AJP - GI Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 279: G268-G276, 2000;
0193-1857/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (49)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shimada, K.
Right arrow Articles by Weinman, S. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shimada, K.
Right arrow Articles by Weinman, S. A.
Vol. 279, Issue 2, G268-G276, August 2000

Expression and canalicular localization of two isoforms of the ClC-3 chloride channel from rat hepatocytes

Kazuo Shimada1, Xinhua Li1, Guiyan Xu1, David E. Nowak1, Lori A. Showalter1, and Steven A. Weinman1,2

Departments of 1 Physiology and Biophysics and 2 Internal Medicine, University of Texas Medical Branch, Galveston, Texas, 77555


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The molecular identities of functional chloride channels in hepatocytes are largely unknown. We examined the ClC-3 chloride channel in rat hepatocytes and found that mRNA for two different isoforms is present. A short form is identical to the previously reported sequence for rat ClC-3, and a long form contains a 176-bp insertion immediately upstream of the translation initiation site. This predicts a 58-amino acid NH2 terminal insertion. Both long and short form mRNA was expressed in diverse tissues of the rat. Transient transfection of the long form in CHO-K1 cells resulted in currents with an I- > B- > Cl- selectivity sequence, outward rectification, and inactivation at positive voltages. Short form currents had identical ionic selectivity but displayed a more extreme outward rectification and showed no voltage-dependent inactivation. Immunofluorescence and immunoblots localized native ClC-3 preferentially but not exclusively to the canalicular membrane. We have therefore identified a new isoform of rat ClC-3 and shown that expression of both isoforms produces functional channels. In hepatocytes, ClC-3 is located in association with the canalicular membrane.

ion channels; liver; CHO-K1 cells; canalicular membrane


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

CHLORIDE CHANNELS ARE WIDELY distributed in mammalian cells and serve important functions. Hepatocytes have a high basal permeability to chloride, and electrophysiological studies have identified chloride channels in sinusoidal membranes (11), canalicular membranes (23), and several different intracellular compartments (1, 8). Hepatocyte chloride channels are involved in cell volume regulation, control of plasma membrane electrical potential, and acidification of the endocytic pathway. They have also been postulated to play a role in bile formation and cholestasis as well as in response to cell injury (29, 30).

Chloride channels of the ClC family are expressed in diverse tissues (12), and mutations of these channels produce several genetic diseases, including myotonia congenita for ClC-1 (15), hereditary nephrocalcinosis (Dent's disease) for ClC-5 (21), and a knockout mouse model of nephrogenic diabetes insipidus for ClC-K1 (18). The ClC chloride channels are thus important to cell function, but the precise functions and even properties of each are largely unknown. ClC-0, ClC-1, ClC-2, and ClC-5 have all been reproducibly expressed in different expression systems and produce characteristic chloride currents (12, 28). Other family members, such as ClC-6 and ClC-7, have not been reproducibly expressed. For ClC-3, expression has been reported by two different groups (6, 13), but its observed properties differ in these systems.

Our ultimate goal is to determine the role of ClC-3 in hepatocyte chloride permeability. In the course of these studies we identified two forms of ClC-3 in hepatocytes. We now report expression studies showing that both of these forms produce channels and that their properties differ in a way that may provide insight into the domains of the channel responsible for gating. We also examined the subcellular localization of ClC-3 and show that the channel is preferentially localized to the canalicular membrane of hepatocytes.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

RNA isolation. Total RNA was isolated from hepatocytes, liver, kidney, and lung tissue by liquid phase separation using the Ultraspec RNA isolation kit (Biotecx, Houston, TX) according to the manufacturer's instructions. Poly(A)+ mRNA was prepared from total RNA using the Oligotex mRNA kit (Qiagen, Chatsworth, CA). Total RNA from rat brain and heart was a generous gift from Dr. H. Saito (University of Texas Medical Branch, Galveston, TX).

RT-PCR. RT-PCR was performed by the methods described previously (25). For the synthesis of the single-stranded cDNA, 4 µg of total RNA from each sample was reverse transcribed using an oligo(dT) primer and 200 units of SuperScript II reverse transcriptase (Gibco BRL, Gaithersburg, MD). Aliquots of the synthesized cDNA (3 µl) were amplified in a Genemate thermal cycler (ISC Bioscience) with 2.5 units of Taq DNA polymerase (Gibco BRL). For identification of ClC-3, primers were designed to amplify a segment from 251 to 1104 (sense, TAGAGCCGGAGATTGAACT; antisense, CCACTTTCCCAAGTAACCTC) for 31 cycles with an elongation temperature of 52°C. Reaction products were separated by electrophoresis using a 1.5% agarose gel. The identity of PCR products was confirmed by predicted size of the amplified products and determination of restriction fragment lengths with restriction sites specifically selected for the predicted amplified sequence. Southern blotting analysis was performed using specific 32P-labeled cDNA probes prepared by the random priming method. The intensity of each band was measured by the LYNX 5000 Image Analyzer (Applied Imaging, Santa Clara, CA). Glyceraldehyde-3-phosphate dehydrogenase (Ambion) was used as a control.

Preparation of ClC-3 expression vectors. Full-length ClC-3 transcripts were prepared by PCR with a mixture of Taq and Pfu polymerases (TaqPlus Precision PCR system, Stratagene, La Jolla, CA) using primers designed to insert a 5' BamH 1 site and a 3' FLAG sequence followed by a Xho 1 site. The PCR products were resolved on agarose gels, extracted with the Wizard PCR purification system (Promega), ligated into pcDNA3.1+ (Invitrogen), and sequenced using eight sequencing primers by the University of Texas Medical Branch sequencing facility. Multiple clones were sequenced for each isoform, and the correct sequences were confirmed.

Transfection. CHO-K1 cells were cultured in DMEM-F-12 medium and grown on glass coverslips. Cells were transfected at 40-60% confluency with the long form or short form ClC-3 cDNA using FuGENE 6 (Boehringer Mannheim) according to the suggested procedures. To identify transfectants, a green fluorescent protein (GFP) construct (pEGFP, Clontech) was cotransfected at a ClC-3-to-GFP ratio of 30:1. Cells expressing GFP fluorescence at 40-70 h were selected for experiments.

Isolation of hepatocytes. Isolated hepatocytes from male Sprague-Dawley rats were prepared by two-step collagenase perfusion of the liver as previously described (23). Trypan blue exclusion was used to assess viability, which ranged from 90 to 95%. The hepatocytes were allowed to attach to collagen-coated glass coverslips and were cultured for 4 h at 37°C in L-15 medium, containing 10% vol/vol fetal bovine serum (FBS), penicillin (200 U/ml), and streptomycin (0.2 mg/ml).

Immunofluorescence. Transfected CHO-K1 cells were fixed with methanol at -20°C for 10 min, washed in PBS, and incubated with the m2 anti-FLAG monoclonal antibody (Sigma) (1:1,500) in 10% goat serum for 60 min. Coverslips were washed for 2 h with PBS and then incubated with Alexa 594-conjugated goat anti-mouse IgG (Molecular Probes) at a dilution of 1:500 for 30 min. After washing for 45 min, coverslips were mounted and observed in a Nikon epifluorescence microscope at excitation wavelength of 590 and emission wavelength of 630 nm.

A polyclonal rabbit antibody prepared against a glutathione-S-transferase (GST) fusion protein of ClC-3 (residues 592-661) was purchased from Alomone Labs. This antibody has been shown to be specific for ClC-3 and not to cross-react with the closely related proteins ClC-4 or ClC-5 (22). For immunofluorescence, hepatocytes were cultured on glass coverslips and fixed and permeabilized in methanol for 10 min at -20°C. The coverslips were incubated with anti-ClC-3 antibody at a dilution of 1:200 in 10% goat serum at 4°C for 16 h. After washing in PBS for 30 min, the coverslips were further incubated for 1 h at room temperature with an Alexa 488-conjugated goat anti-rabbit IgG at a dilution of 1:500 in 10% goat serum, followed by another washing in PBS for 30 min. The coverslips were then mounted with FluorSave (Calbiochem) solution and observed in a Nikon Eclipse E800 epifluorescence microscope. Parallel incubations were performed using primary antibody that had been preabsorbed with a 10:1 (by weight) excess of the GST-ClC-3 fusion protein used to generate the antibody. Cryosections were obtained from freshly killed rat liver. Immunostaining was performed using the same protocol as for hepatocytes, except that the secondary antibody was Alexa 594-conjugated goat anti-rabbit IgG (Molecular Probes).

Membrane preparation and Western blotting. Crude canalicular and basolateral membranes were prepared from a single rat liver by a modification of the method of Song et al. (26). Rats (150-200 g) were fasted overnight and killed with CO2. The liver was perfused with Hanks' buffer followed by perfusion with ice-cold 1 mM NaHCO3. The liver was minced and homogenized in 2 volumes of NaHCO3 with 15 strokes of a Dounce homogenizer with a loose-fitting pestle. Homogenate was diluted with 200 ml of NaHCO3, filtered through cotton cheesecloth, and centrifuged at 1,500 g for 10 min. Pellet was resuspended in NaHCO3 equal to the original wet weight of the liver, to which 5.5 volumes of 56% (wt/wt) sucrose were added. Suspension was applied as the bottom layer of a discontinuous sucrose gradient (56%, 42%, 38%) and centrifuged at 66,000 g for 60 min at 4°C. Enriched canalicular membranes were collected from the upper interface and typically yielded 1.2 mg/10 g liver. Canalicular enrichment in this preparation was confirmed by immunoblotting for ectoATPase. Basolateral membrane fraction was collected from the lower interface, further centrifuged in a second discontinuous gradient as above, and stored at -80°C.

Membrane protein (200 µg) was electrophoresed on 10% SDS-PAGE and transferred to nitrocellulose membranes. Membranes were blocked overnight at 4°C in Tris-buffered saline, pH 7.5, with 5% milk-0.1% Tween 20, and then incubated for 1 h at room temperature with ClC-3 antibody at a dilution of 1:500 or with ClC-3 antibody that had been preabsorbed with a 10:1 excess of the GST-ClC-3 fusion protein used to generate the antibody. Detection was performed by chemiluminescence with peroxidase-labeled anti-rabbit IgG using the ECL Plus system (Amersham).

Patch clamp. Whole cell patch clamp was performed at room temperature as previously described (19). Borosilicate glass micropipettes (catalogue no. 1B150F-6; WP Instruments, Sarasota, FL) were pulled with a multistep pull on a Flaming-Brown micropipette puller (model P-87; Sutter Instrument, Novato, CA) and were fire polished to final tip resistance of 3.5-5 MOmega when filled with pipette solution and immersed in bath solutions. Currents were measured using a patch-clamp amplifier (Axopatch 200; Axon Instruments, Foster City, CA) and filtered at 2 kHz. pCLAMP software (v. 6.03; Axon Instruments) was used to generate the command voltages and process the acquired data. Sampling rates varied according to different protocols. Liquid junction potentials were measured with a flowing 3 M KCl junction and current-voltage curves corrected appropriately. Only records with a series resistance increase of <50% after formation of the whole cell were included. GFP-expressing cells were visualized with epifluorescence on a Nikon Diaphot microscope and patch clamped immediately. Bath solution contained (in mM): 114 NaCl, 5.4 CsCl, 1 MgSO4, 1.5 CaCl2, 10 HEPES, and 10 glucose, pH 7.4, adjusted with NaOH. Preliminary experiments demonstrated that spontaneous activation of large, chloride-selective currents was a common phenomenon, even in nontransfected cells. This appeared to be a consequence of cell swelling, which occurred when cells were transferred from a relatively hyperosmotic culture medium (DMEM-F-12 with 10% FBS, ~350 mosmol/kgH2O) to the standard patch-clamp bath solution (300 mosmol/kgH2O). Dilution of the culture medium with water to an osmolality of 300 mosmol/kgH2O eliminated this spontaneous activation.

Osmolality was measured with a vapor-pressure osmometer (model 5500; Wescor, Logan, UT). Bath solution was adjusted to 300 mosmol/kgH2O by adding sucrose. Hypotonic bath solutions were the same, except that the osmolality was 240 mosmol/kgH2O by omitting sucrose. For determination of anion selectivity, NaCl was substituted with NaI or NaBr in bath solutions. Pipette solution contained (in mM): 120 CsCl, 3 MgSO4, 1 CaCl2, 11 EGTA, 3 Na2ATP, 10 HEPES, and 10 glucose, pH 7.2, using CsOH. Osmolality was adjusted to 290 mosmol/kgH2O with sucrose. Data are presented as means ± SE. Outward membrane conductance (G+50,+80) was calculated over the voltage interval from +50 to +80 mV. The rectification factor was the ratio of outward to inward conductance (G+50,+80/G-80,-50). Comparisons were made by unpaired t-test using SigmaStat software.

Animal care. All animals were treated in accordance with the guidelines established by the Animal Care and Use Committee of the University of Texas Medical Branch (Protocol 89-11-239).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Isoforms of ClC-3 mRNA expression. ClC-3 has previously been shown to be expressed in diverse tissues, including liver (14). We initially examined ClC-3 mRNA expression in hepatocytes by RT-PCR with primers spanning the predicted translation initiation site. This amplification always yielded two products. Southern blot analysis confirmed that both products specifically hybridized to a ClC-3 probe (Fig. 1A). The two PCR products were subcloned and sequenced. The smaller 853-bp product corresponded to the published sequence of rat ClC-3 (originally derived from a rat kidney cDNA library) (14). The longer 1,029-bp fragment contained a 176-bp insertion that created a longer open reading frame (ORF) that predicted a 58-amino acid addition at the NH2 terminus of the protein (Fig. 2). This predicted sequence was almost identical to a similar sequence at the NH2 terminus of mouse, rabbit, and human ClC-3. To confirm that full-length long and short form mRNA species are both transcribed in hepatocytes, we used RT-PCR with a proofreading polymerase to amplify the entire predicted 2.7-kb ORF for ClC-3. Again, two products were obtained (Fig. 1B), and sequence analysis confirmed that full-length mRNAs are expressed for both long and short forms of ClC-3. The full sequence of the ClC-3 long form ORF is available as GenBank accession no. AF142778.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 1.   Two PCR products for ClC-3. A: RT-PCR performed with primers spanning the translation initiation site produced the expected shorter product as well as a longer product. Southern blotting using the short product as a probe showed that both products hybridized. B: RT-PCR was performed with primers designed to amplify the full-length coding region of ClC-3. Again, two products corresponding to the long and short forms of ClC-3 were obtained.



View larger version (44K):
[in this window]
[in a new window]
 
Fig. 2.   Sequence of ClC-3 long form. A: 176-bp insert is shaded. B: predicted amino acid sequences of the NH2 terminal portion of ClC-3 molecules. The full-length sequence of the newly identified rat ClC-3 long form (*) is available as GenBank accession no. AF142778. ORF, open reading frame.

We next used RT-PCR to determine whether both long and short forms are present in various rat tissues. The results are presented in Fig. 3 and show that all of the tissues examined expressed both forms. The long form predominates in every tissue, but the short form is relatively more abundant in liver, kidney, and lung than it is in heart and brain.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 3.   RT-PCR of long and short form ClC-3 expression in various rat tissues. Total RNA (4 µg) from the indicated tissues was reverse transcribed, and PCR was performed for ClC-3 as described in EXPERIMENTAL PROCEDURES. The ratios of long form to short form were: liver, 3.0; kidney, 2.5; lung 2.9; heart, 3.9; cerebral cortex, 4.1; cerebellum 4.7; and olfactory bulb, 3.5.

Heterologous expression in CHO-K1 cells. Expression vectors for both the short and long form were prepared by RT-PCR of the ClC-3 sequence from rat liver RNA and ligation into pcDNA3.1. A FLAG epitope was inserted at the COOH terminus, predicted to be an intracellular domain. These constructs were then transiently transfected into CHO-K1 cells. Cotransfection with a GFP expression vector was used to identify transfected cells. To examine the extent of ClC-3 expression and determine whether simultaneous GFP expression correctly identified ClC-3-expressing cells, we performed immunofluorescence with the anti-FLAG antibody. Figure 4A demonstrates the immunofluorescence pattern of ClC-3-expressing cells. In the ClC-3-GFP cotransfections, GFP-positive cells (green fluorescence) were also positive for ClC-3 immunostaining (red fluorescence). In the GFP-only transfections, many cells were positive for the green GFP fluorescence, but none of these cells showed red fluorescence (data not shown). The localization of ClC-3 immunofluorescence for both the long and short forms is demonstrated in Fig. 4B. There was extensive immunostaining intracellularly as well as on the plasma membrane.


View larger version (81K):
[in this window]
[in a new window]
 
Fig. 4.   Immunofluorescence of ClC-3. CHO-K1 cells were cotransfected with the FLAG-ClC-3 construct and green fluorescence protein (GFP), and the expressed protein was localized by immunofluorescence. A: separate observation for GFP fluorescence (right, FITC wavelengths) and anti-FLAG immunofluorescence (left, Texas red wavelengths) confirms that GFP is a marker for ClC-3 expression. B: anti-FLAG immunofluorescence images of cells expressing either short (left) or long form (right) of ClC-3.

Functional expression of ClC-3 long and short forms. To examine the functional expression of ClC-3 channels, the whole cell voltage clamp technique was used. From a holding potential of 0 mV, pulses of -80 to +80 mV induced identical small amplitude currents in both untransfected CHO-K1 and GFP-only-transfected cells (Fig. 5A). The mean conductance from +50 to +80 mV was 24 ± 3 pS/pF (n = 18) and remained stable for at least 30 min. No cells exhibited conductance of >50 pS/pF. In contrast, a large proportion of ClC-3 long form- or short form-transfected cells exhibited large outwardly rectifying currents (Fig. 5, B and C). Long form-transfected cells showed currents of >80 pS/pF in 28 of 56 patches, with a mean conductance of 255 ± 56 pS/pF (n = 28). For ClC-3 short form, an even greater proportion of cells (24 of 37) exhibited large conductances (185 ± 24 pS/pF; n = 24). Additionally, Fig. 5D demonstrates that the ClC-3 short form channel currents have stronger outward rectification with rectification factors (G+50,+80/G-80,-50) for short form, long form, and control of 8.5 ± 0.8, 3.8 ± 0.3 (P < 0.01), and 1.5 ± 0.2 (P < 0.01), respectively.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 5.   Chloride channel currents from ClC-3 long form- and short form-transfected CHO-K1 cells. Whole cell patch clamp traces of CHO-K1 cells transfected with GFP only (A), ClC-3 long form (B), and ClC-3 short form (C) are shown. From a 0-mV holding potential, cells were clamped in 10-mV step increments between -80 and +80 mV. Data plotted as current-voltage curves (D); n = 18 (control), 24 (long form), and 28 (short form) cells. Vertical bars represent standard errors.

To determine whether the presence of GFP alters channel properties, we performed some patch-clamp experiments with cells transfected with the ClC-3 short form vector alone. Outwardly rectifying currents were seen in five cells, which were identical to those in the ClC-3-GFP cotransfected cells. The yield of these experiments was lower due to the difficulty in identifying transfected cells, and therefore all other experiments were performed with cotransfected cells.

Properties of long and short form currents. It has been widely noted that volume-activated chloride channels inactivate slowly at very positive voltages (27). Since ClC-3 has been proposed as a candidate for these swelling-activated channels (6), we tested inactivation kinetics of the ClC-3 isoforms by using 2-s pulses over the voltage range from -100 to +100 mV (Fig. 6). Like the volume-activated current, ClC-3 long form displayed slow inactivation at voltage pulses of >60 mV (20 of 20 cells examined). In contrast, the short form never displayed voltage-dependent inactivation (n = 16). We further performed sequential bath ionic substitutions and determined selectivity from the changes in reversal potential. On the basis of reversal potential changes, our results show almost identical selectivity sequences of I- > Br- > Cl- for both long form and short form. However, in the presence of I- bath solution, short form current amplitudes at high positive voltage were somewhat reduced and displayed less rectification (Fig. 7).


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 6.   Different inactivation between ClC-3 long form and short form. Currents were recorded with 2-s voltage pulses from -100 to +100 mV in 20-mV steps under isotonic conditions. Traces of ClC-3 long form (A) displayed inactivation above 70 mV, but short form (B) had no inactivation in the voltage range.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 7.   Anion selectivity of ClC-3 channels. A: current-voltage relationships are shown for long form-expressing cells that were sequentially exposed to isosmotic NaCl, NaBr, and NaI bath solutions. Data are corrected for liquid junction potentials. Selectivity sequence determined from reversal potential changes was I- (1.47 ± 0.04, n = 7) > Br- (1.19 ± 0.04, n = 8) > Cl-. B: identical experimental protocol for short form-expressing cells. Inset demonstrates reversal potential changes. Selectivity sequence was I- (1.47 ± 0.06, n = 8) > Br- (1.18 ± 0.04, n = 9) > Cl-.

Localization of native ClC-3 in hepatocytes. Expression of the ClC-3 protein was examined in hepatocytes and membrane fractions by indirect immunofluorescence and Western blotting. Indirect immunofluorescence using a polyclonal rabbit ClC-3 antibody was performed in isolated hepatocytes and hepatocyte couplets that had been cultured for 4 h after isolation. The results, presented in Fig. 8, A and B, revealed a selective fluorescence of the canalicular membrane domain. In addition, patches of intracellular fluorescence were also frequently observed. The basolateral membrane of cells and couplets did not stain under these conditions. Specific absorption of the antiserum with ClC-3 antigenic peptide eliminated all canalicular membrane staining (Fig. 8, C and D). A similar result was obtained by omission of the primary antibody (data not shown).


View larger version (89K):
[in this window]
[in a new window]
 
Fig. 8.   Immunofluorescence staining of ClC-3. Isolated hepatocytes and hepatocyte couplets (A-D) and frozen sections of rat liver tissue (E and F) were fixed and immunostained as described in EXPERIMENTAL PROCEDURES. A and B: hepatocyte couplets cultured on glass coverslips for 4 h. Primary antibody was anti-ClC-3. C and D: anti-ClC-3 antiserum preabsorbed with the ClC-3 antigenic peptide. E: ectoATPase, a canalicular marker, immunofluorescence in liver section demonstrating the appearance of the canaliculi (arrows). F: ClC-3 immunofluorescence. Note canalicular localization (arrows).

To determine whether canalicular localization occurred in liver tissue as well as couplets, immunostaining was performed in frozen rat liver sections. Figure 8E shows the immunostaining pattern of ectoATPase, a known canalicular marker. The canalicular pattern of punctate circular areas at the junctions of cells and branching tracts is readily apparent. ClC-3 immunostaining in liver (Fig. 8F) similarly shows canalicular staining, but in addition there appears to be localization to other sites as well, possibly sinusoidal lining cells.

We confirmed the preferential localization to the canalicular membrane by Western blotting using selective membrane fractions. The results (Fig. 9) confirm that ClC-3 protein is enriched in canalicular membranes compared with basolateral membranes. Interestingly, total cell membranes have similar quantities of ClC-3 to canalicular membranes, suggesting a possible intracellular localization as well.


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 9.   ClC-3 immunoblots in liver membrane fractions. Membrane protein (200 µg) was loaded on each lane and probed with anti-ClC-3 antibody (lanes 1-3) or preabsorbed anti-ClC-3 antibody (lanes 4-6). Lanes 1 and 4, canalicular membranes; lanes 2 and 5, basolateral membranes; lanes 3 and 6, liver homogenate. Similar results were obtained in 3 different membrane preparations.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

This study has determined that ClC-3 is expressed as two different mRNA isoforms in rats, one corresponding to the reported sequence (14) and the other with a 176-bp insertion upstream to the translation initiation site. The insert extends the ORF and predicts a new NH2 terminal segment that is nearly identical to the NH2 terminal sequences of human, mouse, and rabbit ClC-3. We further confirmed that both forms produce functional chloride channels when transiently transfected in CHO-K1 cells. Ionic currents resulting from the two isoforms had similar anion selectivity but exhibited different rectification and inactivation properties. In hepatocytes, ClC-3 protein localizes preferentially to the canalicular membrane. This is the first identification of the molecular identity of a canalicular membrane chloride channel.

Significance of ClC-3 isoforms. The broad expression of two different mRNA isoforms for ClC-3 was unexpected. The short form we identified was identical to the previously reported sequence (20), except for a G-to-A substitution at nucleotide 2644 that predicts a V to I substitution at amino acid 759. This one conservative change makes our sequence identical to that of mouse, rabbit, and human ClC-3 at this position. This newly reported rat long form was 100% identical at the amino acid level with the reported sequence for mouse ClC-3 and was 99% amino acid identical to human ClC-3. Although two different ClC-3 mRNAs are present, our Western blots did not resolve two protein bands (Fig. 9). It is possible that the small size difference (4 kDa) could not be resolved on our gels, but alternatively only one of the forms may be translated. Resolving this issue will require further studies.

Other ClC family chloride channels have also been reported to exist in multiple isoforms. The best defined of these is for ClC-2, in which tissue-specific exon skipping and alternative splicing have been shown to generate alternate forms of the channel (2, 3). Alternative splicing variants have also been observed for ClC-6 (7) and for the related Drosophila chloride channel DrosGluCl-alpha (24). It is possible that the different ClC-3 isoforms have different functional properties or are involved in formation of heteromultimers (16).

Expression studies of chloride channels have been hampered by the lack of an expression system devoid of endogenous chloride channels. Therefore, interference from endogenous chloride currents is possible in any expression system. In particular, most cells have endogenous swelling-activated currents. We chose to use CHO-K1 cells in these studies. These cells had the lowest endogenous ClC-3 mRNA expression of several cells lines as assessed by RT-PCR (Shimada and Weinman, unpublished observations). In addition, they are easily patch clamped (31) and have very low basal chloride currents (10).

Expression of both long and short form of ClC-3 produced reproducible currents. In both cases, immunofluorescence with the anti-FLAG antibody provided direct evidence that the protein is expressed and appears to be present on the plasma membrane. Although ClC-3 protein expression could still activate endogenous channels, short form- and long form-associated currents have different rectification and inactivation kinetics from each other and this would not be expected if these two very similar proteins merely activated an endogenous channel. Although the long form current has similar properties to the endogenous swelling-activated currents in CHO-K1 cells, the much stronger rectification and absence of voltage-dependent inactivation in the short form-transfected cells are not seen in nontransfected cells either as a result of cell swelling, increased intracellular Ca2+, or other stimuli. We therefore conclude that the observed currents result directly from heterologous ion channel expression.

The rectification and inactivation of ClC-3 short form currents are quite similar to those of ClC-4 and ClC-5 channels, which have ~80% amino acid homology with ClC-3 (9). However, the I- > Br- > Cl- permeability sequence of ClC-3 is different from ClC-4 and ClC-5. The two isoforms of ClC-3 exhibit different kinetic and gating properties, although they differ only by a 58-amino acid NH2 terminal domain. This segment may therefore be involved in gating, possibly by voltage-dependent conformational changes of the protein, or alternatively it could serve as an interaction site for another molecule that is responsible for channel inactivation.

Channel localization. We used a rabbit polyclonal antibody for localization of ClC-3. This antibody was generated to a peptide in the cytoplasmic domain of the COOH terminal that shares little homology with other members of the ClC family except for the closely related ClC-4 and ClC-5. However, lack of cross-reactivity of the antibody with ClC-4 and ClC-5 has been directly demonstrated (22). Immunofluorescence revealed a canalicular membrane localization of native ClC-3 in hepatocytes. This was seen most clearly in hepatocyte couplets, but canalicular localization was also seen in frozen liver sections and was confirmed by Western blotting of membrane fractions. In addition to the canalicular membrane, frozen liver sections showed prominent localization within the sinusoids (Fig. 8F), possibly indicating the presence of ClC-3 in endothelial cells or Kupffer cells as well.

The presence of outwardly rectifying chloride channels has previously been demonstrated in canalicular membrane vesicles (23), and ClC-3 is therefore a candidate for this channel. It is important to note that intracellular ClC-3 was also seen and that total liver homogenate contains nearly as much ClC-3 as canalicular membranes by Western blot (Fig. 9). Together, these observations suggest that ClC-3 may reside both intracellularly and at the canalicular membrane. A similar situation was seen in transfected CHO-K1 cells, in which an intracellular as well as a plasma membrane distribution was observed. The closely related ClC-5 channel has also been reported to be largely or exclusively intracellular (4, 17).

Comparison with other reports of ClC-3 expression. Two other groups have previously reported the properties of ClC-3 in heterologous expression systems. Kawasaki et al. described rat ClC-3 currents in oocytes (14) and stably transfected CHO-K1 cells (13). The currents in oocytes were slightly outwardly rectifying, and those in the stably transfected cells were also weakly outwardly rectifying, even though the single channels they identified did not appear to pass current at all in the inward direction. These findings suggest that their single channels were not responsible for their observed whole cell currents. Similar results were reported by Duan et al. (5, 6), who stably and transiently transfected guinea pig ClC-3 in fibroblasts and reported very large chloride conductances. These currents again were only slightly outwardly rectifying and inactivated at positive voltages, and both the rectification and ionic selectivity were altered by an N597K substitution. All of these studies used a ClC-3 sequence that was nearly identical to our short form.

We initially attempted to produce stably transfected ClC-3 cells, but although we obtained high levels of mRNA expression we were not able to successfully demonstrate either protein expression or an increase in basal currents. Instead, the transient transfections reported in this study were able to observe both. The major differences between our studies and the previous studies are that we used a FLAG epitope-labeled construct and confirmed membrane expression by immunofluorescence. We observed smaller total current magnitudes and different rectification and inactivation properties for the short form.

The explanation for these different properties is not certain but could result from differences in the cellular environment or levels of expression. Although the magnitude of our currents was smaller than those seen previously, it is comparable to that observed for transient ClC-4 and ClC-5 expression in mammalian cells (9). The magnitudes of the ClC-3-associated currents observed by others, on the other hand, are unusually large. Kawasaki et al. (13) reported a current of 2,535 pA at 10 mV, which corresponds to an electrical resistance of only 4 MOmega . Since this is comparable to the lowest typical access resistance of a whole cell pipette, the conductance of these cell membranes must have been so high that free solution ionic mobility and not the cell membrane was rate limiting for current flow. We therefore believe that the currents reported in this study accurately reflect the properties of ClC-3 when transiently expressed in CHO-K1 cells.

In summary, we have identified two different isoforms of ClC-3 from rat hepatocytes and shown functional expression of each in CHO-K1 cells. The two isoforms can be distinguished by different kinetic properties but have identical ionic selectivities. In hepatocytes, the native ClC-3 channel appears to be both intracellular and associated with the bile canalicular membrane.


    ACKNOWLEDGEMENTS

We wish to thank Drs. N. Wills, H. Saito, J. Navarro, and R. Green for assistance and helpful discussions. We also thank Dr. L. Reuss for critical review of a preliminary version of the manuscript and Dr. M. Ananthanarayanan for providing the ectoATPase antibody.


    FOOTNOTES

This work was supported by Grant DK-42917 from the National Institute of Diabetes and Digestive and Kidney Diseases.

Present address of K. Shimada: Department of Surgery and Oncology, Graduate School of Medical Sciences, Kyushu University, Maidashi 3-1-1, Higashi-ku, Fukuoka, 812-8582, Japan.

Address for reprint requests and other correspondence: S. A. Weinman, Dept. of Physiology and Biophysics, Univ. of Texas Medical Branch, 301 Univ. Blvd., Galveston, TX 77555-0641 (E-mail: sweinman{at}utmb.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Received 15 December 1999; accepted in final form 26 February 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Al-Awqati, Q. Chloride channels of intracellular organelles. Curr Opin Cell Biol 7: 504-508, 1995[ISI][Medline].

2.   Chu, S, Murray CB, Liu MM, and Zeitlin PL. A short ClC-2 mRNA transcript is produced by exon skipping. Nucleic Acids Res 24: 3453-3457, 1996[Abstract/Free Full Text].

3.   Chu, S, and Zeitlin PL. Alternative mRNA splice variants of the rat ClC-2 chloride channel gene are expressed in lung: genomic sequence and organization of ClC-2. Nucleic Acids Res 25: 4153-4159, 1997[Abstract/Free Full Text].

4.   Devuyst, O, Christie PT, Courtoy PJ, Beauwens R, and Thakker RV. Intra-renal and subcellular distribution of the human chloride channel, CLC-5, reveals a pathophysiological basis for Dent's disease. Hum Mol Genet 8: 247-257, 1999[Abstract/Free Full Text].

5.   Duan, D, Cowley S, Horowitz B, and Hume JR. A serine residue in ClC-3 links phosphorylation-dephosphorylation to chloride channel regulation by cell volume. J Gen Physiol 113: 57-70, 1999[Abstract/Free Full Text].

6.   Duan, D, Winter C, Cowley S, Hume JR, and Horowitz B. Molecular identification of a volume-regulated chloride channel. Nature 390: 417-421, 1997[Medline].

7.   Eggermont, J, Buyse G, Voets T, Tytgat J, De Smedt H, Droogmans G, and Nilius B. Alternative splicing of ClC-6 (a member of the ClC chloride-channel family) transcripts generates three truncated isoforms one of which, ClC-6c, is kidney-specific. Biochem J 325: 269-276, 1997.

8.   Eliassi, A, Garneau L, Roy G, and Sauvé R. Characterization of a chloride-selective channel from rough endoplasmic reticulum membranes of rat hepatocytes: evidence for a block by phosphate. J Membr Biol 159: 219-229, 1997[ISI][Medline].

9.   Friedrich, T, Breiderhoff T, and Jentsch TJ. Mutational analysis demonstrates that ClC-4 and ClC-5 directly mediate plasma membrane currents. J Biol Chem 274: 896-902, 1999[Abstract/Free Full Text].

10.   Gabriel, SE, Price EM, Boucher RC, and Stutts MJ. Small linear chloride channels are endogenous to nonepithelial cells. Am J Physiol Cell Physiol 263: C708-C713, 1992[Abstract/Free Full Text].

11.   Graf, J, Henderson RM, Krumpholz B, and Boyer JL. Cell membrane and transepithelial voltages and resistances in isolated rat hepatocyte couplets. J Membr Biol 95: 241-254, 1987[ISI][Medline].

12.   Jentsch, TJ, Friedrich T, Schriever A, and Yamada H. The CLC chloride channel family. Pflügers Arch 437: 783-795, 1999[ISI][Medline].

13.   Kawasaki, M, Suzuki M, Uchida S, Sasaki S, and Marumo F. Stable and functional expression of the CIC-3 chloride channel in somatic cell lines. Neuron 14: 1285-1291, 1995[ISI][Medline].

14.   Kawasaki, M, Uchida S, Monkawa T, Miyawaki A, Mikoshiba K, Marumo F, and Sasaki S. Cloning and expression of a protein kinase C-regulated chloride channel abundantly expressed in rat brain neuronal cells. Neuron 12: 597-604, 1994[ISI][Medline].

15.   Koch, MC, Steinmeyer K, Lorenz C, Ricker K, Wolf F, Otto M, Zoll B, Lehmann-Horn F, Grzeschik KH, and Jentsch TJ. The skeletal muscle chloride channel in dominant and recessive human myotonia. Science 257: 797-800, 1992[Abstract/Free Full Text].

16.   Lorenz, C, Pusch M, and Jentsch TJ. Heteromultimeric CLC chloride channels with novel properties. Proc Natl Acad Sci USA 93: 13362-13366, 1996[Abstract/Free Full Text].

17.   Luyckx, VA, Goda FO, Mount DB, Nishio T, Hall A, Hebert SC, Hammond TG, and Yu AS. Intrarenal and subcellular localization of rat CLC5. Am J Physiol Renal Physiol 275: F761-F769, 1998[Abstract/Free Full Text].

18.   Matsumura, Y, Uchida S, Kondo Y, Miyazaki H, Ko SB, Hayama A, Morimoto T, Liu W, Arisawa M, Sasaki S, and Marumo F. Overt nephrogenic diabetes insipidus in mice lacking the CLC-K1 chloride channel. Nat Genet 21: 95-98, 1999[ISI][Medline].

19.   Meng, X-J, and Weinman SA. Cyclic AMP and swelling activated chloride conductance in rat hepatocytes. Am J Physiol Cell Physiol 271: C112-C120, 1996[Abstract/Free Full Text].

20.   Sakamoto, H, Kawasaki M, Uchida S, Sasaki S, and Marumo F. Identification of a new outwardly rectifying Cl- channel that belongs to a subfamily of the ClC Cl- channels. J Biol Chem 271: 10210-10216, 1996[Abstract/Free Full Text].

21.   Scheinman, SJ. X-linked hypercalciuric nephrolithiasis: clinical syndromes and chloride channel mutations. Kidney Int 53: 3-17, 1998[ISI][Medline].

22.   Schmieder, S, Lindenthal S, Idelson G, and Ehrenfeld J. ClC-3 chloride channel distribution in mammalian tissue (Abstract). J Physiol (Lond) 517P: 15P, 1999.

23.   Sellinger, M, Weinman SA, Henderson RM, Zweifach A, Boyer JL, and Graf J. Anion channels in rat liver canalicular plasma membranes reconstituted into planar lipid bilayers. Am J Physiol Gastrointest Liver Physiol 262: G1027-G1032, 1992[Abstract/Free Full Text].

24.   Semenov, EP, and Pak WL. Diversification of Drosophila chloride channel gene by multiple posttranscriptional mRNA modifications. J Neurochem 72: 66-72, 1999[ISI][Medline].

25.   Shimada, K, Navarro J, Goeger DE, Mustafa SB, Weigel PH, and Weinman SA. Expression and regulation of leukotriene-synthesis enzymes in rat liver cells. Hepatology 28: 1275-1281, 1998[ISI][Medline].

26.   Song, CS, Rubin W, Rifkind AB, and Kappas A. Plasma membranes of the rat liver. Isolation and enzymatic characterization of a fraction rich in bile canaliculi. J Cell Biol 41: 124-132, 1969[Abstract/Free Full Text].

27.   Strange, K, Emma F, and Jackson PS. Cellular and molecular physiology of volume-sensitive anion channels. Am J Physiol Cell Physiol 270: C711-C730, 1996[Abstract/Free Full Text].

28.   Uchida, S, and Marumo F. Molecular characterization of chloride channels in the kidney. Exp Nephrol 4: 135-138, 1996[ISI][Medline].

29.   Venkatachalam, M, Weinberg J, Patel Y, Saikumar P, and Dong Z. Cytoprotection of kidney epithelial cells by compounds that target amino acid gated chloride channels. Kidney Int 49: 449-460, 1996[ISI][Medline].

30.   Waters, SL, Sarang SS, Wang KKW, and Schnellmann RG. Calpains mediate calcium and choride influx during the late phase of cell injury. J Pharmacol Exp Ther 283: 1177-1184, 1997[Abstract/Free Full Text].

31.   Weinman, SA, Carruth MW, and Dawson PA. Bile acid uptake via the human apical sodium-bile acid cotransporter is electrogenic. J Biol Chem 273: 34691-34695, 1998[Abstract/Free Full Text].


Am J Physiol Gastrointest Liver Physiol 279(2):G268-G276
0193-1857/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
Z. Yin, Y. Tong, H. Zhu, and M. A. Watsky
ClC-3 is required for LPA-activated Cl- current activity and fibroblast-to-myofibroblast differentiation
Am J Physiol Cell Physiol, February 1, 2008; 294(2): C535 - C542.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. J. Matsuda, M. S. Filali, K. A. Volk, M. M. Collins, J. G. Moreland, and F. S. Lamb
Overexpression of CLC-3 in HEK293T cells yields novel currents that are pH dependent
Am J Physiol Cell Physiol, January 1, 2008; 294(1): C251 - C262.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. Denton, K. Nehrke, X. Yin, A. M. Beld, and K. Strange
Altered gating and regulation of a carboxy-terminal ClC channel mutant expressed in the Caenorhabditis elegans oocyte
Am J Physiol Cell Physiol, April 1, 2006; 290(4): C1109 - C1118.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
W.-Z. Lan, H. Abbas, H. D. Lam, A.-M. Lemay, and C. E. Hill
Contribution of a time-dependent and hyperpolarization-activated chloride conductance to currents of resting and hypotonically shocked rat hepatocytes
Am J Physiol Gastrointest Liver Physiol, February 1, 2005; 288(2): G221 - G229.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
N. G. Jin, J. K. Kim, D. K. Yang, S. J. Cho, J. M. Kim, E. J. Koh, H. C. Jung, I. So, and K. W. Kim
Fundamental role of ClC-3 in volume-sensitive Cl- channel function and cell volume regulation in AGS cells
Am J Physiol Gastrointest Liver Physiol, November 1, 2003; 285(5): G938 - G948.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
G.-X. Wang, W. J. Hatton, G. L. Wang, J. Zhong, I. Yamboliev, D. Duan, and J. R. Hume
Functional effects of novel anti-ClC-3 antibodies on native volume-sensitive osmolyte and anion channels in cardiac and smooth muscle cells
Am J Physiol Heart Circ Physiol, October 1, 2003; 285(4): H1453 - H1463.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
M. L. Olsen, S. Schade, S. A. Lyons, M. D. Amaral, and H. Sontheimer
Expression of Voltage-Gated Chloride Channels in Human Glioma Cells
J. Neurosci., July 2, 2003; 23(13): 5572 - 5582.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Gentzsch, L. Cui, A. Mengos, X.-b. Chang, J.-H. Chen, and J. R. Riordan
The PDZ-binding Chloride Channel ClC-3B Localizes to the Golgi and Associates with Cystic Fibrosis Transmembrane Conductance Regulator-interacting PDZ Proteins
J. Biol. Chem., February 14, 2003; 278(8): 6440 - 6449.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
C. Isnard-Bagnis, N. Da Silva, V. Beaulieu, A. S. L. Yu, D. Brown, and S. Breton
Detection of ClC-3 and ClC-5 in epididymal epithelium: immunofluorescence and RT-PCR after LCM
Am J Physiol Cell Physiol, January 1, 2003; 284(1): C220 - C232.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
T. J. Jentsch, V. Stein, F. Weinreich, and A. A. Zdebik
Molecular Structure and Physiological Function of Chloride Channels
Physiol Rev, April 1, 2002; 82(2): 503 - 568.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Mohammad-Panah, C. Ackerley, J. Rommens, M. Choudhury, Y. Wang, and C. E. Bear
The Chloride Channel ClC-4 Co-localizes with Cystic Fibrosis Transmembrane Conductance Regulator and May Mediate Chloride Flux across the Apical Membrane of Intestinal Epithelia
J. Biol. Chem., January 4, 2002; 277(1): 566 - 574.
[Abstract] [Full Text]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
F. S. Lamb, R. W. Graeff, G. H. Clayton, R. L. Smith, B. C. Schutte, and P. B. McCray Jr.
Ontogeny of CLCN3 Chloride Channel Gene Expression in Human Pulmonary Epithelium
Am. J. Respir. Cell Mol. Biol., April 1, 2001; 24(4): 376 - 381.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
R. M. Roman, R. L. Smith, A. P. Feranchak, G. H. Clayton, R. B. Doctor, and J. G. Fitz
ClC-2 chloride channels contribute to HTC cell volume homeostasis
Am J Physiol Gastrointest Liver Physiol, March 1, 2001; 280(3): G344 - G353.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Huang, J. Liu, A. Di, N. C. Robinson, M. W. Musch, M. A. Kaetzel, and D. J. Nelson
Regulation of Human CLC-3 Channels by Multifunctional Ca2+/Calmodulin-dependent Protein Kinase
J. Biol. Chem., June 1, 2001; 276(23): 20093 - 20100.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
X. Li, T. Wang, Z. Zhao, and S. A. Weinman
The ClC-3 chloride channel promotes acidification of lysosomes in CHO-K1 and Huh-7 cells
Am J Physiol Cell Physiol, June 1, 2002; 282(6): C1483 - C1491.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services