|
|
||||||||
Departments of 1 Physiology and Biophysics and 2 Internal Medicine, University of Texas Medical Branch, Galveston, Texas, 77555
| |
ABSTRACT |
|---|
|
|
|---|
The molecular identities
of functional chloride channels in hepatocytes are largely unknown. We
examined the ClC-3 chloride channel in rat hepatocytes and found that
mRNA for two different isoforms is present. A short form is identical
to the previously reported sequence for rat ClC-3, and a long form
contains a 176-bp insertion immediately upstream of the translation
initiation site. This predicts a 58-amino acid NH2 terminal
insertion. Both long and short form mRNA was expressed in diverse
tissues of the rat. Transient transfection of the long form in CHO-K1
cells resulted in currents with an I
> B
> Cl
selectivity sequence, outward
rectification, and inactivation at positive voltages. Short form
currents had identical ionic selectivity but displayed a more extreme
outward rectification and showed no voltage-dependent inactivation.
Immunofluorescence and immunoblots localized native ClC-3
preferentially but not exclusively to the canalicular membrane. We have
therefore identified a new isoform of rat ClC-3 and shown that
expression of both isoforms produces functional channels. In
hepatocytes, ClC-3 is located in association with the canalicular membrane.
ion channels; liver; CHO-K1 cells; canalicular membrane
| |
INTRODUCTION |
|---|
|
|
|---|
CHLORIDE CHANNELS ARE WIDELY distributed in mammalian cells and serve important functions. Hepatocytes have a high basal permeability to chloride, and electrophysiological studies have identified chloride channels in sinusoidal membranes (11), canalicular membranes (23), and several different intracellular compartments (1, 8). Hepatocyte chloride channels are involved in cell volume regulation, control of plasma membrane electrical potential, and acidification of the endocytic pathway. They have also been postulated to play a role in bile formation and cholestasis as well as in response to cell injury (29, 30).
Chloride channels of the ClC family are expressed in diverse tissues (12), and mutations of these channels produce several genetic diseases, including myotonia congenita for ClC-1 (15), hereditary nephrocalcinosis (Dent's disease) for ClC-5 (21), and a knockout mouse model of nephrogenic diabetes insipidus for ClC-K1 (18). The ClC chloride channels are thus important to cell function, but the precise functions and even properties of each are largely unknown. ClC-0, ClC-1, ClC-2, and ClC-5 have all been reproducibly expressed in different expression systems and produce characteristic chloride currents (12, 28). Other family members, such as ClC-6 and ClC-7, have not been reproducibly expressed. For ClC-3, expression has been reported by two different groups (6, 13), but its observed properties differ in these systems.
Our ultimate goal is to determine the role of ClC-3 in hepatocyte chloride permeability. In the course of these studies we identified two forms of ClC-3 in hepatocytes. We now report expression studies showing that both of these forms produce channels and that their properties differ in a way that may provide insight into the domains of the channel responsible for gating. We also examined the subcellular localization of ClC-3 and show that the channel is preferentially localized to the canalicular membrane of hepatocytes.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
RNA isolation. Total RNA was isolated from hepatocytes, liver, kidney, and lung tissue by liquid phase separation using the Ultraspec RNA isolation kit (Biotecx, Houston, TX) according to the manufacturer's instructions. Poly(A)+ mRNA was prepared from total RNA using the Oligotex mRNA kit (Qiagen, Chatsworth, CA). Total RNA from rat brain and heart was a generous gift from Dr. H. Saito (University of Texas Medical Branch, Galveston, TX).
RT-PCR. RT-PCR was performed by the methods described previously (25). For the synthesis of the single-stranded cDNA, 4 µg of total RNA from each sample was reverse transcribed using an oligo(dT) primer and 200 units of SuperScript II reverse transcriptase (Gibco BRL, Gaithersburg, MD). Aliquots of the synthesized cDNA (3 µl) were amplified in a Genemate thermal cycler (ISC Bioscience) with 2.5 units of Taq DNA polymerase (Gibco BRL). For identification of ClC-3, primers were designed to amplify a segment from 251 to 1104 (sense, TAGAGCCGGAGATTGAACT; antisense, CCACTTTCCCAAGTAACCTC) for 31 cycles with an elongation temperature of 52°C. Reaction products were separated by electrophoresis using a 1.5% agarose gel. The identity of PCR products was confirmed by predicted size of the amplified products and determination of restriction fragment lengths with restriction sites specifically selected for the predicted amplified sequence. Southern blotting analysis was performed using specific 32P-labeled cDNA probes prepared by the random priming method. The intensity of each band was measured by the LYNX 5000 Image Analyzer (Applied Imaging, Santa Clara, CA). Glyceraldehyde-3-phosphate dehydrogenase (Ambion) was used as a control.
Preparation of ClC-3 expression vectors. Full-length ClC-3 transcripts were prepared by PCR with a mixture of Taq and Pfu polymerases (TaqPlus Precision PCR system, Stratagene, La Jolla, CA) using primers designed to insert a 5' BamH 1 site and a 3' FLAG sequence followed by a Xho 1 site. The PCR products were resolved on agarose gels, extracted with the Wizard PCR purification system (Promega), ligated into pcDNA3.1+ (Invitrogen), and sequenced using eight sequencing primers by the University of Texas Medical Branch sequencing facility. Multiple clones were sequenced for each isoform, and the correct sequences were confirmed.
Transfection. CHO-K1 cells were cultured in DMEM-F-12 medium and grown on glass coverslips. Cells were transfected at 40-60% confluency with the long form or short form ClC-3 cDNA using FuGENE 6 (Boehringer Mannheim) according to the suggested procedures. To identify transfectants, a green fluorescent protein (GFP) construct (pEGFP, Clontech) was cotransfected at a ClC-3-to-GFP ratio of 30:1. Cells expressing GFP fluorescence at 40-70 h were selected for experiments.
Isolation of hepatocytes. Isolated hepatocytes from male Sprague-Dawley rats were prepared by two-step collagenase perfusion of the liver as previously described (23). Trypan blue exclusion was used to assess viability, which ranged from 90 to 95%. The hepatocytes were allowed to attach to collagen-coated glass coverslips and were cultured for 4 h at 37°C in L-15 medium, containing 10% vol/vol fetal bovine serum (FBS), penicillin (200 U/ml), and streptomycin (0.2 mg/ml).
Immunofluorescence.
Transfected CHO-K1 cells were fixed with methanol at
20°C for 10 min, washed in PBS, and incubated with the m2 anti-FLAG monoclonal
antibody (Sigma) (1:1,500) in 10% goat serum for 60 min.
Coverslips were washed for 2 h with PBS and then incubated with
Alexa 594-conjugated goat anti-mouse IgG (Molecular Probes) at a
dilution of 1:500 for 30 min. After washing for 45 min, coverslips were
mounted and observed in a Nikon epifluorescence microscope at
excitation wavelength of 590 and emission wavelength of 630 nm.
20°C. The coverslips were incubated with anti-ClC-3 antibody at a
dilution of 1:200 in 10% goat serum at 4°C for 16 h. After
washing in PBS for 30 min, the coverslips were further incubated for
1 h at room temperature with an Alexa 488-conjugated goat
anti-rabbit IgG at a dilution of 1:500 in 10% goat serum, followed by
another washing in PBS for 30 min. The coverslips were then mounted
with FluorSave (Calbiochem) solution and observed in a Nikon Eclipse
E800 epifluorescence microscope. Parallel incubations were performed
using primary antibody that had been preabsorbed with a 10:1 (by
weight) excess of the GST-ClC-3 fusion protein used to generate the
antibody. Cryosections were obtained from freshly killed rat liver.
Immunostaining was performed using the same protocol as for
hepatocytes, except that the secondary antibody was Alexa
594-conjugated goat anti-rabbit IgG (Molecular Probes).
Membrane preparation and Western blotting.
Crude canalicular and basolateral membranes were prepared from a single
rat liver by a modification of the method of Song et al.
(26). Rats (150-200 g) were fasted overnight and
killed with CO2. The liver was perfused with Hanks' buffer
followed by perfusion with ice-cold 1 mM NaHCO3. The liver
was minced and homogenized in 2 volumes of NaHCO3 with 15 strokes of a Dounce homogenizer with a loose-fitting pestle. Homogenate
was diluted with 200 ml of NaHCO3, filtered through cotton
cheesecloth, and centrifuged at 1,500 g for 10 min. Pellet
was resuspended in NaHCO3 equal to the original wet weight
of the liver, to which 5.5 volumes of 56% (wt/wt) sucrose were added.
Suspension was applied as the bottom layer of a discontinuous sucrose
gradient (56%, 42%, 38%) and centrifuged at 66,000 g for
60 min at 4°C. Enriched canalicular membranes were collected from the
upper interface and typically yielded 1.2 mg/10 g liver. Canalicular
enrichment in this preparation was confirmed by immunoblotting for
ectoATPase. Basolateral membrane fraction was collected from the lower
interface, further centrifuged in a second discontinuous gradient as
above, and stored at
80°C.
Patch clamp.
Whole cell patch clamp was performed at room temperature as previously
described (19). Borosilicate glass micropipettes (catalogue no. 1B150F-6; WP Instruments, Sarasota, FL) were pulled with
a multistep pull on a Flaming-Brown micropipette puller (model P-87;
Sutter Instrument, Novato, CA) and were fire polished to final tip
resistance of 3.5-5 M
when filled with pipette solution and
immersed in bath solutions. Currents were measured using a patch-clamp
amplifier (Axopatch 200; Axon Instruments, Foster City, CA) and
filtered at 2 kHz. pCLAMP software (v. 6.03; Axon Instruments) was used
to generate the command voltages and process the acquired data.
Sampling rates varied according to different protocols. Liquid junction
potentials were measured with a flowing 3 M KCl junction and
current-voltage curves corrected appropriately. Only records with a
series resistance increase of <50% after formation of the whole cell
were included. GFP-expressing cells were visualized with
epifluorescence on a Nikon Diaphot microscope and patch clamped immediately. Bath solution contained (in mM): 114 NaCl, 5.4 CsCl, 1 MgSO4, 1.5 CaCl2, 10 HEPES, and 10 glucose, pH
7.4, adjusted with NaOH. Preliminary experiments demonstrated that
spontaneous activation of large, chloride-selective currents was a
common phenomenon, even in nontransfected cells. This appeared to be a
consequence of cell swelling, which occurred when cells were transferred from a relatively hyperosmotic culture medium (DMEM-F-12 with 10% FBS, ~350 mosmol/kgH2O) to the standard
patch-clamp bath solution (300 mosmol/kgH2O). Dilution of
the culture medium with water to an osmolality of 300 mosmol/kgH2O eliminated this spontaneous activation.
80,
50). Comparisons were made by unpaired t-test using SigmaStat software.
Animal care. All animals were treated in accordance with the guidelines established by the Animal Care and Use Committee of the University of Texas Medical Branch (Protocol 89-11-239).
| |
RESULTS |
|---|
|
|
|---|
Isoforms of ClC-3 mRNA expression.
ClC-3 has previously been shown to be expressed in diverse tissues,
including liver (14). We initially examined ClC-3 mRNA expression in hepatocytes by RT-PCR with primers spanning the predicted
translation initiation site. This amplification always yielded two
products. Southern blot analysis confirmed that both products
specifically hybridized to a ClC-3 probe (Fig.
1A). The two PCR products were
subcloned and sequenced. The smaller 853-bp product corresponded to the
published sequence of rat ClC-3 (originally derived from a rat kidney
cDNA library) (14). The longer 1,029-bp fragment contained
a 176-bp insertion that created a longer open reading frame (ORF) that
predicted a 58-amino acid addition at the NH2 terminus of
the protein (Fig. 2). This predicted
sequence was almost identical to a similar sequence at the
NH2 terminus of mouse, rabbit, and human ClC-3. To confirm
that full-length long and short form mRNA species are both transcribed
in hepatocytes, we used RT-PCR with a proofreading polymerase to
amplify the entire predicted 2.7-kb ORF for ClC-3. Again, two products
were obtained (Fig. 1B), and sequence analysis confirmed
that full-length mRNAs are expressed for both long and short forms of
ClC-3. The full sequence of the ClC-3 long form ORF is available as
GenBank accession no. AF142778.
|
|
|
Heterologous expression in CHO-K1 cells.
Expression vectors for both the short and long form were prepared by
RT-PCR of the ClC-3 sequence from rat liver RNA and ligation into
pcDNA3.1. A FLAG epitope was inserted at the COOH terminus, predicted
to be an intracellular domain. These constructs were then transiently
transfected into CHO-K1 cells. Cotransfection with a GFP expression
vector was used to identify transfected cells. To examine the extent of
ClC-3 expression and determine whether simultaneous GFP expression
correctly identified ClC-3-expressing cells, we performed
immunofluorescence with the anti-FLAG antibody. Figure
4A demonstrates the
immunofluorescence pattern of ClC-3-expressing cells. In the ClC-3-GFP
cotransfections, GFP-positive cells (green fluorescence) were also
positive for ClC-3 immunostaining (red fluorescence). In the GFP-only
transfections, many cells were positive for the green GFP fluorescence,
but none of these cells showed red fluorescence (data not shown). The
localization of ClC-3 immunofluorescence for both the long and short
forms is demonstrated in Fig. 4B. There was extensive
immunostaining intracellularly as well as on the plasma membrane.
|
Functional expression of ClC-3 long and short forms.
To examine the functional expression of ClC-3 channels, the whole cell
voltage clamp technique was used. From a holding potential of 0 mV,
pulses of
80 to +80 mV induced identical small amplitude currents in
both untransfected CHO-K1 and GFP-only-transfected cells (Fig.
5A). The mean conductance from
+50 to +80 mV was 24 ± 3 pS/pF (n = 18) and
remained stable for at least 30 min. No cells exhibited conductance of
>50 pS/pF. In contrast, a large proportion of ClC-3 long form- or
short form-transfected cells exhibited large outwardly rectifying
currents (Fig. 5, B and C). Long form-transfected
cells showed currents of >80 pS/pF in 28 of 56 patches, with a mean
conductance of 255 ± 56 pS/pF (n = 28). For ClC-3
short form, an even greater proportion of cells (24 of 37) exhibited
large conductances (185 ± 24 pS/pF; n = 24). Additionally, Fig. 5D demonstrates that the ClC-3 short form
channel currents have stronger outward rectification with rectification factors
(G+50,+80/G
80,
50) for
short form, long form, and control of 8.5 ± 0.8, 3.8 ± 0.3 (P < 0.01), and 1.5 ± 0.2 (P < 0.01), respectively.
|
Properties of long and short form currents.
It has been widely noted that volume-activated chloride channels
inactivate slowly at very positive voltages (27). Since ClC-3 has been proposed as a candidate for these swelling-activated channels (6), we tested inactivation kinetics of the ClC-3 isoforms by using 2-s pulses over the voltage range from
100 to +100
mV (Fig. 6). Like the volume-activated
current, ClC-3 long form displayed slow inactivation at voltage pulses
of >60 mV (20 of 20 cells examined). In contrast, the short form never displayed voltage-dependent inactivation (n = 16). We
further performed sequential bath ionic substitutions and determined
selectivity from the changes in reversal potential. On the basis of
reversal potential changes, our results show almost identical
selectivity sequences of I
> Br
> Cl
for both long form and short form. However, in the
presence of I
bath solution, short form current
amplitudes at high positive voltage were somewhat reduced and displayed
less rectification (Fig. 7).
|
|
Localization of native ClC-3 in hepatocytes.
Expression of the ClC-3 protein was examined in hepatocytes and
membrane fractions by indirect immunofluorescence and Western blotting.
Indirect immunofluorescence using a polyclonal rabbit ClC-3 antibody
was performed in isolated hepatocytes and hepatocyte couplets that had
been cultured for 4 h after isolation. The results, presented in
Fig. 8, A and B,
revealed a selective fluorescence of the canalicular membrane domain.
In addition, patches of intracellular fluorescence were also frequently
observed. The basolateral membrane of cells and couplets did not stain
under these conditions. Specific absorption of the antiserum with ClC-3
antigenic peptide eliminated all canalicular membrane staining (Fig. 8,
C and D). A similar result was obtained by
omission of the primary antibody (data not shown).
|
|
| |
DISCUSSION |
|---|
|
|
|---|
This study has determined that ClC-3 is expressed as two different mRNA isoforms in rats, one corresponding to the reported sequence (14) and the other with a 176-bp insertion upstream to the translation initiation site. The insert extends the ORF and predicts a new NH2 terminal segment that is nearly identical to the NH2 terminal sequences of human, mouse, and rabbit ClC-3. We further confirmed that both forms produce functional chloride channels when transiently transfected in CHO-K1 cells. Ionic currents resulting from the two isoforms had similar anion selectivity but exhibited different rectification and inactivation properties. In hepatocytes, ClC-3 protein localizes preferentially to the canalicular membrane. This is the first identification of the molecular identity of a canalicular membrane chloride channel.
Significance of ClC-3 isoforms. The broad expression of two different mRNA isoforms for ClC-3 was unexpected. The short form we identified was identical to the previously reported sequence (20), except for a G-to-A substitution at nucleotide 2644 that predicts a V to I substitution at amino acid 759. This one conservative change makes our sequence identical to that of mouse, rabbit, and human ClC-3 at this position. This newly reported rat long form was 100% identical at the amino acid level with the reported sequence for mouse ClC-3 and was 99% amino acid identical to human ClC-3. Although two different ClC-3 mRNAs are present, our Western blots did not resolve two protein bands (Fig. 9). It is possible that the small size difference (4 kDa) could not be resolved on our gels, but alternatively only one of the forms may be translated. Resolving this issue will require further studies.
Other ClC family chloride channels have also been reported to exist in multiple isoforms. The best defined of these is for ClC-2, in which tissue-specific exon skipping and alternative splicing have been shown to generate alternate forms of the channel (2, 3). Alternative splicing variants have also been observed for ClC-6 (7) and for the related Drosophila chloride channel DrosGluCl-
(24). It is possible
that the different ClC-3 isoforms have different functional properties
or are involved in formation of heteromultimers (16).
Expression studies of chloride channels have been hampered by the lack
of an expression system devoid of endogenous chloride channels.
Therefore, interference from endogenous chloride currents is possible
in any expression system. In particular, most cells have endogenous
swelling-activated currents. We chose to use CHO-K1 cells in these
studies. These cells had the lowest endogenous ClC-3 mRNA expression of
several cells lines as assessed by RT-PCR (Shimada and Weinman,
unpublished observations). In addition, they are easily patch clamped
(31) and have very low basal chloride currents
(10).
Expression of both long and short form of ClC-3 produced reproducible
currents. In both cases, immunofluorescence with the anti-FLAG antibody
provided direct evidence that the protein is expressed and appears to
be present on the plasma membrane. Although ClC-3 protein expression
could still activate endogenous channels, short form- and long
form-associated currents have different rectification and inactivation
kinetics from each other and this would not be expected if these two
very similar proteins merely activated an endogenous channel. Although
the long form current has similar properties to the endogenous
swelling-activated currents in CHO-K1 cells, the much stronger
rectification and absence of voltage-dependent inactivation in the
short form-transfected cells are not seen in nontransfected cells
either as a result of cell swelling, increased intracellular
Ca2+, or other stimuli. We therefore conclude that the
observed currents result directly from heterologous ion channel expression.
The rectification and inactivation of ClC-3 short form currents are
quite similar to those of ClC-4 and ClC-5 channels, which have ~80%
amino acid homology with ClC-3 (9). However, the I
> Br
> Cl
permeability sequence of ClC-3 is different from ClC-4 and ClC-5. The
two isoforms of ClC-3 exhibit different kinetic and gating properties,
although they differ only by a 58-amino acid NH2 terminal domain. This segment may therefore be involved in gating, possibly by
voltage-dependent conformational changes of the protein, or alternatively it could serve as an interaction site for another molecule that is responsible for channel inactivation.
Channel localization. We used a rabbit polyclonal antibody for localization of ClC-3. This antibody was generated to a peptide in the cytoplasmic domain of the COOH terminal that shares little homology with other members of the ClC family except for the closely related ClC-4 and ClC-5. However, lack of cross-reactivity of the antibody with ClC-4 and ClC-5 has been directly demonstrated (22). Immunofluorescence revealed a canalicular membrane localization of native ClC-3 in hepatocytes. This was seen most clearly in hepatocyte couplets, but canalicular localization was also seen in frozen liver sections and was confirmed by Western blotting of membrane fractions. In addition to the canalicular membrane, frozen liver sections showed prominent localization within the sinusoids (Fig. 8F), possibly indicating the presence of ClC-3 in endothelial cells or Kupffer cells as well.
The presence of outwardly rectifying chloride channels has previously been demonstrated in canalicular membrane vesicles (23), and ClC-3 is therefore a candidate for this channel. It is important to note that intracellular ClC-3 was also seen and that total liver homogenate contains nearly as much ClC-3 as canalicular membranes by Western blot (Fig. 9). Together, these observations suggest that ClC-3 may reside both intracellularly and at the canalicular membrane. A similar situation was seen in transfected CHO-K1 cells, in which an intracellular as well as a plasma membrane distribution was observed. The closely related ClC-5 channel has also been reported to be largely or exclusively intracellular (4, 17).Comparison with other reports of ClC-3 expression. Two other groups have previously reported the properties of ClC-3 in heterologous expression systems. Kawasaki et al. described rat ClC-3 currents in oocytes (14) and stably transfected CHO-K1 cells (13). The currents in oocytes were slightly outwardly rectifying, and those in the stably transfected cells were also weakly outwardly rectifying, even though the single channels they identified did not appear to pass current at all in the inward direction. These findings suggest that their single channels were not responsible for their observed whole cell currents. Similar results were reported by Duan et al. (5, 6), who stably and transiently transfected guinea pig ClC-3 in fibroblasts and reported very large chloride conductances. These currents again were only slightly outwardly rectifying and inactivated at positive voltages, and both the rectification and ionic selectivity were altered by an N597K substitution. All of these studies used a ClC-3 sequence that was nearly identical to our short form.
We initially attempted to produce stably transfected ClC-3 cells, but although we obtained high levels of mRNA expression we were not able to successfully demonstrate either protein expression or an increase in basal currents. Instead, the transient transfections reported in this study were able to observe both. The major differences between our studies and the previous studies are that we used a FLAG epitope-labeled construct and confirmed membrane expression by immunofluorescence. We observed smaller total current magnitudes and different rectification and inactivation properties for the short form. The explanation for these different properties is not certain but could result from differences in the cellular environment or levels of expression. Although the magnitude of our currents was smaller than those seen previously, it is comparable to that observed for transient ClC-4 and ClC-5 expression in mammalian cells (9). The magnitudes of the ClC-3-associated currents observed by others, on the other hand, are unusually large. Kawasaki et al. (13) reported a current of 2,535 pA at 10 mV, which corresponds to an electrical resistance of only 4 M
. Since this is comparable to the
lowest typical access resistance of a whole cell pipette, the
conductance of these cell membranes must have been so high that free
solution ionic mobility and not the cell membrane was rate limiting for
current flow. We therefore believe that the currents reported in this
study accurately reflect the properties of ClC-3 when transiently
expressed in CHO-K1 cells.
In summary, we have identified two different isoforms of ClC-3 from rat
hepatocytes and shown functional expression of each in CHO-K1 cells.
The two isoforms can be distinguished by different kinetic properties
but have identical ionic selectivities. In hepatocytes, the native
ClC-3 channel appears to be both intracellular and associated with the
bile canalicular membrane.
| |
ACKNOWLEDGEMENTS |
|---|
We wish to thank Drs. N. Wills, H. Saito, J. Navarro, and R. Green for assistance and helpful discussions. We also thank Dr. L. Reuss for critical review of a preliminary version of the manuscript and Dr. M. Ananthanarayanan for providing the ectoATPase antibody.
| |
FOOTNOTES |
|---|
This work was supported by Grant DK-42917 from the National Institute of Diabetes and Digestive and Kidney Diseases.
Present address of K. Shimada: Department of Surgery and Oncology, Graduate School of Medical Sciences, Kyushu University, Maidashi 3-1-1, Higashi-ku, Fukuoka, 812-8582, Japan.
Address for reprint requests and other correspondence: S. A. Weinman, Dept. of Physiology and Biophysics, Univ. of Texas Medical Branch, 301 Univ. Blvd., Galveston, TX 77555-0641 (E-mail: sweinman{at}utmb.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Received 15 December 1999; accepted in final form 26 February 2000.
| |
REFERENCES |
|---|
|
|
|---|
1.
Al-Awqati, Q.
Chloride channels of intracellular organelles.
Curr Opin Cell Biol
7:
504-508,
1995[Web of Science][Medline].
2.
Chu, S,
Murray CB,
Liu MM,
and
Zeitlin PL.
A short ClC-2 mRNA transcript is produced by exon skipping.
Nucleic Acids Res
24:
3453-3457,
1996
3.
Chu, S,
and
Zeitlin PL.
Alternative mRNA splice variants of the rat ClC-2 chloride channel gene are expressed in lung: genomic sequence and organization of ClC-2.
Nucleic Acids Res
25:
4153-4159,
1997
4.
Devuyst, O,
Christie PT,
Courtoy PJ,
Beauwens R,
and
Thakker RV.
Intra-renal and subcellular distribution of the human chloride channel, CLC-5, reveals a pathophysiological basis for Dent's disease.
Hum Mol Genet
8:
247-257,
1999
5.
Duan, D,
Cowley S,
Horowitz B,
and
Hume JR.
A serine residue in ClC-3 links phosphorylation-dephosphorylation to chloride channel regulation by cell volume.
J Gen Physiol
113:
57-70,
1999
6.
Duan, D,
Winter C,
Cowley S,
Hume JR,
and
Horowitz B.
Molecular identification of a volume-regulated chloride channel.
Nature
390:
417-421,
1997[Medline].
7.
Eggermont, J,
Buyse G,
Voets T,
Tytgat J,
De Smedt H,
Droogmans G,
and
Nilius B.
Alternative splicing of ClC-6 (a member of the ClC chloride-channel family) transcripts generates three truncated isoforms one of which, ClC-6c, is kidney-specific.
Biochem J
325:
269-276,
1997.
8.
Eliassi, A,
Garneau L,
Roy G,
and
Sauvé R.
Characterization of a chloride-selective channel from rough endoplasmic reticulum membranes of rat hepatocytes: evidence for a block by phosphate.
J Membr Biol
159:
219-229,
1997[Web of Science][Medline].
9.
Friedrich, T,
Breiderhoff T,
and
Jentsch TJ.
Mutational analysis demonstrates that ClC-4 and ClC-5 directly mediate plasma membrane currents.
J Biol Chem
274:
896-902,
1999
10.
Gabriel, SE,
Price EM,
Boucher RC,
and
Stutts MJ.
Small linear chloride channels are endogenous to nonepithelial cells.
Am J Physiol Cell Physiol
263:
C708-C713,
1992
11.
Graf, J,
Henderson RM,
Krumpholz B,
and
Boyer JL.
Cell membrane and transepithelial voltages and resistances in isolated rat hepatocyte couplets.
J Membr Biol
95:
241-254,
1987[Web of Science][Medline].
12.
Jentsch, TJ,
Friedrich T,
Schriever A,
and
Yamada H.
The CLC chloride channel family.
Pflügers Arch
437:
783-795,
1999[Web of Science][Medline].
13.
Kawasaki, M,
Suzuki M,
Uchida S,
Sasaki S,
and
Marumo F.
Stable and functional expression of the CIC-3 chloride channel in somatic cell lines.
Neuron
14:
1285-1291,
1995[Web of Science][Medline].
14.
Kawasaki, M,
Uchida S,
Monkawa T,
Miyawaki A,
Mikoshiba K,
Marumo F,
and
Sasaki S.
Cloning and expression of a protein kinase C-regulated chloride channel abundantly expressed in rat brain neuronal cells.
Neuron
12:
597-604,
1994[Web of Science][Medline].
15.
Koch, MC,
Steinmeyer K,
Lorenz C,
Ricker K,
Wolf F,
Otto M,
Zoll B,
Lehmann-Horn F,
Grzeschik KH,
and
Jentsch TJ.
The skeletal muscle chloride channel in dominant and recessive human myotonia.
Science
257:
797-800,
1992
16.
Lorenz, C,
Pusch M,
and
Jentsch TJ.
Heteromultimeric CLC chloride channels with novel properties.
Proc Natl Acad Sci USA
93:
13362-13366,
1996
17.
Luyckx, VA,
Goda FO,
Mount DB,
Nishio T,
Hall A,
Hebert SC,
Hammond TG,
and
Yu AS.
Intrarenal and subcellular localization of rat CLC5.
Am J Physiol Renal Physiol
275:
F761-F769,
1998
18.
Matsumura, Y,
Uchida S,
Kondo Y,
Miyazaki H,
Ko SB,
Hayama A,
Morimoto T,
Liu W,
Arisawa M,
Sasaki S,
and
Marumo F.
Overt nephrogenic diabetes insipidus in mice lacking the CLC-K1 chloride channel.
Nat Genet
21:
95-98,
1999[Web of Science][Medline].
19.
Meng, X-J,
and
Weinman SA.
Cyclic AMP and swelling activated chloride conductance in rat hepatocytes.
Am J Physiol Cell Physiol
271:
C112-C120,
1996
20.
Sakamoto, H,
Kawasaki M,
Uchida S,
Sasaki S,
and
Marumo F.
Identification of a new outwardly rectifying Cl
channel that belongs to a subfamily of the ClC Cl
channels.
J Biol Chem
271:
10210-10216,
1996
21.
Scheinman, SJ.
X-linked hypercalciuric nephrolithiasis: clinical syndromes and chloride channel mutations.
Kidney Int
53:
3-17,
1998[Web of Science][Medline].
22.
Schmieder, S,
Lindenthal S,
Idelson G,
and
Ehrenfeld J.
ClC-3 chloride channel distribution in mammalian tissue (Abstract).
J Physiol (Lond)
517P:
15P,
1999.
23.
Sellinger, M,
Weinman SA,
Henderson RM,
Zweifach A,
Boyer JL,
and
Graf J.
Anion channels in rat liver canalicular plasma membranes reconstituted into planar lipid bilayers.
Am J Physiol Gastrointest Liver Physiol
262:
G1027-G1032,
1992
24.
Semenov, EP,
and
Pak WL.
Diversification of Drosophila chloride channel gene by multiple posttranscriptional mRNA modifications.
J Neurochem
72:
66-72,
1999[Web of Science][Medline].
25.
Shimada, K,
Navarro J,
Goeger DE,
Mustafa SB,
Weigel PH,
and
Weinman SA.
Expression and regulation of leukotriene-synthesis enzymes in rat liver cells.
Hepatology
28:
1275-1281,
1998[Web of Science][Medline].
26.
Song, CS,
Rubin W,
Rifkind AB,
and
Kappas A.
Plasma membranes of the rat liver. Isolation and enzymatic characterization of a fraction rich in bile canaliculi.
J Cell Biol
41:
124-132,
1969
27.
Strange, K,
Emma F,
and
Jackson PS.
Cellular and molecular physiology of volume-sensitive anion channels.
Am J Physiol Cell Physiol
270:
C711-C730,
1996
28.
Uchida, S,
and
Marumo F.
Molecular characterization of chloride channels in the kidney.
Exp Nephrol
4:
135-138,
1996[Web of Science][Medline].
29.
Venkatachalam, M,
Weinberg J,
Patel Y,
Saikumar P,
and
Dong Z.
Cytoprotection of kidney epithelial cells by compounds that target amino acid gated chloride channels.
Kidney Int
49:
449-460,
1996[Web of Science][Medline].
30.
Waters, SL,
Sarang SS,
Wang KKW,
and
Schnellmann RG.
Calpains mediate calcium and choride influx during the late phase of cell injury.
J Pharmacol Exp Ther
283:
1177-1184,
1997
31.
Weinman, SA,
Carruth MW,
and
Dawson PA.
Bile acid uptake via the human apical sodium-bile acid cotransporter is electrogenic.
J Biol Chem
273:
34691-34695,
1998
This article has been cited by other articles:
![]() |
C. W. Habela, M. L. Olsen, and H. Sontheimer ClC3 Is a Critical Regulator of the Cell Cycle in Normal and Malignant Glial Cells J. Neurosci., September 10, 2008; 28(37): 9205 - 9217. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yin, Y. Tong, H. Zhu, and M. A. Watsky ClC-3 is required for LPA-activated Cl- current activity and fibroblast-to-myofibroblast differentiation Am J Physiol Cell Physiol, February 1, 2008; 294(2): C535 - C542. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Matsuda, M. S. Filali, K. A. Volk, M. M. Collins, J. G. Moreland, and F. S. Lamb Overexpression of CLC-3 in HEK293T cells yields novel currents that are pH dependent Am J Physiol Cell Physiol, January 1, 2008; 294(1): C251 - C262. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Denton, K. Nehrke, X. Yin, A. M. Beld, and K. Strange Altered gating and regulation of a carboxy-terminal ClC channel mutant expressed in the Caenorhabditis elegans oocyte Am J Physiol Cell Physiol, April 1, 2006; 290(4): C1109 - C1118. [Abstract] [Full Text] [PDF] |
||||
![]() |
W.-Z. Lan, H. Abbas, H. D. Lam, A.-M. Lemay, and C. E. Hill Contribution of a time-dependent and hyperpolarization-activated chloride conductance to currents of resting and hypotonically shocked rat hepatocytes Am J Physiol Gastrointest Liver Physiol, February 1, 2005; 288(2): G221 - G229. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. G. Jin, J. K. Kim, D. K. Yang, S. J. Cho, J. M. Kim, E. J. Koh, H. C. Jung, I. So, and K. W. Kim Fundamental role of ClC-3 in volume-sensitive Cl- channel function and cell volume regulation in AGS cells Am J Physiol Gastrointest Liver Physiol, November 1, 2003; 285(5): G938 - G948. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-X. Wang, W. J. Hatton, G. L. Wang, J. Zhong, I. Yamboliev, D. Duan, and J. R. Hume Functional effects of novel anti-ClC-3 antibodies on native volume-sensitive osmolyte and anion channels in cardiac and smooth muscle cells Am J Physiol Heart Circ Physiol, October 1, 2003; 285(4): H1453 - H1463. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Olsen, S. Schade, S. A. Lyons, M. D. Amaral, and H. Sontheimer Expression of Voltage-Gated Chloride Channels in Human Glioma Cells J. Neurosci., July 2, 2003; 23(13): 5572 - 5582. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Gentzsch, L. Cui, A. Mengos, X.-b. Chang, J.-H. Chen, and J. R. Riordan The PDZ-binding Chloride Channel ClC-3B Localizes to the Golgi and Associates with Cystic Fibrosis Transmembrane Conductance Regulator-interacting PDZ Proteins J. Biol. Chem., February 14, 2003; 278(8): 6440 - 6449. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Isnard-Bagnis, N. Da Silva, V. Beaulieu, A. S. L. Yu, D. Brown, and S. Breton Detection of ClC-3 and ClC-5 in epididymal epithelium: immunofluorescence and RT-PCR after LCM Am J Physiol Cell Physiol, January 1, 2003; 284(1): C220 - C232. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Jentsch, V. Stein, F. Weinreich, and A. A. Zdebik Molecular Structure and Physiological Function of Chloride Channels Physiol Rev, April 1, 2002; 82(2): 503 - 568. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mohammad-Panah, C. Ackerley, J. Rommens, M. Choudhury, Y. Wang, and C. E. Bear The Chloride Channel ClC-4 Co-localizes with Cystic Fibrosis Transmembrane Conductance Regulator and May Mediate Chloride Flux across the Apical Membrane of Intestinal Epithelia J. Biol. Chem., January 4, 2002; 277(1): 566 - 574. [Abstract] [Full Text] |
||||
![]() |
A. Majid, P. D Brown, L. Best, and K. Park Expression of volume-sensitive Cl- channels and ClC-3 in acinar cells isolated from the rat lacrimal gland and submandibular salivary gland J. Physiol., July 15, 2001; 534(2): 409 - 421. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. S. Lamb, R. W. Graeff, G. H. Clayton, R. L. Smith, B. C. Schutte, and P. B. McCray Jr. Ontogeny of CLCN3 Chloride Channel Gene Expression in Human Pulmonary Epithelium Am. J. Respir. Cell Mol. Biol., April 1, 2001; 24(4): 376 - 381. [Abstract] [Full Text] |
||||
![]() |
R. M. Roman, R. L. Smith, A. P. Feranchak, G. H. Clayton, R. B. Doctor, and J. G. Fitz ClC-2 chloride channels contribute to HTC cell volume homeostasis Am J Physiol Gastrointest Liver Physiol, March 1, 2001; 280(3): G344 - G353. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Huang, J. Liu, A. Di, N. C. Robinson, M. W. Musch, M. A. Kaetzel, and D. J. Nelson Regulation of Human CLC-3 Channels by Multifunctional Ca2+/Calmodulin-dependent Protein Kinase J. Biol. Chem., June 1, 2001; 276(23): 20093 - 20100. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, T. Wang, Z. Zhao, and S. A. Weinman The ClC-3 chloride channel promotes acidification of lysosomes in CHO-K1 and Huh-7 cells Am J Physiol Cell Physiol, June 1, 2002; 282(6): C1483 - C1491. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |