990[ISI][Medline].
39.
Vane, J.
Inhibition of prostaglandin synthesis as a mechanism of action for aspirin-like drugs.
Nature
231:
232-234,
1971.
40.
Vane, J,
Mitchell J,
Appleton I,
Tomlinson A,
Bishop-Bailey D,
Croxtall J,
and
Willoughby D.
Inducible isoforms of cyclooxygenase and nitric-oxide synthase in inflammation.
Proc Natl Acad Sci USA
91:
2046-2050,
1994
41.
Wheater, P,
Burkitt H,
Stevens A,
and
Lowe J
(Editors).
Basic Histopathology. Edinburgh: Churchill Livingstone, 1985, p. 17-35.
42.
Whittle, B,
Higgs G,
Eakins K,
Moncada S,
and
Vane J.
Selective inhibition of prostaglandin production in inflammatory exudates and gastric mucosa.
Nature
284:
271-273,
1980[Medline].
43.
Xie, W,
Chipman J,
Robertson D,
Erison R,
and
Simmons D.
Expression of a mitogen-responsive gene encoding prostaglandin synthase is regulated by mRNA splicing.
Proc Natl Acad Sci USA
88:
2692-2696,
1991
44.
Yamagata, K,
Andreasson K,
Kaufmann W,
Barnes C,
and
Worley P.
Expression of a mitogen-inducible cyclooxygenase in brain neurons: regulation by synaptic activity and glucocorticoids.
Neuron
11:
371-386,
1993[ISI][Medline].
45.
Zimmermann, K,
Serbia M,
Schror K,
and
Weber-A A.
Consitutive cyclooxygenase-2 expression in healthy human and rabbit gastric mucosa.
Mol Pharmacol
54:
536-540,
1998
This article has been cited by other articles:
![]() |
B. Kis, J. A. Snipes, and D. W. Busija Acetaminophen and the Cyclooxygenase-3 Puzzle: Sorting out Facts, Fictions, and Uncertainties J. Pharmacol. Exp. Ther., October 1, 2005; 315(1): 1 - 7. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Haworth, K. Oakley, N. McCormack, and A. Pilling Differential Expression of COX-1 and COX-2 in the Gastrointestinal Tract of the Rat Toxicol Pathol, February 1, 2005; 33(2): 239 - 245. [Abstract] [Full Text] [PDF] |
||||
![]() |
H K Baumgartner, O T Starodub, J S Joehl, L Tackett, and M H Montrose Cyclooxygenase 1 is required for pH control at the mouse gastric surface Gut, December 1, 2004; 53(12): 1751 - 1757. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. L. Simmons, R. M. Botting, and T. Hla Cyclooxygenase Isozymes: The Biology of Prostaglandin Synthesis and Inhibition Pharmacol. Rev., September 1, 2004; 56(3): 387 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Vogiagis, W. Brown, E. M. Glare, and P. E. O'Brien Rat colorectal tumours treated with a range of non-steroidal anti-inflammatory drugs show altered cyclooxygenase-2 and cyclooxygenase-1 splice variant mRNA expression levels Carcinogenesis, June 1, 2001; 22(6): 869 - 874. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |