AJP - GI Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 279: G426-G436, 2000;
0193-1857/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (21)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Esworthy, R. S.
Right arrow Articles by Chu, F.-F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Esworthy, R. S.
Right arrow Articles by Chu, F.-F.
Vol. 279, Issue 2, G426-G436, August 2000

Low glutathione peroxidase activity in Gpx1 knockout mice protects jejunum crypts from gamma -irradiation damage

R. Steven Esworthy1, Jeffrey R. Mann2, Mindy Sam1, and Fong-Fong Chu1

1 Department of Medical Oncology, City of Hope Medical Center, and 2 Department of Biology, City of Hope, Beckman Research Institute, Duarte, CA 91010


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Gpx1 knockout (KO) mice had a higher number of regenerating crypts in the jejunum than did Gpx2-KO or wild-type mice analyzed 4 days after >= 10 Gy gamma -irradiation. Without gamma -irradiation, glutathione peroxidase (GPX) activity in the jejunal and ileal epithelium of Gpx1-KO mice was <10 and ~35%, respectively, of that of the wild-type mice. Four days after exposure to 11 Gy, GPX activity in wild-type and Gpx1-KO ileum was doubled and tripled, respectively. However, jejunal GPX activity was not changed. Thus the lack of GPX activity in the jejunum is associated with better regeneration of crypt epithelium after radiation. Gpx2 gene expression was solely responsible for the increase in GPX activity in the ileum, since radiation did not alter GPX activity in Gpx2-KO mice. The intestinal Gpx2 mRNA levels of Gpx1-KO and wild-type mice increased up to 14- and 7-fold after radiation, respectively. Although the Gpx1-KO jejunum had higher levels of PGE2 than the wild-type jejunum after exposure to 0 or 15 Gy, these differences were not statistically significant. Thus whether GPX inhibits PG biosynthesis in vivo remains to be established. We can conclude that the Gpx2 gene compensates for the lack of Gpx1 gene expression in the ileal epithelium. This may have abolished the protective effect in Gpx1-KO mice against the radiation damage in the ileum.

Gpx2 gene induction; microcolony survival assay; Gpx2-knockout mice; antioxidant protein 2; gene compensation


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

THE PREVAILING THEORY on the mechanisms of radiation-induced cell death identifies DNA single- and double-strand breaks as the direct damaging effect. Such damage is produced from direct interaction of the DNA with ionizing radiation or with the hydroxyl free radicals generated from radiolysis of water and other molecules. The cells with unrepaired DNA damage will die of necrosis or apoptosis (14). Although generation of H2O2 is an alternative route for hydroxyl free radical generation (42), there is little evidence that elevated Se-dependent glutathione peroxidase (GPX) activity protects cells from radiation damage (9, 25, 32, 35, 36).

The intestinal crypt epithelial cells are very sensitive to abdominal and pelvic radiation therapy. The actively dividing transitory epithelial cells are the most sensitive to radiation-induced injury. The damage in the mucosal epithelium can result in a variety of symptoms, including diarrhea, electrolyte imbalance, and sepsis. The survival of slowly proliferating crypt stem cells appears to play a central role in mucosal regeneration following injury (8, 31). Several mitogens enhance the survival of intestinal epithelial cells after radiation injury. These include keratinocyte growth factor (KGF), stem cell factor (SCF), and prostaglandins (PGs) (8, 11, 22).

KGF is a newly recognized member of the heparin-binding fibroblast growth factor family. Short-term pretreatment with KGF, and to a lesser extent SCF, from 2 h to 3 days before irradiation provides significant protection of the crypts (11, 22). The exact mechanism for the KGF or SCF enhancement of crypt survival is not clear. KGF is a potent inducer for a human analog of the antioxidant protein 2 (Aop2), which has a weak Se-independent GPX activity (13, 18, 27, 28, 37). Aop2 has no homology with the Se-dependent GPXs. Instead, Aop2 has homology with antioxidant protein 1 (Aop1) family, which used to be known as thiol-specific antioxidant protein (18). The human Aop2 is also known as non-Se GPX, 1-Cys peroxiredoxin, and KGF-regulated gene 1 (12, 13, 20, 21, 27). Aop2 appears to be ubiquitous and is highly expressed in the nasal epithelium, skin, and eye tissues including the ciliary body, retina, and iris (37). Whether Aop2 can contribute significantly to total GPX activity in intestinal epithelium and thus affect crypt hydroperoxide metabolism is not known. Therefore, we have included Aop2 in this study.

PGs are important mediators of epithelial integrity and function in the gastrointestinal tract. Many PGs protect gastric and intestinal mucosa from damaging agents, including gamma -irradiation (15). Cyclooxygenases (COXs) catalyze two key steps in PGs biosynthesis: oxygenation and cyclization of arachidonic acid to form PGG2 and the reduction of the hydroperoxide of PGG2 to form PGH2. Indomethacin, an inhibitor of both COX1 and COX2, reduced the number of surviving crypts in the irradiated mice (8). Although peroxynitrite, the coupling product of nitric oxide and superoxide anion, activates COX in activated macrophages in the presence of GPX (24), hydroperoxides activate COX in vitro, an activity inhibited by GPX (2, 23, 26). Whether GPX inhibits PG biosynthesis in vivo has not been established. In this study, we have investigated the effect of GPX activity on intestinal crypt survival and PGE2 concentrations after exposure to a high dose of gamma -irradiation. An inverse correlation between GPX activity and either crypt survival or PGE2 concentration would support the inhibitory effect of GPX on PG synthesis in the intestinal epithelium.

There are two major cellular Se-dependent GPX isozymes expressed in the intestinal epithelium: the classic ubiquitous GPX-1 encoded by the Gpx1 gene, and the epithelium-specific GPX-GI encoded by the Gpx2 gene (3, 10). Unlike the rather uniform distribution of GPX-1 in rat small intestine along the cephalocaudal axis, a higher level of Gpx2 gene expression was detected in the distal section of the mouse small intestine or the ileum (6, 10). We have estimated that GPX-1 contributed >80% of total GPX activity in mouse proximal small intestine, and GPX-1 and GPX-GI contributed ~50 and 35% of total GPX activity in the distal small intestine. Since these two isozymes have very similar substrate specificity, this apparent redundant gene expression suggests that the two isozymes may be regulated differently to serve different physiological functions.

In this manuscript, we describe the making of Gpx2 knockout mouse lines. The homozygous Gpx2 knockout mice are apparently normal. These mice with disrupted Gpx1 or Gpx2 gene expression were analyzed for GPX activity and crypt regeneration after exposure to gamma -irradiation. We found that the crypt survival is highly correlated with the lack of GPX activity. Our result provides the first link between GPX activity and radiation sensitivity in the intestinal epithelium. This study may provide a reason for the development of GPX-specific inhibitors to be used as protective agents on the intestinal epithelium during radiotherapy or accidental exposure to radiation.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Animals. The generation of mice with disrupted Gpx1 gene expression (Gpx1-KO) has been described previously (17). These homozygous Gpx1-KO mice on a mixed C57BL/6J (B6) and 129/Sv (129) genetic background (B6 × 129) were maintained by inbreeding. The wild-type control mice originated from heterozygous Gpx1-KO parents and were maintained similarly as a mixed B6 × 129 line. Breeding B6 × 129 Gpx1-KO with B6 for six generations generated the second Gpx1-KO subline in a B6 background. Southern blots were used for all genotyping. GPX assays were performed to confirm the phenotypes on the hemolysate from 25 µl of blood after rinsing the red blood cells with PBS. The relative specific activity was estimated as a fixed arbitrary ratio of activity to the A540 of Drabkin's reagent-treated hemolysate (1). Wild-type B6 mice were purchased from Jackson Labs (Bar Harbor, MA) and used as the controls for B6 Gpx1-KO mice.

To isolate the mouse Gpx2 gene without interference from its pseudogene (5), intron primers were used for screening by PCR. Three positively identified P1 clones (nos. 8470, 8471, and 8472) were isolated from a genomic library of 129/Sv embryonic stem (ES) cells (Genome Systems, St. Louis, MO). A Hind III fragment (6.5 kb) isolated from the 8471 P1 clone was subcloned into pBluescript (Stratagene, La Jolla, CA) and sequenced (GenBank accession no. AJ249277). It contained 2 kb of 5' untranscribed region, 0.3 kb of exon 1, 2.2 kb of intron, 0.8 kb of exon 2, and 1.5 kb of 3' untranscribed region. The Gpx2-KO construct was made by substituting the exon 1 with the neo gene using the pPNT vector (40), which also contains a herpes simplex viral thymidine kinase gene cassette as shown in Fig. 1. The linearized pPNT-Gpx2-KO construct was transfected into W9.5 ES cells of the 129S3/SvImJ (129S3) mouse strain according to procedures previously described (39, 41). ES clones resistant to 0.3 mg/ml G418 and 2 µM ganciclovir were analyzed for the evidence of homologous recombination. Two correctly targeted clones, nos. 8 and 21, were injected into (CBA/CaJ-a/a × B6)F1 × B6 blastocysts, and resulting chimeric males were mated to B6 females to obtain germ line transmission of the mutation. The heterozygous Gpx2-KO mice were then intercrossed to generate mice homozygous for the mutation, i.e., Gpx2-KO mice. As controls, wild-type Gpx2+/+ mice from the same intercross were used. Thus all mice studied were of a mixed 129S3 × B6 genetic background. Occasionally, the B6 × 129 wild-type mice generated for the Gpx1-KO controls were used as the controls for the Gpx2-KO mice.


View larger version (74K):
[in this window]
[in a new window]
 
Fig. 1.   Targeted disruption of the mouse Gpx2 gene (Gpx2-KO) and the analysis of Gpx2-KO mice. A: genomic structure and partial restriction map of the wild-type (WT) mouse Gpx2 locus (top), the targeting vector pPNT-Gpx2-KO (middle), and the targeted locus (bottom). Striped boxes contain the mouse gene. Black boxes contain the Gpx2 exons. The pPNT-Gpx2-KO has a neo cassette, which confers neomycin resistance, and a herpes simplex viral thymidine kinase gene cassette (hsv-tk), which contains a herpes simplex viral thymidine kinase gene driven by mouse phosphoglycerate kinase-1 promoter. The recognition sites for restriction enzymes are as follows: A, Apa I; H, Hind III; K, Kpn I; N, Not I; B, BamH I. The exon 1 and exon 2 probes are shown in the open box on the top of the wild-type Gpx2 gene. B: Southern blot of wild-type and Gpx2-KO mouse DNA. The Apa I-digested genomic DNA was probed with the Gpx2 exon 2. Lane 1 shows 7 kb of wild-type Gpx2 DNA and ~14 kb of the Gpx2-ps pseudogene in the homozygous Gpx2+/+ DNA. Lane 2 shows 4.9 kb of the targeted allele in addition to the 7 kb wild-type allele and the ~14 kb pseudogene in the heterozygous Gpx2+/- DNA. Lane 3 shows the 4.9 kb of targeted allele and the ~14 kb pseudogene in the homozygous Gpx2-KO (-/-) DNA. C: Northern blot of total RNA isolated from the middle small intestine of wild-type, heterozygous, and homozygous mice. Total RNA was isolated 4 days after whole body exposure to 0 and 17 Gy. Gpx2 exon 1 mRNA is present in wild-type and heterozygous Gpx2-KO mice but not homozygous Gpx2-KO mice, as shown at top. The 2nd panel shows a 1-kb wild-type Gpx2 mRNA and a 3-kb Gpx2-KO mRNA with weaker intensity when probed with Gpx2 exon 2. The 3rd and 4th panels show the Gpx1 and beta -actin mRNA.

Whole body irradiation. All mice were maintained on a 12:12-h light/dark schedule and given free access to standard lab mouse chow and water. Mice of both genders at 8-16 wk of age were placed into a ventilated Plexiglas pie container during exposure to gamma -irradiation. All exposures were done between 7:15 and 8:15 AM to minimize the potential variations caused by circadian rhythm (19). The mice were exposed to a 60Co irradiator (Theratron-80 S/N 140; Atomic Energy of Canada) at 51-56 cGy/min with a source-to-skin distance of ~80 cm. The exposure procedure and all other mouse work were done with the approval of the City of Hope Research Animal Care Committee. At certain time points from 6 h to 7 days after exposure, mice were euthanatized by halothane (Halocarbon Labs, North Augusta, SC).

Crypt survival assay. Crypt microcolony survival was measured in animals terminated 4 days after irradiation following the described procedure (30, 43). Two 3-cm sections of the jejunum and the ileum starting from 1 cm distal to the pylorus end of stomach and 1 cm proximal to the cecum were excised. They were rinsed and fixed in Bouin's fixative for 2-3 h and, after rinsing 3 times with 50% ethanol, were equilibrated in 70% ethanol overnight. They were cut to 1-cm lengths and then embedded longitudinally in paraffin. They were then sectioned onto slides and stained with hematoxylin and eosin. The number of surviving crypts was scored from cross-sections. Two to four complete cross-sections were scored from each region of mice. Two to four mice exposed to each dose of radiation were analyzed in each experiment.

Assay of GPX activity in intestinal epithelium. The GPX activity was determined on mouse intestinal epithelium. Jejunal and ileal epithelial cells were isolated from two 12-cm sections (total small intestine is ~36 cm long) of the proximal and the distal small intestine (4, 10). Briefly, after the intestinal lumen was rinsed with buffer A containing PBS and 1 mM dithiothreitol, the epithelial cells were eluted three times with buffer B containing 1.5 mM EGTA in buffer A after incubation at 37°C for 10, 20, and 30 min. These isolated cells were pooled and washed 3 times in PBS. Four volumes of homogenate buffer containing 0.15 M Tris, pH 7.2, 0.1 M NaCl, 5 mM EGTA, and a cocktail of protease inhibitors were added to the packed cells. The cells were sonicated by five 1-s bursts with the use of a cell sonicator equipped with a microprobe (Branson Cell Disruptor 200; Branson Sonic Power, Danbury, CT). After centrifugation at 22,000 g for 30 min, GSH was added to an aliquot of the supernatant to 5 mM final concentration for the preservation of GPX-GI activity during freezing and thawing. The GPX activity was measured with 60 µM H2O2 and 3 mM GSH at pH 7.3. The protein concentration was determined with a BCA assay (Pierce Chemical, Rockford, IL) with bovine serum albumin as the standard.

Analysis of Southern and Northern blots. Genomic DNA was isolated from ES cells and 1 cm of mouse tails following the described procedure (34). Genotyping of the Gpx1 or Gpx2 genes was done by Southern blot analysis on the BamH I or Apa I digested genomic DNA. After resolving 10 µg of DNA per sample on 0.7% agarose gels, the DNA was denatured with 0.25 M HCl for 10 min and then transferred onto Zeta Probe blotting membranes (Bio-Rad, Richmond, CA) in 0.4 N NaOH overnight. Total RNA was isolated from 60 mg (~0.6 cm) of small intestine. After homogenization by polytron in the lysis buffer, the total RNA was isolated with the RNeasy kit (Qiagen, Valencia, CA). Ten micrograms of RNA per sample were resolved in a formaldehyde-denaturing agarose gel containing 1.3% agarose and then transferred to a Zeta Probe blotting membrane with 10× standard saline citrate (34). The hybridization and washing was performed at 62°C in buffers that had high concentrations of SDS, as recommended by the manufacturer. All presented mRNA levels were normalized against beta -actin mRNA levels. Similar results were obtained with normalization against 28S rRNA, which was also probed initially and later periodically. Quantification of the Gpx1 and Gpx2 mRNA levels was done with phosphor imaging after 6- to 24-h exposure (Molecular Dynamics, Sunnyvale, CA).

The 600 bp of EcoR I fragment of the mouse Gpx1 gene and the 400 bp of the mouse Aop2 cDNA probes have been described previously (4, 27). The 220 bp of the mouse Gpx2 exon 1 probe was generated by PCR with PX212 (GGGGCTCACTCTGCGCTTCA) and PX222 (CTTGGCTTCCCTTGCAACCAA) primers based on the human Gpx2 sequence. The 450 bp of the Gpx2 exon 2 probe was generated by PCR with the mouse mPX201 (GGACGATATTAAGGGAATGCCTT) and the human PX221 (GAGAACTGTCAGAATGAGGAGAT) primers (5). The Gpx2 exon 2 probe was used mostly because it yielded a much stronger signal. Routinely, the blots were probed in the order of Gpx2, beta -actin, Gpx1, and Aop2. The old signal was stripped by two incubations of the blots at 80°C in 0.1% SDS and 0.1× standard saline citrate for 20 min.

Measurement of PGE2 and protein levels. The mice backcrossed to B6 for 7-8 generations were used for this study. About 0.12 g of the jejunum (a 4-cm segment from 1 cm distal to the stomach) and 0.1 g of the ileum (a 4-cm segment from 1 cm proximal to cecum) were processed to measure PGE2 concentrations. These two sections of small intestine were rinsed with PBS and then snap frozen in liquid nitrogen. Without thawing, they were homogenized in 1 ml of 100% methanol containing 1 mM indomethacin to inhibit COX activity in a prechilled 10 ml cylinder with a polytron. The homogenization buffer was also prechilled on dry ice. After centrifugation at 10,000 g for 15 min, 0.5 ml of supernatant was added to 10 ml of H2O, pH 3. A trace amount of 3H-PGE2 (~10,000 dpm) with a high specific activity was added to monitor for the yield through organic extraction. Ten milliliters of diluted supernatant was passed through an activated C-18 Sep-Pak cartridge (Waters, Milford, MA) for solid-phase extraction. The column was washed with 5 ml H2O followed by 5 ml hexane. Prostaglandins were eluted in 5 ml of ethyl acetate containing 1% methanol. Half a milliliter was counted for radioactivity, and another 0.1 ml was lyophilized and resuspended in 0.1-0.5 ml of an enzyme immunometric assay buffer supplied by the manufacturer (Cayman Chemical, Ann Arbor, MI). Duplicate PGE2 assays were performed on an aliquot of each sample with enzyme immunoassay.

Protein concentrations in the clarified methanol extract were determined with BCA assay (Pierce). Bovine serum albumin was used as a standard. The interference of indomethacin was accounted for by assaying the homogenization buffer. The value obtained from the homogenization buffer was subtracted from all sample values. We estimated that 0.5 µg of protein had been extracted from 1 mg of wet tissue.

Statistical analysis. All statistical analysis (ANOVA) was done with a two-tailed Student's t-test using Microsoft Excel 97. A P value of <0.05 was considered significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Generation of Gpx2-KO mice. The target for Gpx2 gene disruption was the 300 bp of exon 1, which contained the UGA codon for the selenocysteine amino acid residue (Fig. 1A). A 2-kb DNA sequence 5' to the translation start site and 2.2 kb of mouse Gpx2 intron were generated by PCR and then inserted 5' and 3' to a 1.8-kb neo gene cassette and flanking sequence in pPNT vector. The 5' end of the neo cassette had an Apa I recognition site. Thus, after homologous recombination, Apa I digestion resulted in a 4.9-kb fragment from the disrupted Gpx2 gene and a 7-kb fragment from the wild-type Gpx2 gene when probed with the exon 2 probe (Fig. 1B). The ~14 kb of Apa I fragment appeared to contain the Gpx2 pseudogene (5). Lanes 1, 2, and 3 of the Southern blot in Fig. 1B contain mouse DNA isolated from a wild-type, a heterozygous Gpx2-KO, and a homozygous Gpx2-KO mouse, respectively. Expression of the Gpx2 mRNA in each type of mouse is shown in Fig. 1C. No Gpx2 mRNA was detectable in homozygous Gpx2-KO mice when the Gpx2 exon 1 was used as the probe. A Gpx2 mRNA of higher molecular weight was detected in the Gpx2-KO mice when the Gpx2 exon 2 was used as the probe.

Two ES-transfectant cell lines were used to create two independent mouse knockout lines, designated as nos. 8 and 21. No difference can be detected between these two lines based on Southern blot, Northern blot, and activity assays (data not shown). Therefore, we have combined the results obtained from these two lines.

Crypt survival. Whether Gpx1 and Gpx2 gene expression could have any effect on the survival of crypt epithelium after exposure to gamma -irradiation was analyzed in the jejunum and the ileum (Fig. 2). The number of cryptlike foci of the surviving epithelial cells was scored on the cross-sections of intestine 4 days after exposure. Each epithelial focus represents survival of one or more clonogenic stem cells able to regenerate a crypt. Figure 2 shows the jejunum of B6 × 129 Gpx1-KO and wild-type mice after exposure to 0, 15, 17, and 20 Gy. Although gamma -irradiation destroyed most of the epithelial cells, Gpx1-KO mice had more surviving stem cells proliferating to form regenerative foci than Gpx2-KO mice and wild-type mice (Fig. 3).


View larger version (83K):
[in this window]
[in a new window]
 
Fig. 2.   Regenerating jejunal crypt foci after exposure to high-dose gamma -irradiation. Cross-sections of the jejunum were obtained from wild-type (Gpx1+/+; A, C, E, and G) and the Gpx1-KO (Gpx1-/-; B, D, F, and H) mice 4 days after exposure to 0, 15, 17, and 20 Gy. The regenerating crypts exhibit darker stained epithelial cells, which locate close to the muscular layer.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 3.   Survival of jejunal and ileal crypt epithelium after exposure to gamma -irradiation in wild-type, Gpx1-KO, and Gpx2-KO mice. Sections of the jejunum and ileum were harvested from the mice 4 days after exposure to gamma -irradiation. The number of surviving crypts was counted and divided by 120 for the jejunum and 101 for the ileum, which are the numbers of crypts found in untreated mice, to get a percentage. The data are presented as log of 100 times the percentage value. A and C: crypt survival of the wild-type and Gpx1-KO mice of a mixed C57BL/6J (B6) and 129/Sv (129) genetic background (B6 × 129). Jejunum is shown at top, and ileum is shown at bottom. B and D: crypt survival of the same wild-type and Gpx2-KO mice of B6 × 129 background. Jejunum is shown at top, and ileum is shown at bottom. The same wild-type B6 × 129 mice are shown at left and right. Each point represents 2-4 mice. Four counts were obtained from each of the jejunal and ileal sections from each mouse. Statistical difference (P < 0.005) was found between the B6 × 129 wild-type and the B6 × 129 Gpx1-KO jejunum exposed to >= 11 Gy, between the B6 wild-type and the B6 Gpx1-KO exposed to >= 13.6 Gy, and between the B6 × 129 wild-type and the B6 × 129 Gpx1-KO ileum. No differences were found between the B6 wild-type and the B6 Gpx1-KO in ileal crypt survival or between the B6 × 129 wild-type and B6 × 129 Gpx2-KO mice in either jejunal or ileal crypt survival by actual paired comparisons.

The fractional crypt survival was determined by the total number of crypt foci divided by the number of crypts in the nonirradiated intestines. Because the radiation damage follows the first order of kinetics, the percentage of crypt survival is plotted on a log scale. As shown in Fig. 3, after exposure to 15 Gy, there was <10% survival, plotted as log10(10) surviving crypt foci of the control. Since the genetic background can affect crypt survival, we have analyzed this in both B6 and B6 × 129 Gpx1-KO and wild-type mice. The jejunal crypt of Gpx1-KO is more resistant to radiation than wild-type and Gpx2-KO mice regardless of mouse strain background. The ileal crypts of B6 × 129 Gpx1-KO mice are more resistant to radiation than the B6 × 129 wild-type, but the ileal crypts of B6 Gpx1-KO mice had similar sensitivity to radiation as those of the B6 wild-type. Thus the protection of Gpx1-KO on the jejunal crypts transcends the strain differences, and the genetic background is as big a factor in the ileal crypts. No difference was found between Gpx2-KO and wild-type mice in both ileum and jejunum.

Elevation of GPX activity. To determine whether the crypt survival correlated with GPX activity, we analyzed the GSH-dependent H2O2-reducing activity in the jejunum and ileum. As shown in Fig. 4, the change in GPX activity was monitored during the first 7 days after exposure to 11 Gy. Kinetics of activity change were studied at 11 Gy since this is at the threshold of crypt sterilization. The jejunal epithelium of Gpx1-KO mice had very low GPX activity, in contrast to the high level of GPX activity in the wild-type mice throughout the 7 days. On the contrary, the ileal epithelium of Gpx1-KO mice had ~35% of the GPX activity in the wild-type mice before exposure to gamma -irradiation. Four days after irradiation, GPX activity in the ileal epithelium of Gpx1-KO and wild-type mice had quadrupled and doubled, respectively. The ileal GPX activity in the exposed Gpx1-KO mice was higher than that in the unexposed wild-type mice. One each of B6 and B6 × 129 Gpx1-KO mice and two B6 × 129 wild-type mice were assayed at each time point as shown in Fig. 4. Since we did not find any difference in GPX activity between these two lines of Gpx1-KO mice, we have combined the data.


View larger version (22K):
[in this window]
[in a new window]
 
Fig. 4.   Kinetics of GPX activity alteration in the jejunal (A) and ileal (B) epithelium after exposure to 11 Gy. The epithelium was isolated from the jejunum (starting at 1 cm from pyloric valve to <FR><NU>1</NU><DE>3</DE></FR> of the small intestine) and the ileum (the distal <FR><NU>1</NU><DE>3</DE></FR> of the total small intestine) and assayed for H2O2-reducing GPX activity. Error bars represent variances of the means; n = 2. Two B6 × 129 wild-type mice and one each of B6 × 129 and B6 Gpx1-KO were analyzed at each time point.

The increase of GPX activity in ileal epithelium appeared to be solely contributed by increased levels of Gpx2 mRNA. As shown in Fig. 5, Gpx2-KO ileal epithelium did not increase GPX activity assayed at the fourth day after exposure to 11 Gy. This is in contrast to the wild-type and Gpx1-KO ileal epithelium, in which the GPX activity increased 50% and twofold, respectively, at the fourth day after exposure. Each column represents the mean of 9-38 mice.


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 5.   Increase of GPX activity in mouse ileal epithelium after exposure to 11 Gy. The ileal epithelium was isolated from wild-type, Gpx1-KO, and Gpx2-KO mice 4 days after exposure to 0 and 11 Gy. The error bars are standard deviations of the means from 38 control and 13 irradiated wild-type mice, 38 control and 9 irradiated Gpx1-KO mice, and 12 control and 13 irradiated Gpx2-KO mice. Significant difference (P < 0.01) in GPX activity levels is found between the control and irradiated wild-type mice and between the control and irradiated Gpx1-KO mice. No difference was found between the control and irradiated Gpx2-KO mice.

Elevation of the Gpx2 mRNA levels after gamma -irradiation. To determine whether the increase in GPX activity correlated with the increase of the Gpx2 mRNA level, but not the Gpx1 mRNA level, the intestinal RNA was analyzed on Northern blots. Total RNA was isolated from the middle small intestine (distal jejunum) of wild-type mice between 0 and 6 days after exposure to 11 Gy. As shown in Fig. 6, the Gpx2 mRNA levels in wild-type mice were tripled 3-4 days after exposure, whereas the Gpx1 mRNA levels did not change significantly. The Aop2 mRNA level was doubled after irradiation, although the relative abundance of the Aop2 mRNA was 10-fold lower than the Gpx2 mRNA. The Gpx2 and Aop2 mRNA were maintained at the elevated levels afterwards. The kinetics of Gpx2 mRNA level change in the Gpx1-KO small intestine was also analyzed (Fig. 7). Three days after exposure to 11 Gy, the Gpx2 mRNA levels increased 15-fold and the Aop2 mRNA level increased 2-fold. Unlike the wild-type mice, the increase of Gpx2 and Aop2 mRNA levels in the Gpx1-KO mice was transient. The mRNA levels returned to near basal levels 6 days after exposure.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 6.   Kinetics of increased antioxidant mRNA levels in middle small intestine of wild-type mice after exposure to 11 Gy. Top: Northern blot of total RNA being probed with Gpx2 exon 2, Gpx1, antioxidant protein 2 (Aop2), and beta -actin cDNAs. The analysis of antioxidant RNA levels after being normalized against the beta -actin mRNA level is shown at bottom. Error bars are the variances of the means; n = 2.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 7.   Kinetics of change in antioxidant mRNA levels in middle small intestine of homozygous Gpx1-KO mice after exposure to 11 Gy. Top: Northern blot of total RNA being probed with Gpx2 exon 2, Aop2, and beta -actin cDNAs. The blot has also been probed with Gpx1 cDNA to confirm its phenotype. The analysis of the antioxidant mRNA levels after being normalized against beta -actin mRNA level is shown at bottom. Error bars represent the variances of the means; n = 2. Similar results were obtained when normalized against the 28S rDNA level. The experiment was repeated once with a similar result.

The dosage response to gamma -irradiation of the increase of Gpx2 mRNA levels was studied in the middle small intestine of B6 × 129 Gpx1-KO and wild-type mice (Fig. 8). When exposed to 0-6 Gy, the Gpx2 mRNA levels in the Gpx1-KO mice were at 50% of wild-type mice assayed at the third day after exposure. When exposed to >10 Gy, the Gpx1-KO and wild-type mice had the same levels of Gpx2 mRNA. Each data point represents the average of 2-4 mice.


View larger version (11K):
[in this window]
[in a new window]
 
Fig. 8.   Dose response of Gpx2 mRNA elevation to gamma -irradiation in the mouse GI tract. The total RNA was isolated from both the jejunum and the ileum and analyzed separately from 2 mice at the 3rd day after exposure to 0, 1.5, 3, 6, and 12 Gy. The data from the jejunum and the ileum were pooled and presented as the means. The rest of RNA was isolated from the middle small intestine at the 4th day after exposure. The Gpx2 mRNA levels were normalized against the beta -actin mRNA levels. All mice had B6 × 129 background.

Since Gpx1 gene expression appeared to have an impact on the Gpx2 mRNA levels, we had also analyzed whether there was a reciprocal effect between these two genes, i.e., if the Gpx1 mRNA levels were altered in the Gpx2-KO mice. Figure 1C shows the Northern blot analysis of RNA isolated from the middle small intestine of the Gpx2-KO and wild-type mice at the fourth day after exposure to 0 and 17 Gy. The Gpx2-KO mRNA of higher molecular weight was expressed at 50% of the endogenous Gpx2 mRNA level. The Gpx2-KO mRNA can only be detected with the Gpx2 exon 2 probe but not with the exon 1 probe. The lower level of Gpx2-KO mRNA was evident in the heterozygous mice, as shown in lane 12 of Fig. 1C.

After exposure to gamma -irradiation, the Gpx2-KO mRNA level was also elevated in small intestine, as shown in Figs. 1C and 9. The latter figure is the analysis of Fig. 1C. The amount of Gpx2 mRNA was eightfold higher (from 0.58 ± 0.17 to 5.35 ± 2.96 of the normalized Gpx2 mRNA level; P = 0.04) in wild-type mice after exposure to 17 Gy when the amount of Gpx2-KO mRNA was onefold higher in Gpx2-KO mice (from 0.29 ± 0.08 to 0.49 ± 0.25; P = 0.17). There was no change in the Gpx1 mRNA level in the irradiated Gpx2-KO mice (from 0.56 ± 0.03 to 0.65 ± 0.19 of the normalized Gpx1 mRNA level; P = 0.40) and wild-type mice (from 0.51 ± 0.06 to 0.65 ± 0.12; P = 0.09).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 9.   Elevation in the Gpx2 mRNA levels in the small intestine after exposure to gamma -irradiation. The levels of Gpx2 and Gpx1 mRNA expressed in the mouse small intestine at the 4th day after exposure to 0 and 17 Gy were normalized against the beta -actin mRNA levels as shown in Fig. 1C. The level of normalized Gpx2 and Gpx1 mRNA expressed in unexposed mice was set to 1. The error bars are standard deviations of means from 4 mice, except for the untreated wild-type Gpx2 mRNA levels, which are from 3 mice to exclude the heterozygous animal.

Effect of Gpx1 gene expression on PGE2 levels in the small intestine. To determine whether Gpx1 gene expression affects PG biosynthesis in the small intestine, we have measured PGE2 concentrations in jejunum and ileum after exposure to 15 Gy. As shown in Fig. 10, B6 Gpx1-KO jejunum had a higher level of PGE2 than the wild-type jejunum after exposure to 0 and 15 Gy. The basal PGE2 concentration in the Gpx1-KO jejunum was 21.0 ± 8.5 vs. 15.5 ± 10 pg PGE2/µg protein in the wild-type jejunum. The induced PGE2 concentration in the Gpx1-KO jejunum was 215 ± 76 pg PGE2/µg protein after exposure to 15 Gy compared with 146 ± 41 pg PGE2/µg protein in the wild-type jejunum. The Gpx1-KO ileum also had a higher basal level of PGE2 (38 ± 9 pg PGE2/µg protein) than the wild-type ileum (20 ± 10.5 pg PGE2/µg protein). However, the irradiated Gpx1-KO ileum had the same level of PGE2 (101 ± 57 pg PGE2/µg protein) as the exposed wild-type ileum (114 ± 64 pg PGE2/ µg protein). Nevertheless, none of the differences are statistically significant. Only the increase of PGE2 level by gamma -irradiation in both the jejunum and ileum of the Gpx1-KO and the wild-type mice is statistically significant.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 10.   The PGE2 level in the jejunum and ileum of Gpx1-KO and control mice exposed to 0 and 15 Gy. The PGE2 was measured from a section each of the proximal jejunum and the distal ileum 3 days after exposure. Six to eight B6 mice were analyzed in each group. Data are presented as means ± SD. Statistical difference is found between unexposed and exposed mice. No statistical difference is found between the unexposed Gpx1-KO and wild-type ileum (P = 0.06) and between the irradiated Gpx1-KO and wild-type jejunum (P = 0.08).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have previously shown that both GPX-1 and GPX-GI are the major GPX activities in the intestinal epithelium of mouse and rat. The mouse jejunal and ileal epithelia have different levels of GPX-1 and GPX-GI activity (6, 10). To study their function in the crypt epithelium after exposure to gamma -irradiation, we have generated Gpx2-KO mice. Similar to the Gpx1-KO mice, the Gpx2-KO mice have lower levels of GPX activity in the gastrointestinal tract than the wild-type mice, and there is no unusual phenotype in the Gpx2-KO mice under normal conditions (17). GPX-1 contributes to 80% and 50% of total GPX activity in the jejunum and the ileum, respectively. Four days after exposure to high-dose gamma -irradiation, the jejunum of both B6 and B6 × 129 Gpx1-KO mice has higher numbers of surviving crypt foci than the wild-type controls. The ileum of the B6 × 129 but not B6 Gpx1-KO mice is also more resistant to radiation. Thus radiation resistance can be associated with lack of GPX activity. The levels of resistance found in the Gpx1-KO mice are comparable to the protection afforded by KGF and PG mimetics (9-11).

It was previously reported that radiation injury decreases the number of surviving crypts in the jejunum. Indomethacin, an inhibitor of COX, further decreases the number of crypt foci. The indomethacin response can be blocked by dimethyl-PGE2 (8). In vitro studies have shown that GPX activity inhibits activation of COX, the rate-limiting enzyme for PGE2 biosynthesis (2, 23). Radiation increases the PGE2 concentration ninefold in the jejunum of the Gpx1-KO and wild-type mice and about threefold in the ileum of the Gpx1-KO and wild-type mice. With the exception of the irradiated ileum, the Gpx1-KO small intestine has higher levels of PGE2 than wild-type small intestine does. Perhaps because of the large variation of PGE2 levels in samples, the differences are not statistically significant. Thus we cannot make any conclusions about the in vivo effect of GPX activity on the PGE2 level. Our PGE2 measurements are comparable to the reported data in FVB/N mice (8). This suggests that the PGE2 level is similarly regulated by gamma -irradiation in these two strains of mice.

Although the Gpx2 mRNA was expressed in the jejunal epithelium of the wild-type and Gpx1-KO mice, it did not result in a significant increase of GPX activity, probably due to the lack of GPX-GI production. The juncture between the regions of the intestine showing activity increases was between 33 and 50% of the length of the intestine from the duodenum (data not shown). The lack of GPX-GI activity in the jejunum may be due to the fact that GPX-GI is ultrasensitive to cellular redox status. GPX-1 is already sensitive to oxidative damage (16, 29, 44), and we have found that GPX-GI is more labile than GPX-1 (4). Thus the lack of GPX activity in the jejunum of the Gpx1-KO mice may be due to the rapid inactivation of GPX-GI in this tissue in the absence of GPX-1. In the wild-type mouse jejunum, the high level of GPX-1 activity would have masked the increase of GPX-GI activity.

Contrary to jejunal Gpx2 gene expression, the increase of Gpx2 mRNA level in the ileal epithelium does result in an increase of GPX activity. After exposure to >= 10 Gy, the GPX activity level in Gpx1-KO ileum is higher than that found in the unexposed wild-type mice. This provides the first evidence that the Gpx2 gene can compensate for the lack of Gpx1 gene expression. Unlike the Gpx1 gene, of which mRNA level is constitutively expressed in most tissues, the Gpx2 mRNA level is highly regulated. In addition to this effect of radiation, all-trans retinoic acid can increase Gpx2 mRNA level 10-fold, as shown in MCF-7 breast cancer cells (7). Since gamma -irradiation of MCF-7 cells did not increase Gpx2 mRNA levels (data not shown), and maximal levels of Gpx2 mRNA in small intestine occurred at 3-4 days postirradiation, this suggests that the increase in mRNA levels is not a direct response to radiation. Rather, it is a response to some component of secondary injury. The kinetics of Gpx2 mRNA changes is similar to the changes observed with Cox1 in the intestine after exposed to high-dose gamma -irradiation (8). This suggests that the Gpx2 and the Cox1 genes are coregulated in this exposure.

Although we have found that most GPX activity in the intestinal epithelium is contributed by GPX-1 and GPX-GI under normal conditions, the recent identification of Aop2 has raised the question of its possible contribution to GPX activity after exposure to gamma -irradiation. The Aop2 gene is normally expressed at a low level in the intestinal epithelium but is highly expressed in the eye (13, 27, 37). It has been shown in keratinocytes that the Aop2 gene is highly inducible by KGF, which can also increase crypt survival. We can rule out any significant contribution of Aop2 to total GPX activity in the intestinal epithelium on the basis of the following observations: 1) Aop2 mRNA level was increased only onefold after exposure to high-dose gamma -irradiation; 2) Aop2 has low GPX activity, and 3) no increase in GPX activity occurred in Gpx2-KO mice after exposure to radiation.

Our study elucidates a function for Gpx1 gene expression in the intestinal epithelial cells after exposure to gamma -irradiation. The fact that the Gpx1-KO and the wild-type ileum have similar sensitivity to gamma -irradiation is most likely a result of the compensatory effect of Gpx2 gene expression. To study the function of the Gpx2 gene in the ileal epithelium against high-dose radiation, the crypt survival in Gpx1 and Gpx2 double knockout mice should be analyzed in the future.

Considering the beneficial effect of voiding GPX activity in the crypt epithelium against radiation damage, it may be highly desirable to develop GPX-specific inhibitors as therapeutic reagents. Gold (I)-containing compounds, including aurothioglucose and the antiarthritic drug auranofin, are potent inhibitors for several selenocysteine-containing enzymes (33, 38). Unfortunately, aurothioglucose is a much more potent inhibitor for thioredoxin reductase and less effective on GPX-1 when administered intraperitoneally. To our knowledge, there are no GPX-specific inhibitors reported.


    ACKNOWLEDGEMENTS

We thank Heather Adams for maintaining mouse colonies, Helen Sun for processing mouse tissue samples for histological analysis, Sabine Werner at the Swiss Federal Institute of Technology for providing the mouse Aop2 cDNA clone, and Jason D. Morrow at Vanderbilt University for advice on the PGE2 assay.


    FOOTNOTES

This work was supported by American Heart Association Grant 9960042Y (F.-F. Chu). PhosphorImager was funded by National Science Foundation Grant BIR-9220534.

Address for reprint requests and other correspondence: F.-F. Chu, Dept. of Medical Oncology, City of Hope Medical Center, 1500 E. Duarte Road, Duarte, CA 91010-3000 (E-mail: fchu{at}coh.org).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Received 15 November 1999; accepted in final form 8 March 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Beutler, E. Red Cell Metabolism, a Manual of Biochemical Methods. New York: Grune and Stratton, 1971.

2.   Capdevila, JH, Morrow JD, Belosludtsev YY, Beauchamp DR, DuBois RN, and Falck JR. The catalytic outcomes of the constitutive and the mitogen inducible isoforms of prostaglandin H2 synthase are markedly affected by glutathione and glutathione peroxidase(s). Biochemistry 34: 3325-3337, 1995[Medline].

3.   Chu, FF, Doroshow JH, and Esworthy RS. Expression, characterization, and tissue distribution of a new cellular selenium-dependent glutathione peroxidase, GSHPx-GI. J Biol Chem 268: 2571-2576, 1993[Abstract/Free Full Text].

4.   Chu, FF, and Esworthy RS. The expression of an intestinal form of glutathione peroxidase (GSHPx-GI) in rat intestinal epithelium. Arch Biochem Biophys 323: 288-294, 1995[Web of Science][Medline].

5.   Chu, FF, Esworthy RS, and Burmeister M. The mouse glutathione peroxidase Gpx2 gene maps to chromosome 12; its pseudogene Gpx2-ps maps to chromosome 7. Genomics 33: 516-518, 1996[Web of Science][Medline].

6.   Chu, FF, Esworthy RS, Ho YS, Bermeister M, Swiderek K, and Elliott RW. Expression and chromosomal mapping of mouse Gpx2 gene encoding the gastrointestinal form of glutathione peroxidase, GPX-GI. Biomed Environ Sci 10: 156-162, 1997[Medline].

7.   Chu, FF, Esworthy RS, Lee L, and Wilczynski S. Retinoic acid induces Gpx2 gene expression in MCF-7 human breast cancer cells. J Nutr 129: 1846-1854, 1999[Abstract/Free Full Text].

8.   Cohn, SM, Schloemann S, Tessner T, Seibert K, and Stenson WF. Crypt stem cell survival in the mouse intestinal epithelium is regulated by prostaglandins synthesized through cyclooxygenase-1. J Clin Invest 99: 1367-1379, 1997[Web of Science][Medline].

9.   Diamond, AM, Dale P, Murray JL, and Grdina DJ. The inhibition of radiation-induced mutagenesis by the combined effects of selenium and the aminothiol WR-1065. Mutat Res 356: 147-154, 1996[Web of Science][Medline].

10.   Esworthy, RS, Swiderek KM, Ho YS, and Chu FF. Selenium-dependent glutathione peroxidase-GI is a major glutathione peroxidase activity in the mucosal epithelium of rodent intestine. Biochim Biophys Acta 1381: 213-226, 1998[Medline].

11.   Farrell, CL, Bready JV, Rex KL, Chen JN, DiPalma CR, Whitcomb KL, Yin S, Hill DC, Wiemann B, Starnes CO, Havill AM, Lu ZN, Aukerman SL, Pierce GF, Thomason A, Potten CS, Ulich TR, and Lacey DL. Keratinocyte growth factor protects mice from chemotherapy and radiation-induced gastrointestinal injury and mortality. Cancer Res 58: 933-939, 1998[Abstract/Free Full Text].

12.   Fisher, AB, Dodia C, Manevich Y, Chen JW, and Feinstein SI. Phospholipid hydroperoxides are substrates for non-selenium glutathione peroxidase. J Biol Chem 274: 21326-21334, 1999[Abstract/Free Full Text].

13.   Frank, S, Munz B, and Werner S. The human homologue of a bovine non-selenium glutathione peroxidase is a novel keratinocyte growth factor-regulated gene. Oncogene 14: 915-921, 1997[Web of Science][Medline].

14.   Fuks, Z, Persaud RS, Alfieri A, McLoughlin M, Ehleiter D, Schwartz JL, Seddon AP, Cordon-Cardo C, and Haimovitz-Friedman A. Basic fibroblast growth factor protects endothelial cells against radiation-induced programmed cell death in vitro and in vivo. Cancer Res 54: 2582-2590, 1994[Abstract/Free Full Text].

15.   Hanson, WR, and Thomas C. 16,16-Dimethyl prostaglandin E2 increases survival of murine intestinal stem cells when given before photon radiation. Radiat Res 96: 393-398, 1983[Web of Science][Medline].

16.   Hidalgo, FJ, Zamora R, and Tappel AL. Oxidant-induced haemoprotein degradation in rat tissue slices: effect of bromotrichloromethane, antioxidants and chelators. Biochim Biophys Acta 1037: 313-320, 1990[Medline].

17.   Ho, YS, Magnenat JL, Bronson RT, Cao J, Gargano M, Sugawara M, and Funk CD. Mice deficient in cellular glutathione peroxidase develop normally and show no increased sensitivity to hyperoxia. J Biol Chem 272: 16644-16651, 1997[Abstract/Free Full Text].

18.   Iakoubova, OA, Pacella LA, Her H, and Beier DR. LTW4 protein on mouse chromosome 1 is a member of a family of antioxidant proteins. Genomics 42: 474-478, 1997[Web of Science][Medline].

19.   Ijiri, K. Apoptosis (cell death) induced in mouse bowel by 1,2-dimethylhydrazine, methylazoxymethanol acetate, and gamma-rays. Cancer Res 49: 6342-6346, 1989[Abstract/Free Full Text].

20.   Kang, SW, Baines IC, and Rhee SG. Characterization of a mammalian peroxiredoxin that contains one conserved cysteine. J Biol Chem 273: 6303-6311, 1998[Abstract/Free Full Text].

21.   Kang, SW, Chae HZ, Seo MS, Kim K, Baines IC, and Rhee SG. Mammalian peroxiredoxin isoforms can reduce hydrogen peroxide generated in response to growth factors and tumor necrosis factor-alpha. J Biol Chem 273: 6297-6302, 1998[Abstract/Free Full Text].

22.   Khan, WB, Shui C, Ning S, and Knox SJ. Enhancement of murine intestinal stem cell survival after irradiation by keratinocyte growth factor. Radiat Res 148: 248-253, 1997[Web of Science][Medline].

23.   Kulmacz, RJ, and Wang LH. Comparison of hydroperoxide initiator requirements for the cyclooxygenase activities of prostaglandin H synthase-1 and -2. J Biol Chem 270: 24019-24023, 1995[Abstract/Free Full Text].

24.   Landino, LM, Crews BC, Timmons MD, Morrow JD, and Marnett LJ. Peroxynitrite, the coupling product of nitric oxide and superoxide, activates prostaglandin biosynthesis. Proc Natl Acad Sci USA 93: 15069-15074, 1996[Abstract/Free Full Text].

25.   Liebmann, J, Fisher J, Lipschultz C, Kuno R, and Kaufman DC. Enhanced glutathione peroxidase expression protects cells from hydroperoxides but not from radiation or doxorubicin. Cancer Res 55: 4465-4470, 1995[Abstract/Free Full Text].

26.   Marshall, PJ, Kulmacz RJ, and Lands WE. Constraints on prostaglandin biosynthesis in tissues. J Biol Chem 262: 3510-3517, 1987[Abstract/Free Full Text].

27.   Munz, B, Frank S, Hubner G, Olsen E, and Werner S. A novel type of glutathione peroxidase: expression and regulation during wound repair. Biochem J 326: 579-585, 1997.

28.   Phelan, SA, Johnson KA, Beier DR, and Paigen B. Characterization of the murine gene encoding Aop2 (antioxidant protein 2) and identification of two highly related genes. Genomics 54: 132-139, 1998[Web of Science][Medline].

29.   Pigeolet, E, and Remacle J. Susceptibility of glutathione peroxidase to proteolysis after oxidative alteration by peroxides and hydroxyl radicals. Free Radic Biol Med 11: 191-195, 1991[Web of Science][Medline].

30.   Potten, CS. A comprehensive study of the radiobiological response of the murine (BDF1) small intestine. Int J Radiat Biol 58: 925-973, 1990[Web of Science][Medline].

31.   Potten, CS, and Loeffler M. Stem cells: attributes, cycles, spirals, pitfalls and uncertainties. Lessons for and from the crypt. Development 110: 1001-1020, 1990[Abstract/Free Full Text].

32.   Ramakrishnan, N, Kalinich JF, and McClain DE. Ebselen inhibition of apoptosis by reduction of peroxides. Biochem Pharmacol 51: 1443-1451, 1996[Web of Science][Medline].

33.   Roberts, JR, and Shaw CF, 3rd. Inhibition of erythrocyte selenium-glutathione peroxidase by auranofin analogues and metabolites. Biochem Pharmacol 55: 1291-1299, 1998[Web of Science][Medline].

34.   Sambrook, J, Fritsch EF, and Maniatis T. Molecular Cloning. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.

35.   Sandstrom, BE, Carlsson J, and Marklund SL. Selenite-induced variation in glutathione peroxidase activity of three mammalian cell lines: no effect on radiation-induced cell killing or DNA strand breakage. Radiat Res 117: 318-325, 1989[Web of Science][Medline].

36.   Sandstrom, BE, Grankvist K, and Marklund SL. Selenite-induced increase in glutathione peroxidase activity protects human cells from hydrogen peroxide-induced DNA damage, but not from damage inflicted by ionizing radiation. Int J Radiat Biol 56: 837-841, 1989[Web of Science][Medline].

37.   Singh, AK, and Shichi H. A novel glutathione peroxidase in bovine eye. Sequence analysis, mRNA level, and translation. J Biol Chem 273: 26171-26178, 1998[Abstract/Free Full Text].

38.   Smith, AD, Guidry CA, Morris VC, and Levander OA. Aurothioglucose inhibits murine thioredoxin reductase activity in vivo. J Nutr 129: 194-198, 1999[Abstract/Free Full Text].

39.   Szabo, P, and Mann JR. Expression and methylation of imprinted genes during in vitro differentiation of mouse parthenogenetic and androgenetic embryonic stem cell lines. Development 120: 1651-1660, 1994[Abstract].

40.   Tybulewicz, VL, Crawford CE, Jackson PK, Bronson RT, and Mulligan RC. Neonatal lethality and lymphopenia in mice with a homozygous disruption of the c-abl proto-oncogene. Cell 65: 1153-1163, 1991[Web of Science][Medline].

41.   Vetter, DE, Mann JR, Wangemann P, Liu J, McLaughlin KJ, Lesage F, Marcus DC, Lazdunski M, Heinemann SF, and Barhanin J. Inner ear defects induced by null mutation of the isk gene. Neuron 17: 1251-1264, 1996[Web of Science][Medline].

42.   Ward, JF, Blakely WF, and Joner EI. Mammalian cells are not killed by DNA single-strand breaks caused by hydroxyl radicals from hydrogen peroxide. Radiat Res 103: 383-392, 1985[Web of Science][Medline].

43.   Withers, HR, and Elkind MM. Microcolony survival assay for cells of mouse intestinal mucosa exposed to radiation. Int J Radiat Biol Relat Stud Phys Chem Med 17: 261-267, 1970[Web of Science][Medline].

44.   Zamora, R, Hidalgo FJ, and Tappel AL. Oxidant-increased proteolysis in rat liver slices: effect of bromotrichloromethane, antioxidants and effectors of proteolysis. Chem Biol Interact 76: 293-305, 1990[Web of Science][Medline].


Am J Physiol Gastrointest Liver Physiol 279(2):G426-G436
0193-1857/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
Cancer Epidemiol. Biomarkers Prev.Home page
U. Peters, N. Chatterjee, R. B. Hayes, R. E. Schoen, Y. Wang, S. J. Chanock, and C. B. Foster
Variation in the Selenoenzyme Genes and Risk of Advanced Distal Colorectal Adenoma
Cancer Epidemiol. Biomarkers Prev., May 1, 2008; 17(5): 1144 - 1154.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Banning, S. Deubel, D. Kluth, Z. Zhou, and R. Brigelius-Flohe
The GI-GPx Gene Is a Target for Nrf2
Mol. Cell. Biol., June 15, 2005; 25(12): 4914 - 4923.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
R. S. Esworthy, L. Yang, P. H. Frankel, and F.-F. Chu
Epithelium-Specific Glutathione Peroxidase, Gpx2, Is Involved in the Prevention of Intestinal Inflammation in Selenium-Deficient Mice
J. Nutr., April 1, 2005; 135(4): 740 - 745.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
F.-F. Chu, R. S. Esworthy, P. G. Chu, J. A. Longmate, M. M. Huycke, S. Wilczynski, and J. H. Doroshow
Bacteria-Induced Intestinal Cancer in Mice with Disrupted Gpx1 and Gpx2 Genes
Cancer Res., February 1, 2004; 64(3): 962 - 968.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
L. Rao, B. Puschner, and T. A. Prolla
Gene Expression Profiling of Low Selenium Status in the Mouse Intestine: Transcriptional Activation of Genes Linked to DNA Damage, Cell Cycle Control and Oxidative Stress
J. Nutr., December 1, 2001; 131(12): 3175 - 3181.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
R. S. Esworthy, R. Aranda, M. G. Martin, J. H. Doroshow, S. W. Binder, and F.-F. Chu
Mice with combined disruption of Gpx1 and Gpx2 genes have colitis
Am J Physiol Gastrointest Liver Physiol, September 1, 2001; 281(3): G848 - G855.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (21)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Esworthy, R. S.
Right arrow Articles by Chu, F.-F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Esworthy, R. S.
Right arrow Articles by Chu, F.-F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online