AJP - GI Watch the video to see how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 278: G930-G936, 2000;
0193-1857/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (25)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oates, P. S.
Right arrow Articles by Morgan, E. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oates, P. S.
Right arrow Articles by Morgan, E. H.
Vol. 278, Issue 6, G930-G936, June 2000

Gene expression of divalent metal transporter 1 and transferrin receptor in duodenum of Belgrade rats

Phillip S. Oates, Carla Thomas, Elizabeth Freitas, Matthew J. Callow, and Evan H. Morgan

Department of Physiology, University of Western Australia, Nedlands 6907, Western Australia, Australia


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Regulation of iron absorption is thought to be mediated by the amount of iron taken up by duodenal crypt cells via the transferrin receptor (TfR)-transferrin cycle and the activity of the divalent metal transporter (DMT1), although DMT1 cannot be detected morphologically in crypt cells. We investigated the uptake of transferrin-bound iron by duodenal enterocytes in Wistar rats fed different levels of iron and Belgrade (b/b) rats in which iron uptake by the transferrin cycle is defective because of a mutation in DMT1. We showed that DMT1 in our colony of b/b rats contains the G185R mutation, which in enterocytes results in reduced cellular iron content and increased DMT1 gene expression similar to levels in iron deficiency of normal rats. In all groups the uptake of transferrin-bound iron by crypt cells was directly proportional to plasma iron concentration, being highest in iron-loaded Wistar rats and b/b rats. We conclude that the uptake of transferrin-bound iron by developing enterocytes is largely independent of DMT1.

Nramp2; regulation; HFE; transferrin; absorption; iron


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

RECENT STUDIES INDICATE that the uptake phase of iron absorption by the enterocyte involves the recently cloned divalent metal transporter 1 (DMT1) (14, 21). This is based on the finding that in mice with microcytic anemia (mk) and Belgrade rats (b/b), both of which share a common missense mutation of the DMT1 (G185R) (14, 15), iron uptake by the intestine is severely reduced (8, 26). Supporting this finding, duodenal villus enterocytes from genetically normal animals fed an iron-deficient diet show increased expression of DMT1 that localizes to the microvillus membrane and is associated with increased uptake of iron (5, 36).

Also, in b/b rats the transport of iron across the endosomal membrane as part of the transferrin cycle is severely impaired, which in reticulocytes reduces iron acquisition and hemoglobin synthesis (4, 9, 10, 18). Because DMT1 and transferrin colocalize to cycling endosomes this suggests that DMT1 also plays a role in the transport of iron out of the endosomes (20, 35). The transferrin cycle is thought to operate in the intestinal epithelial cells, particularly in the crypt region as shown by the expression of transferrin receptor (TfR) mRNA (22, 25) and the uptake of transferrin-bound iron (1, 28). However, recent studies have failed to detect DMT1 protein in the crypt region irrespective of iron loading (5, 36). This suggests that either the amount of DMT1 required to carry out the transfer of iron across the endosome is small and at levels that cannot be detected by immunohistochemistry or DMT1 is not required by crypt cells for the uptake of transferrin-bound iron.

In addition, TfR is known to colocalize with the hemochromatosis (HFE) protein in the crypt region (2, 29, 37). HFE has been shown to play a role in iron absorption, as evidenced by the increased absorption that results from its mutation (C282Y) (11), knockout (38), or lack of association with beta 2-microglobulin (12). Transfection of HFE and TfR into cell lines was shown to reduce the assimilation of iron by the cells (13, 19, 24, 31, 33), but the significance of this finding in terms of the regulation of iron absorption is unclear. Whatever the mode of action of HFE is, it appears that it is a slow process requiring days before a change in body iron stores, presumably in crypt cells, results in a new level of iron absorption once these cells have matured into villus enterocytes (6, 7).

In view of the above observations, we thought it important to confirm that the G185R mutation exists in b/b animals of our colony and then to examine the role of DMT1. In addition, because of the central role thought to be played by the transferrin cycle in the regulation of iron absorption, we questioned the involvement of DMT1 in this process because it cannot be detected morphologically (5, 36). Therefore, we measured the assimilation of iron from intravenously injected transferrin-bound iron in b/b rats, arguing that this will be reduced if DMT1 is required. Because any change in the uptake of transferrin-bound iron by the transferrin cycle can be explained either by a change in expression of TfR or DMT1 or by a combination of both, we determined the level of gene expression of DMT1 and TfR along the crypt-villus axis of the duodenum of b/b rats and Wistar rats with variations in iron stores.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Animals

Genetically normal 6-wk-old male Wistar rats were obtained from the Animal Resources Centre (Murdoch, Western Australia). Belgrade rats were originally obtained from Dr. John A. Edwards (Dept. of Medicine, State University of New York, Buffalo, NY) and maintained at the Biological Sciences Animal Unit at the University of Western Australia. Belgrade rats were inbred, and the homozygous-anemic phenotype was identified by a low hematocrit, reticulocytosis, high plasma iron, and splenomegaly (4).

Diets and Treatments

All rats were fed a semipurified diet prepared according to the recommendations of the American Institute of Nutrition (3) and containing three levels of iron. The basic diet contained <10 mg/kg of iron and was defined as the iron-deficient diet. The control diet was this diet supplemented with 70 mg iron/kg given as ferrous ammonium sulfate, whereas the iron-loaded diet contained an additional 30 g/kg carbonyl iron (ISP Technologies, Wayne, NJ). These diets were given ad libitum to three groups of Wistar rats, whereas the b/b rats were fed the control diet only, for 8 wk. By this time, body iron stores are altered, as determined by measurement of liver iron stores (25).

Cloning and Sequencing of DMT1 in b/b Rats

One hundred micrograms of duodenal villus epithelium were taken from b/b rats and iron-deficient Wistar rats by scraping with a glass microscope slide. The RNA was isolated using the RNAazol B method (Tel-Test). In combination with a set of primers designed using the published sequences for the DMT1 cDNA (GenBank accession nos. AF008439 and AF029757) and the primer program produced by the Whitehead Institute (www.genome.wi.mit.edu/cgi-bin/primer/ primer3.cgi), a 941-bp PCR product was produced that included the mutation described in mk mice (14) and b/b rats (15) and comprised the following sequences: AGTGCTGCTCCAAACTGTGAGCTAAAATCC/ATTGGCTTCTCGAACTT- CCTGCTTATTGGC. The RT-PCR conditions consisted of first-strand cDNA synthesis at 48°C for 45 min (1 cycle) and denaturation at 94°C for 2 min (1 cycle). Second-strand synthesis consisted of denaturation at 94°C for 30 s, annealing at 60°C for 1 min, and extension at 68°C for 2 min (40 cycles; Promega RT-PCR kit). The PCR product was subcloned into pGEM-T Easy Vector (Promega), transformed, amplified, purified, and sequenced using the (-21)M13F and (-21)M13R Dye Primer Ready Reaction Sequencing kit (Perkin Elmer, Applied Biosystems Incorporated, Foster City, CA) at the Department of Clinical Immunology, Royal Perth Hospital (Perth, Australia).

Estimation of Uptake of Transferrin-Bound Iron and Transferrin by Crypt and Villus Cells

Rat transferrin was isolated from plasma and labeled with 59Fe and 125I as described elsewhere (17). One hundred microliters of 59Fe-125I-labeled diferric transferrin (2-3 mg/ml) were injected via a lateral tail vein. Puncture of the ventral tail vein and collection of blood into microhematocrit tubes were performed at timed intervals so that the rate of plasma clearance of 59Fe could be determined. The animals were killed 2 h later with an overdose of Nembutal, a final blood sample was taken by heart puncture, and the animals were then systemically perfused with 50 ml of heparinized saline. The proximal small intestine was removed, and the intestinal cells were isolated into 10 fractions as previously described (28). The cells in these fractions were washed three times in PBS to remove extracellular mucus and iron-transferrin and incubated with 1 mg/ml Pronase in PBS for 20 min on ice to separate membrane-bound from intracellular transferrin and iron (28). Fractions 2-4 and 7-10 were then pooled to provide villus and crypt cell fractions based on data presented previously (28). Two subfractions of the cells were removed from each of these fractions for the measurement of DNA (23), and the intracellular iron concentration of the cells was measured by atomic absorption spectrometry. The remaining cells were then centrifuged at 1,000 rpm for 5 min. The supernatant was collected, and the pellet was solubilized with 0.5 M NaOH. The radioactivity in each fraction (intracellular 125I and 59Fe), the supernatants (membrane-bound 125I and 59Fe), plasma samples, and standards was counted in a LKB-Wallac 1282 (Compu-gamma) gamma -scintillation counter. The uptake of 125I and 59Fe by enterocytes in villus and crypt fractions was calculated, taking both the plasma iron concentration and changing levels of plasma radioactivity into account (27).

cDNAs

cDNAs encoding the rat genes of TfR and DMT1 were linearized and used as described previously (25, 36).

Riboprobe Synthesis

Depending on the orientation of the cDNA inserts, sense and antisense riboprobes were synthesized using SP6 and T7 RNA polymerases and [35S]UTP-alpha S (~800 Ci/mmol) as the labels (New England Nuclear, Amrad), the Riboprobe in vitro transcription system (Promega), and 0.5 µg of linearized template.

Localization of DMT1 and TfR mRNAs by In Situ Hybridization

The first centimeter segment was removed from the proximal end of the duodenum, immediately fixed in buffered formal saline, and subsequently processed for paraffin embedding. Five-micrometer sections were processed for in situ hybridization as previously described (25). The slides were exposed for 1 wk before development of the silver grains. After development the sections were stained with hematoxylin and eosin.

Statistics

The results are expressed as means ± SE. Comparisons between groups were tested by analysis of variance and partitioning by the Tukey test using the InStat program (GraphPad Software). Significance is considered to be P < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Identification of b/b rats used in this study was based on reticulocytosis, low hematocrit, and splenomegaly. In the four b/b rats selected to clone DMT1, the mean hematocrit was 27 ± 5% compared with 45 ± 2.5% in Wistar rats and the spleen weight was 3.03 ± 0.51 g compared with 1.04 ± 0.01 g in control animals. Cloning and sequencing of DMT1 mRNA from these b/b rats revealed at codon 185 a consistent missense mutation consisting of GGAright-arrowAGA compared with the published sequence of DMT1 (AF008439 and AF029757) and also our wild-type rats (Fig. 1). This mutation results in a glycine-to-arginine substitution at codon 185 in DMT1.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1.   Sequencing chromatogram of a Wistar rat (A) and a Belgrade rat (B) showing codon 185 (underlined) and flanking sequence. This sequence shows that a missense mutation Gright-arrowA (arrow) exists in DMT1 of Belgrade rats, confirming the finding of Fleming et al. (15). This results in a substitution of a glycine to arginine amino acid at codon 185.

Iron Concentration of Crypt and Villus Enterocytes

The iron concentration in crypt cells was similar in control, iron-loaded, and b/b rats but was slightly reduced in iron-deficient rats (Fig. 2A).


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 2.   Iron concentration of crypt (A) and villus (B) cells in b/b rats fed a control diet and Wistar rats fed iron-deficient, normal (control), and iron-loaded diets for 8 wk. Results are means ± SE of 5 rats/group *Significantly different from all other groups tested.

The cellular iron concentration of villus enterocytes was equally low in b/b rats fed the standard diet and in Wistar rats fed the iron-deficient diet (Fig. 2B). Compared with these cells, there were 4- and 10-fold higher iron concentrations in villus cells of Wistar rats fed the standard and iron-loaded diets, respectively (Fig. 2B).

Uptake of Transferrin-Bound Iron by Villus and Crypt Enterocytes Is Proportional to Plasma Iron Concentrations

Plasma iron concentration in b/b rats maintained on the control diet was similar to that of iron-loaded rats (Fig. 3); these values were significantly greater than in Wistar rats fed the control diet. The plasma iron concentration of animals fed the iron-deficient diet was significantly lower than that of all other groups tested (Fig. 3).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 3.   Uptake of transferrin-bound iron (A) and transferrin (B) by villus (circles) or crypt (squares) epithelial cells 2 h after the intravenous injection of 59Fe-transferrin. The animals were Wistar rats fed normal (dark gray symbols), iron-deficient (black symbols), or iron-loaded (light gray symbols) diets or Belgrade rats (open symbols) fed a control diet throughout the experiment for 8 wk. Results are expressed as means ± SE for 6-12 rats.

An average of 85 ± 2% of the total 59Fe within each fraction was found in the cytosol of the cells as determined by the use of Pronase to release membrane-bound 59Fe. These values were similar for crypt and villus cells in all conditions studied.

The uptake of transferrin-bound iron into both villus and crypt cells was greatest in b/b and iron-loaded rats compared with controls and least in iron-deficient animals (Fig. 3A). There was a direct, strong correlation between plasma iron concentration and the uptake of iron by villus and crypt enterocytes, with crypt cells internalizing approximately double the amount of iron internalized by the corresponding villus cell population (Fig. 3A).

Uptake of 125I-Transferrin

Crypt cells. The uptake of 125I-transferrin was approximately equal in the crypt cells of the Wistar rats irrespective of the dietary iron treatment and plasma iron concentration (Fig. 3B). However, in b/b rats the uptake of 125I-transferrin was significantly greater than in the cells of Wistar rats (Fig. 3B).

Villus cells. In contrast, in villus cells from b/b rats the uptake of 125I-transferrin was between the values for cells from iron-deficient and control rats but was significantly greater than in villus cells of iron-loaded animals. Also, the uptake of 125I-transferrin was significantly greater in villus cells from iron-deficient rats compared with control and iron-loaded rats (Fig. 3B).

Uptake of Iron From Transferrin by Femur and Spleen is Significantly Lower in b/b Than in Wistar Rats

The uptake of transferrin-bound iron by the spleen and bone marrow in b/b rats was ~40% of that in Wistar rats fed the control diet. Therefore, the pattern of iron uptake differs markedly from that observed in the intestine of b/b rats, in which the uptake of transferrin-bound iron was approximately double that of Wistar rats fed the control diet (data not shown).

Gene Expression of TfR and DMT1

TfR. In b/b rats TfR mRNA was most strongly expressed in epithelial cells of the crypt region and crypt-villus junction (Fig. 4). The signal intensity then decreased markedly in the lower one-third of the villus and was below detection in epithelia at higher levels of the villus. This pattern of expression was similar to that reported for Wistar rats irrespective of the level of body iron stores (25).


View larger version (162K):
[in this window]
[in a new window]
 
Fig. 4.   Bright-field (A) and dark-field (B) photomicrographs of the mucosa of the duodenum after hybridization with a transferrin receptor (TfR) cRNA in b/b rats. Expression of TfR mRNA is highest in the upper half of the intestinal crypt epithelium but ceases distal to the crypt-villus junction. No TfR mRNA is seen in the upper two-thirds of the intestinal villus epithelium or in cells of the lamina propria. Some precipitation of hematoxylin can be seen in the villus region, which appears as dark and bright spots in bright-field and dark-field photomicroscopy, respectively This should not be considered as TfR mRNA signal. Magnification, ×250

DMT1 gene expression in crypt cells. In crypt epithelial cells DMT1 mRNA expression was either very low or below detection (Fig. 5).


View larger version (82K):
[in this window]
[in a new window]
 
Fig. 5.   Dark-field photomicrographs of the mucosa of the duodenum after hybridization with DMT1 cRNA in b/b rats (A) and normal Wistar rats fed an iron-deficient (B), control (C), or iron-loaded (D) diet. In the duodenum of b/b (A) and iron-deficient (B) rats, DMT1 mRNA is either very low or below detection in the crypt epithelium. However, in b/b (A) and iron-deficient (B) animals it starts to appear strongly and abruptly at the crypt-villus junction and remains constant within enterocytes of the lower four-fifths of the villus. In enterocytes of the upper one-quarter of the villus, activity falls but is still present. In comparison, DMT1 mRNA is observed in enterocytes of the lower two-thirds of the villus in the duodenum of control rats (C) at lower cellular intensity, whereas this is markedly lower in iron-loaded animals (D) and expression is restricted to the lower third of the villus. Magnification, ×250

DMT1 gene expression in villus cells. At the crypt-villus junction of b/b (Fig. 5A) and iron-deficient (Fig. 5B) Wistar rats, DMT1 mRNA abruptly became detectable at high levels in enterocytes and remained constant over the lower four-fifths of the villus. At the villus tip the signal intensity fell but was still above background (Fig. 5, A and B). This pattern of expression and signal intensity was similar in b/b and iron-deficient Wistar rats (compare Fig. 5A with Fig. 5B). In Wistar rats fed the control diet the signal intensity increased at the crypt-villus junction but not to the levels seen in enterocytes from b/b or iron-deficient rats (compare Fig. 5C with Fig. 5, A and B). In addition, DMT1 mRNA levels gradually fell in enterocytes of the upper one-third of the villus (Fig. 5C). In iron-loaded rats villus DMT1 mRNA expression was lower than control levels and much lower than in b/b and iron-deficient animals (compare Fig. 5D with Fig. 5, A-C) and was only detected in the lower third of the villi (Fig. 5D).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In this study we confirm the work of Fleming et al. (15) by detecting the presence of the G185R mutation encoding the iron transporter DMT1 in our colony of b/b rats. This G185R mutation in putative transmembrane domain 4 results in the substitution of a nonpolar amino acid for a larger basic residue, and in vitro studies reveal that its expression results in markedly reduced uptake of ferrous iron compared with the wild-type DMT1 (35). Also, in vivo studies showed that the uptake phase of iron absorption is affected, as evidenced by marked reductions in uptake of luminal iron (26) and, in this study, by reduced total cellular iron concentration of the enterocyte of b/b rats. It also appears that in b/b rats the loss of function of DMT1 is caused by a combination of increased degradation and defective iron transport by the residual protein rather than by diminished transcription because the amount and site of DMT1 mRNA expression were similar in b/b rats fed a normal diet and iron-deficient Wistar rats. This conclusion supports the work of Su et al. (35) in an in vitro investigation.

We found that TfR mRNA is localized to enterocytes of the crypt region in the duodenum and that as the cells migrate apically the message disappears at the crypt-villus junction, indicating the cessation of translation at this site. This finding in b/b rats supports our previous study (25) in Wistar rats that showed similar levels of TfR mRNA in crypt cells irrespective of the iron stores. These results support previous conclusions that in the crypt region of the duodenum the level of TfR gene expression is constant and controlled transcriptionally and not influenced by iron levels (5, 22). If this is correct, it provides an explanation for the data presented here on the uptake of intravenously injected transferrin-bound iron, which was linearly related to plasma iron concentration. As discussed previously (27), if the cellular expression of TfR remains constant irrespective of iron stores, then the assimilation of transferrin-bound iron by the intestine will reflect plasma iron concentration as was observed in the present study.

The ability to assimilate transferrin-bound iron by the transferrin-TfR cycle is thought to be, at least in part, dependent on the activity of DMT1. Early biochemical studies showed that the genetic defect in b/b rats leads to impairment of the transfer of iron from the endosome to the cytoplasm (4), which implies that DMT1, mutated in b/b rats, functions as the endosomal iron carrier. Also, in vitro studies showed that DMT1 colocalizes with transferrin both on the cell membrane and within cycling endosomes (20, 35). Other studies also show that the G185R mutation of DMT1 in mk and b/b rats results in severe anemia caused by diminished iron transport into developing erythroid cells (4, 9, 10, 18), and in vitro there is markedly diminished iron uptake compared with wild-type DMT1 (35). In view of this close association of TfR and DMT1 in the transferrin cycle we expected to observe DMT1 mRNA in the crypt region, where the transferrin cycle is most active (1, 28) as assessed by the assimilation of transferrin-bound iron (28). Furthermore, because of the impaired function of DMT1 in b/b rats we also postulated that there would be increased gene expression in the crypt cells of these animals, analogous to that seen in villus enterocytes with low iron. However, this was not the case. In b/b rats DMT1 gene expression was either absent or below detectable levels in the crypt region. This observation supports previous studies that show that DMT1 mRNA is absent from deep crypt cells (21, 36) and protein expression is not detectable throughout the crypt region of genetically normal rats (36) and mice (5) even with variation in iron loading. Hence, in the crypt region, either DMT1 is not required for the uptake of transferrin-bound iron or the techniques of in situ hybridization and immunohistochemistry are not sufficiently sensitive to detect the low levels of DMT1 required to assimilate iron from plasma transferrin.

To clarify the role of DMT1 in the transferrin cycle of intestinal epithelial cells, we injected radiolabeled transferrin-bound iron intravenously and then measured the uptake of iron by crypt and villus cells in b/b rats and Wistar rats with markedly altered iron stores. Surprisingly, we found that the ability to internalize transferrin-bound iron by these cells was as effective in b/b rats as in iron-loaded rats with a comparable plasma iron concentration. This is supported by the observation that the iron concentration of crypt cells of b/b rats was as high as that found in iron-overloaded Wistar animals. These results suggest that DMT1 is not required for the uptake of transferrin-bound iron by duodenal crypt epithelial cells.

The possibility must be considered that in b/b rats there is upregulation of DMT1 expression and activity to levels that compensate for the poor functional activity of the mutated DMT1 and make the transferrin cycle effective. However, this was not apparent in the crypt region, in which in situ hybridization failed to detect DMT1 mRNA in b/b rats. Therefore, to obtain a further perspective on this problem we measured the uptake of transferrin-bound iron by the bone marrow, in which erythropoiesis occurs and which is the major tissue dependent on the transferrin cycle for the supply of iron (80% of the plasma iron turnover per day is accounted for by this tissue). We argued that in b/b rats, if increased DMT1 and/or TfR expression were able to adequately compensate for the poor uptake of transferrin-bound iron resulting from impaired function of the mutated DMT1 then this is where it should be most obvious. This was not the case. In fact, iron assimilation by this tissue was reduced to 40%, whereas in intestine it was increased by 200% compared with Wistar rats with normal iron stores. Thus this direct comparison in the same animals of a defective transferrin cycle in bone marrow but no defect in the uptake of transferrin-bound iron by intestinal cells supports the conclusion that DMT1 is not required for uptake of transferrin-bound iron by crypt and villus cells and suggests the existence of a second carrier other than DMT1 that is involved in iron uptake from transferrin (32).

After isolation of crypt and villus cells we found significant amounts of radiolabeled transferrin within the cells even though incubation for ~90 min is required for the isolation of the cells (28). Because the transferrin cycling time in intestinal cells is normally ~30 min (1) our results suggest the existence of a very slow or noncycling pool of transferrin. Supporting this conclusion, Anderson and coworkers (1) found in chase experiments using isolated intestinal cells that 20% of transferrin internalized remained within the cell. However, in both studies it is unclear whether the transferrin in the slow-cycling pool of endosomes has released its iron and represents entrapped apotransferrin or represents endosomes containing ferrotransferrin. The slow pool may be involved in regulating iron absorption by way of the ferrotransferrin composition of the pool, which would vary in different states of iron loading, being high in diferric transferrin in iron overload and low in this form of transferrin in iron deficiency.

It is known that HFE is expressed in crypt cells, and by interacting with TfR, which has highest activity in this region, it is thought to regulate iron absorption (2, 29, 37). Thus the C282Y mutation of HFE results in inappropriately high iron absorption (11). It is clear that HFE and TfR interact (13, 19, 24, 33, 37), and in crypt cells this is associated with their colocalization to a supranuclear position (2, 29, 37). Also, in in vitro studies this interaction was shown to reduce the uptake of iron from transferrin (13, 19, 33, 37). Hence, a mutation of HFE, such as is seen in genetic hemochromatosis, that impairs its function would be expected to lead to increased uptake of transferrin-bound iron by the transferrin receptor. If this occurs in crypt cells, it is likely to lead to reduced, not increased, iron absorption (38). Thus an alternative explanation must be sought. One possibility is that HFE-TfR interaction is associated with and determines the size of the slow-cycling pool of transferrin. The release of iron from this pool could regulate the activity of iron-responsive proteins (IRPs), which in turn determines the efficiency of iron absorption by modulating the steady state of mRNAs responsive to IRPs, such as DMT1 and ferritin (Fn) in villus enterocytes (30, 34, 38).

We hypothesize that HFE interacts only with the slow-cycling endosomes and that this pool localizes to the perinuclear region in crypt cells. In this region HFE prevents transfer of iron from transferrin out of the endosomes, as has been shown for HeLa cells (33). However, at the crypt-villus junction HFE is degraded, leading to the release of iron from the endosome. The amount of iron released from this pool then determines the level of expression of genes such as DMT1 and Fn via IRP activity (30, 34, 38). Thus in the case of the C282Y HFE, the slow-moving pool is not established and therefore the cells respond as though iron deficient, and this is characterized by increased IRP activity (31). Similarly in b/b rats, although the endosomes are loaded with relatively large amounts of iron in the form of diferric transferrin, the DMT1 carrier that begins to operate at the crypt-villus junction is defective, leading to the release of relatively little iron. If this hypothesis is correct, it explains the perinuclear location of HFE and TfR in crypt cells and the delay between a change in iron status and a new level of efficiency of iron absorption, because time would be required for migration of the slow-moving cycling pool of endosomes to reach the crypt-villus junction, where its effects on DMT1, Fn expression, and other iron transport proteins are manifest. Finally, this hypothesis also provides an explanation of how the C282Y mutation may result in cellular iron deficiency rather than iron loading that in turn results in increased IRP activity. Thus the slow-cycling pool may contain the "messenger iron" that regulates iron absorption originally proposed by Crosby (7). Clearly, this hypothesis requires extensive testing.


    ACKNOWLEDGEMENTS

This work was supported by a grant from the National Health and Medical Research Council of Australia.


    FOOTNOTES

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Address for reprint requests and other correspondence: P. S. Oates, Dept. of Physiology, Univ. of Western Australia, Nedlands 6907, Western Australia, Australia (E-mail: poates{at}cyllene.uwa.edu.au).

Received 12 November 1999; accepted in final form 25 January 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Anderson, GJ, Powell LW, and Halliday JW The endocytosis of transferrin by rat intestinal epithelial cells. Gastroenterology 106: 414-422, 1994[Web of Science][Medline].

2.   Bastin, JM, Jones M, O'Callaghan CA, Schimanshi L, and Mason DY. Kupffer cell staining by a HFE-specific monoclonal antibody: implications for hereditary haemochromatosis. Br J Haematol 103: 931-941, 1998[Web of Science][Medline].

3.   Bieri, JG, Stoewsand GS, Briggs GM, Phillips RW, Woodard JC, and Knapka JJ. Report of the American Institute of Nutrition Ad Hoc committee on standards for nutritional studies. J Nutr 107: 1340-1348, 1977.

4.   Bowen, BJ, and Morgan EH. Anemia of the Belgrade rat: evidence for defective membrane transport. Blood 70: 38-44, 1987[Abstract/Free Full Text].

5.   Canonne-Hergaux, F, Gruenheid S, Ponka P, and Gros P. Cellular and subcellular localisation of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood 93: 4406-4417, 1999[Abstract/Free Full Text].

6.   Conrad, ME, Weintraub LR, and Crosby WH. The role of the intestine in iron kinetics. J Clin Invest 43: 963-974, 1964.

7.   Crosby, WH. The control of iron balance by the intestinal mucosa. Blood 22: 441-449, 1963[Abstract/Free Full Text].

8.   Edwards, JA, and Hoke JE. Defect of intestinal mucosal iron uptake in mice with hereditary microcytic anaemia. Proc Soc Exp Biol Med 141: 81-84, 1972[Medline].

9.   Edwards, JA, Sullivan AL, and Hoke JE. Defective delivery of iron to the developing red cell of the Belgrade laboratory rat. Blood 55: 645-648, 1980[Abstract/Free Full Text].

10.   Farcich, EA, and Morgan EH. Uptake of transferrin-bound and nontransferrin-bound iron by reticulocytes from the Belgrade rat. Am J Hematol 39: 9-14, 1992[Web of Science][Medline].

11.   Feder, JN, Gnirke A, Thomas W, Tsuchihashi Z, Ruddy DA, Basava A, Dormishian F, Domingo R, Ellis MC, Fullan A, Hinton LM, Jones NL, Kimmel BE, Kronmal GS, Lauer P, Lee VK, Loeb DB, Mapa FA, McClelland E, Meyer NC, Mintier GA, Moeller N, Moore T, Morikang E, Prass CE, Quintana L, Starnes SM, Schatzman RC, Brunke KJ, Drayna DT, Risch NJ, Bacon BR, and Wolf RK. A novel MHC class I-like gene is mutated in patients with hereditary haematochromatosis. Nat Genet 13: 399-408, 1996[Web of Science][Medline].

12.   Feder, JN, Tsuchihashi Z, Irrinki A, Lee VK, Mapa FA, Morikang E, Prass CE, Starnes SM, Wolff RK, Parkkila S, Sly WS, and Schatzman RC. The hemochromatosis founder mutation in HLA-H disrupts beta 2-microglobulin interaction and cell surface expression. J Biol Chem 272: 14025-14028, 1997[Abstract/Free Full Text].

13.   Feder, JN, Penny DM, Irrinke A, Lee A, Lebron JA, Watson N, Tsuchihashi Z, Sigal E, Bjorkman PJ, and Schatzman RC. The hemochromatosis gene product complexes with the transferrin receptor and lowers its affinity for ligand binding. Proc Natl Acad Sci USA 95: 1472-1477, 1998[Abstract/Free Full Text].

14.   Fleming, MD, Trenor CC, Su MA, Foernzler D, Beier DR, Dietrich WF, and Andrews NC. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 16: 383-386, 1997[Web of Science][Medline].

15.   Fleming, MD, Romano MA, Su MA, Garrick LM, Garrick MD, and Andrews NC. Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc Natl Acad Sci USA 95: 1148-1153, 1998[Abstract/Free Full Text].

16.   Fleming, RE, Migas MC, Zhou XY, Jiang J, Britton RS, Brunt EM, Tomatsu S, Waheed A, Bacon BR, and Sly WS. Mechanism of increased iron absorption in murine model of hereditary hemochromatosis: increased duodenal expression of the transporter DMT1. Proc Natl Acad Sci USA 96: 3143-3148, 1999[Abstract/Free Full Text].

17.   Gardiner, E, and Morgan EH. Transferrin and iron uptake by the liver in the rat. Aust J Exp Biol Med Sci 52: 723-736, 1974[Web of Science][Medline].

18.   Garrick, MD, Gniecko K, Liu Y, Cohen DS, and Garrick LM. Transferrin and the transferrin cycle in Belgrade rat reticulocytes. J Biol Chem 268: 14867-14874, 1993[Abstract/Free Full Text].

19.   Gross, CN, Irrinki A, Feder JN, and Enns CA. Co-trafficking of HFE, a nonclassical major histocompatibility complex class I protein, with the transferrin receptor implies a role in intracellular iron regulation. J Biol Chem 273: 22068-22074, 1998[Abstract/Free Full Text].

20.   Gruenheid, S, Canonne-Hergaux F, Gauthier S, Hackam DJ, Grinstein S, and Gros P. The iron transport protein NRAMP2 is an integral membrane glycoprotein that colocalises with transferrin in recycling endosomes. J Exp Med 189: 831-841, 1999[Abstract/Free Full Text].

21.   Gunshin, H, MacKenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Golan JL, and Hediger MA. Cloning and characterisation of a mammalian proton-coupled metal-ion transporter. Nature 388: 482-488, 1997[Medline].

22.   Jeffrey, GP, Basclain KA, and Allen TL. Molecular regulation of transferrin receptor and ferritin expression in the rat gastrointestinal tract. Gastroenterology 110: 790-800, 1996[Web of Science][Medline].

23.   Labarca, C, and Paigen K. A simple, rapid, and sensitive DNA assay procedure. Anal Biochem 102: 344-352, 1980[Web of Science][Medline].

24.   Lebron, JA, Bennett MJ, Vaughn DE, Chirino AC, Snow PM, Mintier GA, Feder JN, and Bjorkman PJ. Crystal structure of the hemochromatosis protein HFE and characterisation of its interaction with transferrin receptor. Cell 93: 111-123, 1998[Web of Science][Medline].

25.   Oates, PS, and Morgan EH. Effects of dietary iron loading with carbonyl iron and of iron depletion on intestinal growth, morphology, and expression of transferrin receptor in rats. Anat Rec 246: 364-371, 1996[Medline].

26.   Oates, PS, and Morgan EH. Defective iron uptake by the duodenum of Belgrade rats fed diets of different iron contents. Am J Physiol Gastrointest Liver Physiol 270: G826-G832, 1996[Abstract/Free Full Text].

27.   Oates, PS, and Morgan EH. Ferritin gene expression and transferrin receptor activity in intestine of rats with varying iron stores. Am J Physiol Gastrointest Liver Physiol 273: G636-G646, 1997[Abstract/Free Full Text].

28.   Oates, PS, Thomas C, and Morgan EH. Characterization of isolated duodenal epithelial cells along a crypt-villus axis in rats fed diets with different iron contents. J Gastroenterol Hepatol 12: 829-838, 1997[Web of Science][Medline].

29.   Pakkila, S, Waheed A, Britton RS, Feder JN, Tsuchihashi Z, Schatzman RC, Bacon BR, and Sly WS. Immunohistochemistry of HLA-H, the protein defective in patients with hereditary hemochromatosis, reveals unique pattern of expression in the gastrointestinal tract. Proc Natl Acad Sci USA 94: 2534-2539, 1997[Abstract/Free Full Text].

30.   Pietrangelo, A, Casalgrandi G, Quaglino D, Gualdi R, Conte D, Milani S, Montosi G, Cesarini L, Ventura E, and Cairo G. Duodenal ferritin synthesis in genetic hemochromatosis. Gastroenterology 108: 208-217, 1995[Web of Science][Medline].

31.   Riedel, HD, Muckenthaler MU, Gehrke SG, Mohr I, Brennan K, Herrmann T, Fitscher BA, Hentze MW, and Stremmel W. HFE downregulates iron uptake from transferrin and induces iron-regulatory protein activity in stably transfected cells. Blood 94: 3915-3921, 1999[Abstract/Free Full Text].

32.   Rolfs, A, and Hediger MA. Metal ion transporters in mammals: structure, function and pathological implications. J Physiol (Lond) 518: 1-12, 1999[Abstract/Free Full Text].

33.   Roy, CN, Penny DM, Feder JN, and Enns CA. The hereditary hemochromatosis protein, HFE, specifically regulates transferrin-mediated iron uptake in HeLa cells. J Biol Chem 26: 9022-9028, 1999.

34.   Schümann, K, Moret R, Kunzle H, and Kühn LC. Iron regulatory protein as an endogenous sensor of iron in rat intestinal mucosa. Eur J Biochem 260: 362-372, 1999[Web of Science][Medline].

35.   Su, MA, Trenor CC, Fleming JC, Fleming MD, and Andrews NC. The G185R mutation disrupts function of the iron transporter Nramp2. Blood 92: 2157-2163, 1998[Abstract/Free Full Text].

36.   Trinder, D, Oates PS, Thomas C, Sadleir J, and Morgan EH Localisation of DMT1 to the microvillus membrane of rat duodenal enterocytes in iron deficiency but to hepatocytes in iron overload. Gut 46: 270-276, 2000[Abstract/Free Full Text].

37.   Waheed, A , Parkkila S, Saarnio J, Fleming RE, Zhou XY, Tomatsu S, Britton RS, Bacon BR, and Sly WS. Association of HFE protein with transferrin receptor in crypt enterocytes of human duodenum. Proc Natl Acad Sci USA 96: 1579-1584, 1999[Abstract/Free Full Text].

38.   Zhou, XY, Tomatsu S, Fleming RE, Parkkila S, Waheed S, Jiang J, Fei Y, Brunt EM, Ruddy DA, Prass CE, Schatzman RC, O'Neill RO, Britton RS, Bacon BR, and Sly WS. HFE gene knockout produces mouse model of hereditary hemochromatosis. Proc Natl Acad Sci USA 95: 2492-2497, 1998[Abstract/Free Full Text].


Am J Physiol Gastrointest Liver Physiol 278(6):G930-G936
0193-1857/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K. Thompson, R. M. Molina, T. Donaghey, J. D. Brain, and M. Wessling-Resnick
Iron absorption by Belgrade rat pups during lactation
Am J Physiol Gastrointest Liver Physiol, September 1, 2007; 293(3): G640 - G644.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
C Thomas and P S Oates
Ferroportin/IREG-1/MTP-1/SLC40A1 modulates the uptake of iron at the apical membrane of enterocytes
Gut, January 1, 2004; 53(1): 44 - 49.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
W.-I. Leong, C. L Bowlus, J. Tallkvist, and B. Lonnerdal
Iron supplementation during infancy--effects on expression of iron transporters, iron absorption, and iron utilization in rat pups
Am. J. Clinical Nutrition, December 1, 2003; 78(6): 1203 - 1211.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
D Trinder, C Fox, G Vautier, and J K Olynyk
Molecular pathogenesis of iron overload
Gut, August 1, 2002; 51(2): 290 - 295.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Trinder, J. K. Olynyk, W. S. Sly, and E. H. Morgan
Iron uptake from plasma transferrin by the duodenum is impaired in the Hfe knockout mouse
PNAS, April 16, 2002; 99(8): 5622 - 5626.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
C. Thomas and P. S. Oates
IEC-6 Cells Are an Appropriate Model of Intestinal Iron Absorption in Rats
J. Nutr., April 1, 2002; 132(4): 680 - 687.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
O. Han and M. Wessling-Resnick
Copper repletion enhances apical iron uptake and transepithelial iron transport by Caco-2 cells
Am J Physiol Gastrointest Liver Physiol, March 1, 2002; 282(3): G527 - G533.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (25)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oates, P. S.
Right arrow Articles by Morgan, E. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oates, P. S.
Right arrow Articles by Morgan, E. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online