AJP - GI Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 279: G1282-G1291, 2000;
0193-1857/00 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (19)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Inan, M. S.
Right arrow Articles by Giardina, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Inan, M. S.
Right arrow Articles by Giardina, C.
Vol. 279, Issue 6, G1282-G1291, December 2000

Transcription factor NF-kappa B participates in regulation of epithelial cell turnover in the colon

Mehmet Sait Inan1, Veronica Tolmacheva1, Qiang-Shu Wang2, Daniel W. Rosenberg2, and Charles Giardina1

1 Department of Molecular and Cell Biology and 2 Department of Pharmaceutical Sciences, University of Connecticut, Storrs, Connecticut 06269


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The transcription factor nuclear factor (NF)-kappa B regulates the expression of genes that can influence cell proliferation and death. Here we analyze the contribution of NF-kappa B to the regulation of epithelial cell turnover in the colon. Immunohistochemical, immunoblot, and DNA binding analyses indicate that NF-kappa B complexes change as colonocytes mature: p65-p50 complexes predominate in proliferating epithelial cells of the colon, whereas the p50-p50 dimer is prevalent in mature epithelial cells. NF-kappa B1 (p50) knockout mice were used to study the role of NF-kappa B in regulating epithelial cell turnover. Knockout animals lacked detectable NF-kappa B DNA binding activity in isolated epithelial cells and had significantly longer crypts with a more extensive proliferative zone than their wild-type counterparts (as determined by proliferating cell nuclear antigen staining and in vivo bromodeoxyuridine labeling). Gene expression profiling reveals that the NF-kappa B1 knockout mice express the potentially growth-enhancing tumor necrosis factor (TNF)-alpha and nerve growth factor-alpha genes at elevated levels, with in situ hybridization localizing some of the TNF-alpha expression to epithelial cells. TNF-alpha is NF-kappa B regulated, and its upregulation in NF-kappa B1 knockouts may result from an alleviation of p50-p50 repression. NF-kappa B complexes may therefore influence cell proliferation in the colon through their ability to selectively activate and/or repress gene expression.

nuclear factor-kappa B; cell proliferation; tumor necrosis factor-alpha ; nerve growth factor-alpha


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE TRANSCRIPTION FACTOR nuclear factor (NF)-kappa B is a dimeric protein generated from the association of five possible subunits: p50, p52, RelA (p65), RelB, and c-Rel (5). The Rel homology domain found in each of these proteins functions in DNA binding, dimerization, and interaction with various inhibitory proteins referred to as Ikappa Bs (27, 57). Ikappa B proteins include Ikappa Balpha , Ikappa Bbeta , Ikappa Bepsilon , p105, and p100. The p105 and p100 proteins are alternative products of the same genes that encode p50 and p52 (NF-kappa B1 and NF-kappa B2, respectively). Ikappa Bs contain multiple copies of the ankyrin repeat at their COOH terminals, and this repeat is required for binding to, and inhibition of, NF-kappa B subunits. NF-kappa B activation entails the signal-induced phosphorylation and degradation of Ikappa B molecules, which in turn releases NF-kappa B to translocate into the nucleus and bind to response elements of target promoters (11, 19, 30, 42, 47, 53, 69). The various NF-kappa B subunits and Ikappa Bs enable the cell to modulate NF-kappa B responses in a highly controlled manner. For example, Ikappa Bs are degraded at different rates, which can control the kinetics of an NF-kappa B response (59). Ikappa Bs also display certain stimuli-specific responses (59). The subunit composition of NF-kappa B also influences gene activation. Only the p65, RelB, and c-Rel subunits have strong transcriptional activation domains. NF-kappa B forms without one of these subunits (for example, p50 or p52 homodimers) are weaker transcription activators and can even function as repressors (5, 39, 40). In summary, cells are able to modulate expression of NF-kappa B-regulated genes by regulating the Ikappa Bs expressed and the subunit composition of the NF-kappa B activated (26).

NF-kappa B has been implicated in regulating cell proliferation and death in a number of cell types (6, 7, 29). Intriguingly, NF-kappa B has been found to both promote and suppress cell death. The role NF-kappa B assumes in regulating cell death appears to depend on both cell type and apoptosis inducer (6, 7, 10, 12, 13, 34, 43, 56, 60, 63, 67). In addition to regulating genes that directly influence cell proliferation and death, NF-kappa B regulates expression of a number of cytokines and cell adhesion molecules operative in immune and inflammatory responses (2, 5, 17, 23, 38, 39, 68). These molecules can also influence cell proliferation and death in a tissue. Understanding how NF-kappa B regulates cell proliferation and death in an integrated, functioning tissue is therefore a major research challenge.

We are interested in better understanding the role of NF-kappa B in regulating cellular proliferation and apoptosis of colonic epithelial cells. Colonic epithelium is a dynamic structure organized into invaginations known as the crypts of Lieberkühn. These crypts open into the lumen of the intestinal tract. Located at the base of the crypt are a number of stem cells that divide continuously and are responsible for perpetual renewal of the epithelium (50). As cells migrate up the crypt axis (due to the mitotic pressure from the cells below them), they stop dividing and differentiate. Differentiated cells continue their ascent toward the luminal surface, where they undergo anoikis or apoptosis (24, 25). The lamina propria that underlies epithelial cells consists of connective tissue and a variety of wandering cells (lymphocytes, plasma cells, eosinophils, and mast cells), which can interact with epithelial cells. The regulation of cell turnover in the colon can therefore be influenced by signals generated by other cells in the tissue.

In this study, we investigated the expression and activity of NF-kappa B in colonic epithelial cells. In addition, we determined the effect of the NF-kappa B1 knockout on epithelial cell turnover in the mouse colon. Our results indicate that NF-kappa B is active in epithelial cells under normal physiological conditions and that it participates in the regulation of epithelial cell turnover.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Immunohistochemistry. Paraffin-embedded tissues were first deparaffinized by baking slides in a 60°C oven for 20 min. Slides were then treated with Hemo-De (Fisher Scientific, Pittsburgh, PA) before undergoing a series of ethanol immersions. To neutralize endogenous peroxidase activity, the sections were blocked for 20 min in 1% hydrogen peroxide in PBS. For the microwave antigen retrieval procedure, slides were immersed in 10 mM citrate buffer (pH 6.0) in a clean polyethylene chamber in a full-powered microwave for 10 min and were then cooled for 10-20 min. After washing three times with PBS-Brij solution, the sections were blocked in 10% normal horse or goat serum for 30-60 min to suppress nonspecific binding of IgG. Each tissue section was then incubated with primary antibody (anti-NF-kappa B1 D-17, Santa Cruz Biotechnologies, Santa Cruz, CA; anti-p65 AB1604, Chemicon). The p65-nuclear localization signal (NLS) antibody that has been used to detect active p65 in human cells (MAB3026; originally available from Boehringer Mannheim and now sold by Chemicon) (52) could not be used for this analysis because it does not recognize mouse p65. Antibodies were incubated overnight at 4°C, except anti-p65, which was incubated for 1 h at room temperature. Slides were then washed three times with PBS-Brij and then incubated with anti-goat or anti-rabbit biotinylated secondary antibodies (Vector Laboratories, Burlingame, CA). For proliferating cell nuclear antigen (PNCA; clone-10; Signet) and bromodeoxyuridine (BrdU; Clone BU33; Sigma) staining, mouse primary antibodies were used with a Mouse-On-Mouse detection kit (Vector) to suppress nonspecific binding. Briefly, after citrate buffer retrieval, the tissues were incubated with blocking reagent for 1 h and washed twice with PBS for 2 min each. The sections were then incubated with Mouse-On-Mouse diluent for 5 min before the primary antibody was applied. After 30 min of incubation with primary antibodies, tissues were washed with PBS and incubated with biotinylated anti-mouse IgG for 10 min. Incubation with ABC Reagent (Vectastain) was followed with three washes of PBS-Brij, and then diaminobenzine reaction was applied. Slides were then counterstained with hematoxylin for 20 s and washed in graded ethanol and Histoclear. Finally, slides were mounted with coverslips and analyzed by light microscopy. Staining specificity for the NF-kappa B antibodies was confirmed by comparing their staining with staining obtained using normal serum (Fig. 1C). Competition experiments were also performed with specific peptide inhibitors that reduced the level of staining (data not shown).


View larger version (77K):
[in this window]
[in a new window]
 
Fig. 1.   Immunohistochemical staining of mouse colon sections with anti-p65 (A) or anti-nuclear factor (NF)-kappa B1 (B) antibodies. Positive staining for these proteins appears as an orange-brown color. Staining was specific, as demonstrated by the lack of staining with normal serum (C). Nuclei are stained blue. Representative images obtained from 5-µm sections of paraffin-imbedded tissue are shown at ×400 magnification. The surface epithelium is at the top of each panel.

Colonic epithelial cell isolation. The isolation of colonic epithelial cells was based on a procedure described by Homaidan et al. (33). Distal colon was removed and washed three times with ~5 ml of washing buffer [150 mM NaCl and 1 mM freshly added dithiothreitol (DTT)] to remove adherent mucus. The colon was then placed in a 60-mm cell culture plate filled with ~5 ml of the dissociation buffer (130 mM NaCl, 1 mM Na2EDTA, 10 mM HEPES, 10% FCS, and 1 mM freshly added DTT, pH 7.4). The plate was placed on a shaker at 37°C and incubated for 15 min. Dissociated cells were collected into a 15-ml Falcon tube by removing the dissociation buffer from the colon. Incubation in dissociation buffer was repeated a total of six times. For the first and second collections, 1 mM EDTA was used, for the third and fourth, 5 mM was used, and for the final two, 10 mM EDTA was present. Isolated cells were processed immediately after isolation by centrifugation at 4°C (2,500 rpm) for 10 min. Proteins were extracted as described below.

Protein extraction. Following centrifugation of the isolated cells, the resulting pellet was washed twice with cold PBS. The cells were then lysed by incubating them at 4°C for 8 min with 500 µl of buffer containing 0.1% NP-40 [10 mM HEPES-KOH, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 1 mM DTT, 2 mM MgCl2, 0.5 mM phenylmethylsulfonyl fluoride (PMSF), 0.5 M sucrose, and 2 µg/ml leupeptin] and transferred to Eppendorf tubes. The tubes were centrifuged at 4°C (14,000 rpm) for 10 min, and the resulting supernatant was collected into a new tube. This is the cytoplasmic extract. The resulting pellet was washed with 1 ml of the above buffer without NP-40, resuspended in 30 µl of buffer (20 mM HEPES-KOH, pH 7.9, 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 1 mM DTT, 5% glycerol, 0.5 mM PMSF, and 2 µg/ml leupeptin) and then incubated for 40 min on ice. The nuclear suspension was centrifuged at 4°C (14,000 rpm) for 10 min. The resulting supernatant, the nuclear extract, was transferred to new tube and diluted with 45 µl of a buffer (20 mM HEPES-KOH, pH 7.9, 50 mM KCl, 0.2 mM EDTA, 1 mM DTT, 20% glycerol, 0.5 mM PMSF, and 2 µg/ml leupeptin). Protein concentrations of nuclear and cytoplasmic extracts were measured by the Bradford assay, and the tubes were placed in -80°C freezer for storage.

Immunoblotting. Thirty micrograms of proteins from each of the above-described samples were resolved on 12% SDS-polyacrylamide gel and transferred onto nitrocellulose membranes. Membranes were blocked for 1 h with 5% nonfat dry milk. Specific proteins were detected with the appropriate antibodies using enhanced chemiluminescence for detection (Santa Cruz). The antibodies used were p65 (1:1,000 C-19; Santa Cruz), p50/p105 (1:1,000 D-17; Santa Cruz), PCNA (1:500 clone-10; Signet), and alkaline phosphatase (1:500; Chemicon).

Electrophoretic mobility shift assay. Ten micrograms of nuclear extract, prepared as described in Protein extraction, in 10 µl of buffer were mixed with 2 µg poly-dIdC and 1 µg BSA to a final volume of 19 µl. After 15-min incubation on ice, 1 µl of [gamma -32P]ATP end-labeled double-stranded NF-kappa B consensus oligonucleotide (TGAGGGGACTTTCCCAGGC) was added to each reaction and incubated at room temperature for an additional 15 min. The reaction products were separated on a 4% native polyacrylamide-0.5 × Tris-borate-EDTA gel and analyzed by autoradiography. Supershift antibodies (1 µl) were included in the binding reaction as indicated (all supershift antibodies were obtained from Santa Cruz).

Animals. Six-week-old male NF-kappa B1 knockout mice and their wild-type counterparts (B6/129P) were purchased from the Jackson Laboratory (Bar Harbor, ME) and housed in a controlled environment with a 12:12-h light/dark cycle. After an acclimation period of 4 wk, mice were killed and their colons were removed and processed for cell isolation or paraffin imbedding as described in Colonic epithelial cell isolation. For in vivo BrdU labeling, mice were injected intraperitoneally with BrdU (Zymed Laboratories, South San Francisco, CA) at a concentration of 50 mg/kg body wt. Two injections were performed, one at 24 h and the other at 12 h before death. Colons were then processed for immunohistochemistry. BrdU labeling was estimated by determining the fraction of cells with positively stained nuclei in each animal. Thirty crypts from the distal colon of each animal were arbitrarily chosen and examined. Only crypts cut longitudinally were considered in this analysis.

cDNA array analysis. The Clontech Atlas Mouse 1.2 cDNA array was used (Clontech, Palo Alto, CA). RNA was isolated from whole colon tissue immediately on removal following the Clontech protocol, with the exception that the Qiagen poly(A) mRNA isolation kit was used (Qiagen, Valencia, CA). cDNA labeling was performed using Clontech reagents, and the resulting probes were purified with a Centri-Spin column (Princeton Separations, Adelphia, NJ). Clontech membranes were probed and washed as described by Clontech, exposed to film, and then quantified with a Bio-Rad PhosphorImager (Bio-Rad, Hercules, CA). Autoradiograms were compared manually using a transparent alignment grid. Only hybridization signals that were precisely positioned in the array were considered further (a number of background "dots" appear on both arrays). True hybridization signals with apparent differences in intensity were then compared quantitatively on the PhosphorImager, with signal adjustments made using the housekeeping genes present at the bottom of the membrane. Nerve growth factor (NGF)-alpha expression found to be enhanced on the array was also analyzed by the RT-PCR assay, following a published protocol (64). Primers for the NGF-alpha were CACCCTGCCCACTGAGGAGCCCAA and CCATCCATCTCTCCTGCACACA, which generated a 195-bp fragment from the NGF-alpha mRNA. (These primers spanned an intron, to prevent confusion with amplification products from trace amounts of genomic DNA in the reaction). Primers to hypoxanthine-guanine phosphoribosyltransferase, which were used as a control, have been previously described (64).

RNase protection. Two NF-kappa B-regulated genes not found on the Clontech cDNA array are TNF-alpha and Fas (3, 15). To assay the expression levels of these genes, an RNase protection assay was performed using in vitro transcription plasmids obtained from PharMingen (San Diego, CA). RNA for this analysis was purified from whole mouse colon using TRIzol reagent (Life Technologies, Grand Island, NY). Complementary RNA labeling and RNase protection was performed as described by PharMingen. Resulting sequencing gels were exposed to film and quantified by PhosphorImager.

In situ hybridization. RNA probes for TNF-alpha in situ hybridization were transcribed in vitro from a pGEM-T Easy vector (Promega, Madison, WI). An RT-PCR-generated TNF-alpha gene fragment (+292 to +578 relative to the translation start site) was cloned into the pGEM-T Easy vector, and the orientation was determined by PCR using TNF-alpha primers and universal priming sites present in the plasmid. In vitro transcription of this clone with T7 RNA polymerase generated the antisense probe, whereas the Sp6 RNA transcription produced the sense probe. The sense and antisense RNA probes were labeled with psoralen-biotin using a BrightStar psoralen-biotin labeling kit according to the manufacturer's instructions (Ambion, Austin, TX). Hybridization was also performed according to the manufacturer's instructions. Briefly, 6-µm sections were deparaffinized and rehydrated in nuclease-free alcohol. The tissue sections were treated with proteinase K, washed, prehybridized, and then probed with either the sense or antisense TNF-alpha probe in a humidifier chamber for 4 h at 55°C. After hybridization, sections were washed and incubated with a streptavidin-alkaline phosphatase conjugate. After several washes, signal was detected by nitroblue tetrazolium salt and 5-bromo-4-chloro-3-indol phosphate. Slides were dehydrated by gradual alcohol immersion, cleared by Histoclear, mounted with coverslips, and analyzed by light microscopy.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Immunohistochemical analysis of NF-kappa B subunits in the mouse colon. If NF-kappa B is involved in regulating epithelial cell turnover, its expression and activity may change as epithelial cells mature. We therefore analyzed sections of mouse colon for the NF-kappa B subunits p50 and p65. These two subunits were chosen for analysis because NF-kappa B isolated from the colon has been found to be composed primarily of these subunits (see NF-kappa B activity in epithelial cell isolates). As shown in Fig. 1A, p65 expression is concentrated at the bottom of the crypt where proliferating cells are present. Some of the staining is present in the nucleus, suggesting that a portion of the p65 may be active. It is not clear, however, whether this nuclear staining is an accurate indication of DNA binding activity. [The antibody for active human p65 (52) does not recognize mouse p65]. Figure 1B shows the immunohistochemical staining for NF-kappa B1 proteins (p50 and p105). In contrast to the results obtained for p65, NF-kappa B1 staining is more even through the length of the crypt, with more cytoplasmic staining present in cells closer to the luminal surface. Staining with normal serum shows some background at the top of the crypts, but is otherwise lower than that obtained with the NF-kappa B antibodies (Fig. 1C). Specific peptide inhibitors to these antibodies also indicates that the observed staining patterns are specific (data not shown). Immunoblot data described in Fig. 4 are also consistent with these staining patterns.

NF-kappa B activity in epithelial cell isolates. To study the activity of NF-kappa B in colonic epithelial cells, epithelial cells were nonenzymatically stripped from the mouse colon (33). Sequential incubations in EDTA-containing buffers provided enriched populations of epithelial cells from different regions of the crypt. Three populations were isolated and characterized for markers of cell proliferation (PCNA) and differentiation (alkaline phosphatase). As shown in Fig. 2A, PCNA expression is highest in the last two isolated cell populations, whereas alkaline phosphatase is highest in the first isolated pool. These isolated cell populations were assayed for NF-kappa B activity by the electrophoretic mobility shift assay (EMSA). As shown in Fig. 2B, NF-kappa B activity is highest in proliferating cells. In addition, the size of the NF-kappa B complex differs in the proliferating and mature cells, suggesting a change in subunit composition. To further characterize the NF-kappa B from proliferating and mature cells, a supershift assay was performed. As shown in Fig. 3, NF-kappa B complexes isolated from proliferating cells include both the p65 and p50 subunits, whereas the mature cells have primarily p50 dimers (the low intensity of the p65 supershift may result from antibody destabilization of the protein-DNA complex). These results are consistent with the immunohistochemical analysis shown in Fig. 1, in which proliferating cells displayed nuclear staining for p65 and the mature cells did not.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2.   Protein expression and NF-kappa B activity in isolated populations of colonic epithelial cells. Epithelial cells were stripped from mouse colons by sequential incubation in EDTA-containing buffers. A: immunoblot analysis shows that the first pool of epithelial cells stripped from the tissue is enriched in mature cells, as determined by the presence of the differentiation marker alkaline phosphatase. Conversely, the proliferating cell nuclear antigen (PCNA) is highest in the last 2 elutions. Thirty micrograms of protein was analyzed in each lane. B: NF-kappa B activity in epithelial cell isolates analyzed by electrophoretic mobility shift assay (EMSA). The same isolates analyzed in A were analyzed here. NF-kappa B is more active in cells from the proliferating region of crypt, whereas differentiated cells show less NF-kappa B activity.



View larger version (52K):
[in this window]
[in a new window]
 
Fig. 3.   Supershift analysis was performed on NF-kappa B activity isolated from proliferating epithelial cells (A) or mature epithelial cells (B). DNA binding reactions were performed in the absence (0) or presence of a supershifting antibody (as indicated). Supershifted complexes are indicated with arrows. Proliferating cells activate p65-p50, whereas the p50 dimer is found in mature cells. N/S, presence of a nonspecific DNA binding activity that is not supershifted by any of the antibodies tested.

Protein extracts from isolated epithelial cells were also analyzed by immunoblotting (Fig. 4). Consistent with the immunohistochemistry shown in Fig. 1, the expression level of p65 is found to decrease as cells mature, whereas the levels of p50 and p105 are more even. The model that emerges is one in which the potent p65-p50 transcriptional activator is partially activated in proliferating cells of the crypt, with the activity and expression of p65 decreasing as cells mature.


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 4.   Expression of NF-kappa B subunits p50 and p65 and the inhibitory protein p105 in isolated epithelial cells. Thirty micrograms of protein obtained from sequentially isolated epithelial cell populations was analyzed by immunoblotting. The results from cells isolated from 2 animals are shown.

NF-kappa B activity in NF-kappa B1 knockout mice. To further explore the role of NF-kappa B in regulating epithelial cell turnover, we analyzed colonic epithelium of NF-kappa B1 knockout mice (55). Unlike p65 knockout mice, NF-kappa B1 knockout mice are viable, although they have a number of immunological alterations, including impaired immunoglobin isotype switching (10, 55). An EMSA analysis was performed using nuclear extracts prepared from colonic epithelial cells of NF-kappa B1 knockout animals and their wild-type counterparts. As shown in Fig. 5, the expected NF-kappa B binding results were obtained from the wild-type isolates, with both p65-p50 and p50-p50 dimers present (isolated cell populations were combined for this assay). However, no NF-kappa B binding activity was detected in the colonic epithelial cells of the NF-kappa B1 knockout mice. The two faint complexes that are observed in the knockout animals cannot be supershifted with antibodies to any of the NF-kappa B subunits. The NF-kappa B1 knockout therefore significantly reduces NF-kappa B activity in colonic epithelial cells and therefore provides a useful model for studying the role of NF-kappa B in epithelial cell turnover in the colon.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 5.   An EMSA was performed to determine the subunit composition of NF-kappa B isolated from wild-type and NF-kappa B1 knockout mice. Where indicated, a supershifting antibody was included in the DNA binding reaction. The binding reactions were performed using nuclear extract prepared from a total epithelial cell isolate. Supershifted complexes are indicated with arrows. N/S, nonspecific DNA binding activity that is not supershifted by any of the antibodies tested.

Epithelial cell turnover NF-kappa B1 knockout mice. To determine the effect of NF-kappa B1 knockout on epithelial cell proliferation, colonic crypts were analyzed for length and expression of the PCNA. Figure 6 shows representative crypts from the distal colon of a wild-type (Fig. 6A) and an NF-kappa B1 knockout (Fig. 6B) animal. Figure 7 shows quantitative data of crypt length (in cell number) and proliferative zone (in cell number) averaged from three animals. As summarized in Fig. 7, the average crypt length in wild-type animals is 22 cells in length, whereas the length of a crypt in the knockout tissue is ~31 cells. In addition, proliferating cells in the wild-type mice extend ~16 cells from the base of the crypt, whereas in the knockout animals the region of proliferation extends to ~25 cells from the crypt base. Also shown in Fig. 6 are the results from an in vivo BrdU labeling of colonic crypts from wild-type (Fig. 6C) and NF-kappa B1 knockout mice (Fig. 6D). The BrdU labeling results confirm the PCNA staining and show a cell labeling index ~2.3-fold higher in the knockout animal (BrdU labeling was estimated as described in MATERIALS AND METHODS). From these results, we conclude that NF-kappa B1 plays a role in suppressing epithelial cell proliferation in the colon. Models for how NF-kappa B1 may be performing this growth inhibitory role are discussed below.


View larger version (129K):
[in this window]
[in a new window]
 
Fig. 6.   Immunohistochemical localization of PCNA in sections of wild-type (A) and NF-kappa B1 knockout (B) mouse colons. Representative crypts derived from the staining of distal colon sections are shown at ×200 magnification. Longer crypts with more extensive proliferative zones are found in the NF-kappa B1 knockout mice compared with wild-type animals. C and D: bromodeoxyuridine (BrdU) incorporation in wild-type and NF-kappa B1 colons, respectively. Both animals were injected with BrdU 24 and 12 h before tissue processing for immunohistochemical detection of BrdU. BrdU incorporation indicates a higher proliferation rate in knockout animals.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7.   Morphometric analysis of PCNA staining shows that NF-kappa B1 knockout animals have significantly longer crypts (A) with longer proliferative zones (B) (P < 0.01). Crypts from the distal colon were analyzed, and the averages from 3 animals in each group are shown. Crypt length was determined by counting the number of cells up 1 side of the crypt. The proliferative zone was determined by counting the number of cells from the base of the crypt to the final positive PCNA-staining cell.

We also analyzed apoptosis in the wild-type and knockout animals using the TUNEL assay (25) (data not shown). No significant differences could be detected between the two strains for apoptotic bodies. Our tentative conclusion is that there is no change in apoptosis rates in the NF-kappa B1 knockout animal, although changes in the rates of cell shedding and phagocytosis can complicate interpretation of the TUNEL assay.

Gene expression profiling in NF-kappa B1 knockout mice. To begin to address the mechanism by which the NF-kappa B1 disruption leads to enhanced cell proliferation in the colon, gene expression profiling was performed. Two approaches were taken (using RNA isolated from the entire tissue). First, a Clontech Atlas mouse 1.2 cDNA array was probed (Fig. 8A). Comparing the expression patterns on these arrays indicates that the expression of most genes remains unchanged in the NF-kappa B1 knockout. One exception was NGF-alpha , a subunit of NGF, which was found to be upregulated ~2.5-fold in the knockout. This result was confirmed by RT-PCR on an independent animal (Fig. 8B). Second, two NF-kappa B-regulated genes of interest that are not on the cDNA array (Fas and TNF-alpha ) were analyzed by an RNase protection assay (Fig. 8C) (3, 15). In this assay, the NF-kappa B1 knockouts were found express TNF-alpha at levels more than five times higher than their wild-type counterparts. Fas mRNA levels were similar in the wild-type and NF-kappa B1 knockouts, indicating that altered expression of Fas is probably not contributing to the increased proliferation rate observed in the knockout mice. The increase in TNF-alpha expression was confirmed by RT-PCR on two other animals (data not shown). A number of cell types in the colon have been reported to express TNF-alpha , including epithelial cells (45). To determine whether epithelial cells were expressing TNF-alpha in the NF-kappa B1 knockout, in situ hybridization was performed (Fig. 9). The results from the in situ hybridization reveal that epithelial cells are at least partly responsible for the elevated levels of TNF-alpha in the NF-kappa B1 knockout. The possible contribution of TNF-alpha and NGF-alpha to the observed proliferation changes in the knockout are discussed below.


View larger version (63K):
[in this window]
[in a new window]
 
Fig. 8.   Differential gene expression analysis in wild-type and NF-kappa B1 knockout mice. A: analysis of mRNA levels in wild-type and NF-kappa B1 knockout mice by the Atlas mouse 1.2 cDNA array. 32P-labeled cDNA probes were prepared from purified mRNA from wild-type or NF-kappa B1 knockout mice. The probes were then hybridized to two separate Atlas mouse 1.2 array membranes. NGF, nerve growth factor; S29, 40S ribosomal protein S29; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. The housekeeping genes were used for normalization of signals. B: comparison of tumor necrosis factor (TNF)-alpha and Fas mRNA expression in wild-type and NF-kappa B1 knockouts by the RNase protection assay. Total RNA was analyzed using the L32 and GAPDH mRNA signals as controls. C: RT-PCR analysis also shows enhanced NGF-alpha mRNA expression in NF-kappa B1 knockouts. The hypoxanthine-guanine phosphoribosyltransferase (HPRT) gene was amplified in parallel as a control.



View larger version (55K):
[in this window]
[in a new window]
 
Fig. 9.   Localization of TNF-alpha mRNA expression in wild-type and NF-kappa B1 knockout animals by in situ hybridization. Colon sections (6 µm) were hybridized to antisense RNA (A and B) or sense RNA (negative control) (C). An upregulation of TNF-alpha is observed in epithelial cells of NF-kappa B1 knockout mice (B) compared with their wild-type counterparts (A). The sense RNA control staining (C) was performed on NF-kappa B1 knockout tissue. Magnification, ×200.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The transcription factor NF-kappa B participates in the regulation of cell proliferation and death in many cell types. Its participation in these events has been studied extensively in cell culture, where NF-kappa B is typically found to promote cell proliferation and suppress apoptosis (6, 7, 10, 12, 13, 29, 34, 43, 56, 60, 63, 67). However, its role in regulating cell turnover in tissue where a variety of cell types interact is less well understood. The complexity of NF-kappa B function in an intact tissue is highlighted by the fact that NF-kappa B is a positive regulator of a number of cytokines, which can have a profound influence on cell viability (2, 5, 17, 23, 38, 39, 68).

Here we provide evidence that NF-kappa B is active in normal mouse colonic epithelial cells. Similar results have been reported by others in both mouse and human tissue (although the level of NF-kappa B activation increases in inflamed tissue) (49, 52). Other groups have also reported expression of NF-kappa B-regulated genes by normal colonic epithelial cells, suggesting a role for this transcription factor in tissue homeostasis (45). Here we provide evidence that NF-kappa B expression and activity change in mouse colonic epithelial cells as they mature. In particular, both the expression and the activity of the p65 subunit are lower in mature cells at the luminal surface. Interestingly, the inhibitor Ikappa Bbeta is reciprocally expressed in colonic epithelium, being highly expressed in mature surface epithelial cells (66). Colonic epithelium therefore appears to be designed to have a low NF-kappa B response at the surface. The changes in p65 and Ikappa Bbeta expression during epithelial cell maturation also suggest that NF-kappa B may participate in regulating epithelial cell turnover. The temporal and positional cues that are influencing p65 and Ikappa Bbeta expression are not entirely clear but could include growth factor availability, extracellular matrix composition, or exposure to luminal contents such as short-chain fatty acids (9, 16, 44, 58).

To study the influence of NF-kappa B on cell turnover in the colon, we have analyzed NF-kappa B1 knockout mice. It was found that disruption of the NF-kappa B1 gene leads to a loss in NF-kappa B activity in colonic epithelial cells and an increase in cell proliferation. In this regard, colonic epithelium appears to be similar to stratified skin epithelium, where NF-kappa B has been found to play a growth inhibitory role (54). We were unable to detect any differences in apoptosis in the NF-kappa B1 knockout by the TUNEL assay. Apoptosis can, however, be difficult to analyze because apoptotic bodies may be rapidly eliminated from the tissue by phagocytosis and shedding. For these reasons it is premature to conclude that the rates of apoptosis have not been affected in the NF-kappa B1 knockouts. The precise mechanism of NF-kappa B in regulating cell proliferation in the colon may involve the activation and/or suppression of a battery of genes required in tissue maintenance.

By gene profiling, two genes were found to be increased in NF-kappa B1 knockout animals, NGF-alpha and TNF-alpha . Increased expression of these genes may be contributing to the enhanced cell proliferation in the colon of NF-kappa B1 knockout mice. NGF-alpha is a component of the mouse NGF, and although it does not interact directly with cellular receptors, it is involved in the processing and stabilization of the receptor-binding NGF-beta subunit (22). NGF is produced by numerous cell types, including intestinal epithelial cells, and it can promote proliferation of epithelial cells under some conditions (18, 20, 61). Modest TNF-alpha levels have also been found to enhance intestinal epithelial cell proliferation in cell culture systems, and it has been suggested to play a role in tissue repair (21, 35-37). The enhanced TNF-alpha expression may also be partly responsible for the higher NGF-alpha expression (1, 46). Further study will be required to determine the contribution of these proteins to the enhanced proliferation rates in NF-kappa B1 knockout mice.

Given the central role of TNF-alpha in intestinal inflammation, the finding that this protein is upregulated in NF-kappa B1 knockouts is particularly interesting (4, 37, 48, 65). This finding is somewhat counterintuitive because the TNF-alpha promoter has a number of functional NF-kappa B sites (3, 68). A possible explanation for the higher TNF-alpha expression level in NF-kappa B1 knockout mice comes from the finding that the p50 dimer (generated from the NF-kappa B1 gene) can act as a potent transcriptional repressor of the TNF-alpha promoter through a high-affinity binding site specific for the p50 dimer (3). Whether mouse intestinal epithelial cells use the p50 dimer to suppress TNF-alpha expression remains to be determined. The finding that TNF-alpha can be produced in the NF-kappa B1 knockout mice also implies that other transcription factors participate in the regulation of TNF-alpha expression in epithelial cells. A number of other response elements are present on the TNF-alpha promoter, and some of these response elements may be activated in the knockout (3, 68).

In summary, our data show that NF-kappa B is active and regulated in colonic epithelial cells and that activation of this transcription factor is associated with a suppression of proliferation. Whether NF-kappa B plays a similar growth inhibitory role during different pathological situations is not clear. Changes in NF-kappa B activity have also been implicated in carcinogenesis (8, 14, 51, 63). In fact, the first NF-kappa B subunit identified was v-Rel, an oncogene from the avian reticuloendotheliosis virus. The mechanism by which v-Rel transforms cells appears to involve the ability of v-Rel to enhance expression of a set of v-Rel-responsive genes and to interfere with the ability of other NF-kappa B subunits to activate gene expression (62). Other studies have revealed that activation of NF-kappa B can enhance proliferation and reduce apoptosis in transformed cells (6, 28, 29, 31, 32, 41, 51, 63, 67). Whether increased NF-kappa B activity is a general facilitator of tumor growth in vivo is not clear. The influence of NF-kappa B on tumor growth is likely to depend on a combination of effects, including the ability to promote cell survival and the ability to stimulate immune and inflammatory reactions to transformed cells.


    FOOTNOTES

Address for reprint requests and other correspondence: C. Giardina, Dept. of Molecular and Cell Biology, Univ. of Connecticut, U-125, 75 North Eagleville Rd., Storrs, CT 06269-3125 (E-mail: giardina{at}uconnvm.uconn.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 14 February 2000; accepted in final form 24 July 2000.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Aloe, L, Fiore M, Probert L, Turrini R, and Tirassa P. Overexpression of tumor necrosis factor alpha in the brain of transgenic mice differentially alters nerve growth factor levels and choline acetyltransferase activity. Cytokine 11: 45-54, 1999[Web of Science][Medline].

2.   Auphan, N, DiDonato JA, Rosette C, Helmberg A, and Karin M. Immunosuppression by glucocorticoids: inhibition of NF-kappa B activity through induction of Ikappa B synthesis. Science 270: 286-290, 1995[Abstract/Free Full Text].

3.   Baer, M, Dillner A, Schwartz RC, Sedon C, Nedospasov S, and Johnson PF. Tumor necrosis factor alpha transcription in macrophages is attenuated by an autocrine factor that preferentially induces NF-kappaB p50. Mol Cell Biol 18: 5678-5689, 1998[Abstract/Free Full Text].

4.   Baert, FJ, D'Haens GR, Peeters M, Hiele MI, Schaible TF, Shealy D, Geboes K, and Rutgeert PJ. Tumor necrosis factor alpha antibody (inflixmab) therapy profoundly downregulates the inflammation in Crohn's ileocolitis. Gastroenterology 116: 22-28, 1999[Web of Science][Medline].

5.   Baeuerle, PA, and Henkel T. Function and activation of NF-kappa B in the immune system. Annu Rev Immunol 14: 649-681, 1994[Web of Science][Medline].

6.   Baichwal, VR, and Baeuerle PA. Apoptosis: activate NF-kappa B or die? Curr Biol 7: R94-R96, 1997[Web of Science][Medline].

7.   Baldwin, AS, Jr, Azizkhan JC, Jensen DE, Beg AA, and Coodly LR. Induction of NF-kappa B DNA-binding activity during the G0-to-G1 transition in mouse fibroblasts. Mol Cell Biol 11: 4943-4951, 1991[Abstract/Free Full Text].

8.   Bargou, RC, Emmerich F, Krappmann D, Bommert K, Mapara MY, Arnold W, Royer HD, Grinstein E, Greiner A, Scheidereit C, and Dorken B. Constitutive nuclear factor-kappa B-RelA activation is required for proliferation and survival of Hodgkin's disease tumor cells. J Clin Invest 100: 2961-2969, 1997[Web of Science][Medline].

9.   Barnard, JA, Warwick GJ, and Gold LI. Localization of transforming growth factor beta isoforms in the normal murine small intestine and colon. Gastroenterology 105: 67-73, 1993[Web of Science][Medline].

10.   Beg, AA, and Baltimore D. An essential role for NF-kappa B in preventing TNF-alpha -induced cell death. Science 274: 782-784, 1996[Abstract/Free Full Text].

11.   Beg, AA, Finco TS, Nantermet PV, and Baldwin AS, Jr. Tumor necrosis factor and interleukin-1 lead to phosphorylation and loss of Ikappa Balpha : mechanism for NF-kappa B activation. Mol Cell Biol 13: 3301-3310, 1993[Abstract/Free Full Text].

12.   Beg, AA, Sha WC, Bronson RT, Ghosh S, and Baltimore D. Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-kappa B. Nature 376: 167-170, 1995[Medline].

13.   Bellas, RE, Fitzgerald MJ, Fausto N, and Sonenshein GE. Inhibition of NF-kappa B activity induces apoptosis in murine hepatocytes. Am J Pathol 151: 891-896, 1997[Abstract].

14.   Cabannes, E, Khan G, Aillet F, Jarrett RF, and Hay RT. Mutations in the Ikappa Balpha gene in Hodgkin's disease suggest a tumor suppressor role for Ikappa Balpha . Oncogene 18: 3063-3070, 1999[Web of Science][Medline].

15.   Chan, H, Bartos DP, and Owen-Schaub LB. Activation-dependent transcriptional regulation of the human Fas promoter requires NF-kappa B p50-p65 recruitment. Mol Cell Biol 19: 2098-2108, 1999[Abstract/Free Full Text].

16.   Daneker, GW, Piazza AJ, Steele GD, and Mercurio AM. Relationship between extracellular matrix interactions and degree of differentiation in human colon carcinoma cell lines. Cancer Res 49: 681-686, 1989[Abstract/Free Full Text].

17.   DePlaen, IG, Tan XD, Chang H, Qu XW, Liu QP, and Hsueh W. Intestinal NF-kappa B is activated, mainly as p50 homodimers, by platelet-activating factor. Biochim Biophys Acta 1392: 185-192, 1998[Medline].

18.   Descamps, S, Lebourhis X, Delehedde M, Boilly B, and Hondermarck H. Nerve growth factor is mitogenic for cancerous but not normal human breast epithelial cells. J Biol Chem 273: 16659-16662, 1998[Abstract/Free Full Text].

19.   DiDonato, JA, Hayakawa M, Rothwarf DM, Zandi E, and Karin M. A cytokine-responsive IkappaB kinase that activates the transcription factor NF-kappaB. Nature 388: 548-554, 1997[Medline].

20.   DiMarco, E, Mathor M, Bondanza S, Cutuli N, Marchisio PC, Cancedda R, and DeLuca M. Nerve growth factor binds to normal human keratinocytes through high and low affinity receptors and stimulates their growth by a novel autocrine loop. J Biol Chem 268: 22838-22846, 1993[Abstract/Free Full Text].

21.   Dionne, S, D'Agata ID, Ruemmele FM, Levy SJ, Srivastava AK, Levesque D, and Seidman EG. Tyrosine kinase and MAPK inhibition of TNF-alpha and EGF-stimulated IEC-6 cell growth. Biochem Biophys Res Commun 242: 146-150, 1997.

22.   Fahnestock, M. Structure and biosynthesis of nerve growth factor. Curr Top Microbiol Immunol 165: 1-26, 1991[Web of Science][Medline].

23.   Frantz, B, and O'Neill EA. The effect of sodium salicylate and aspirin on NF-kappa B. Science 270: 2017-2018, 1995[Abstract/Free Full Text].

24.   Frisch, SM, and Francis H. Disruption of epithelial cell-matrix interactions induces apoptosis. J Cell Biol 124: 619-626, 1994[Abstract/Free Full Text].

25.   Gavrieli, Y, Sherman Y, and Ben-Sassone SA. Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J Cell Biol 119: 493-501, 1992[Abstract/Free Full Text].

26.   Ghosh, S, May MJ, and Kopp EB. NF-kappa B and REL proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immunol 16: 225-260, 1998[Web of Science][Medline].

27.   Gilmore, TD, and Morin PJ. The Ikappa B protein: members of a multifunctional family. Trends Genet 9: 427-433, 1993[Web of Science][Medline].

28.   Giri, DK, and Aggarwal BB. Constitutive activation of NF-kappa B causes resistance to apoptosis in cutaneous T cell lymphoma HuT-78 cells. Autocrine role of tumor necrosis factor and reactive oxygen intermediates. J Biol Chem 273: 14008-14014, 1998[Abstract/Free Full Text].

29.   Guttridge, DC, Albanese C, Reuther JY, and Baldwin AS, Jr. NF-kappaB controls cell growth and differentiation through transcriptional regulation of cyclin D1. Mol Cell Biol 19: 5785-5799, 1999[Abstract/Free Full Text].

30.   Henkel, T, Machledidt T, Alkalay I, Kronke M, Ben-Neriah Y, and Baeuerle PA. Rapid proteolysis of Ikappa B-alpha is necessary for activation of transcription factor NF-kappa B. Nature 365: 182-185, 1993[Medline].

31.   Higgins, KA, Perez JR, Coleman TA, Dorshkind K, McComas WA, Sarmiento UM, Rosen CA, and Narayanan R. Antisense inhibition of the p65 subunit of NF-kappa B blocks tumorigenicity and causes tumor regression. Proc Natl Acad Sci USA 90: 9901-9905, 1993[Abstract/Free Full Text].

32.   Hinz, M, Krappmann D, Eichten A, Heder A, Scheidereit C, and Strauss M. NF-kappa B function in growth control: regulation of cyclin D1 expression and G0/G1-to-S-phase transition. Mol Cell Biol 19: 2690-2698, 1999[Abstract/Free Full Text].

33.   Homaidan, FR, Zhao L, Donavan V, Shinowara NL, and Burakoff R. Separation of pure populations of epithelial cells from rabbit distal colon. Anal Biochem 224: 134-139, 1995[Web of Science][Medline].

34.   Iimuro, Y, Nishiura T, Hellerbrand C, Behrns KE, Schoonhoven R, Grisham JW, and Brenner DA. NF-kappa B prevents apoptosis and liver dysfunction during liver regeneration. J Clin Invest 101: 802-811, 1998[Web of Science][Medline].

35.   Kaiser, GC, and Polk DB. Tumor necrosis factor alpha regulates proliferation in a mouse intestinal cell line. Gastroenterology 112: 1231-1240, 1991[Web of Science][Medline].

36.   Kaiser, GC, Yan F, and Polk DB. Conversion of TNF-alpha from antiproliferative to proliferative ligand in mouse intestinal epithelial cells by regulating mitogen-activated protein kinase. Exp Cell Res 249: 349-358, 1999[Web of Science][Medline].

37.   Kaiser, GC, Yan F, and Polk DB. Mesalamine blocks tumor necrosis factor growth inhibition and nuclear factor kappa B activation in mouse colonocytes. Gastroenterology 116: 602-609, 1999[Web of Science][Medline].

38.   Kunsch, C, Lang RK, Rosen CA, and Shannon MF. Synergistic transcriptional activation of the IL-8 gene by NF-kappa B p65 (RelA) and NF-IL-6. J Immunol 153: 153-164, 1994[Abstract].

39.   Kunsch, C, and Rosen CA. NF-kappa B subunit-specific regulation of the interleukin-8 promoter. Mol Cell Biol 13: 6137-6146, 1993[Abstract/Free Full Text].

40.   Kunsch, C, Ruben SM, and Rosen CA. Selection of optimal kappa B/Rel DNA binding motifs: interaction of both subunits of NF-kappa B with DNA is required for transcriptional activation. Mol Cell Biol 12: 4412-4421, 1992[Abstract/Free Full Text].

41.   LaRosa, F, Pierce J, and Sonenshein G. Differential regulation of the c-myc oncogene promoter by the NF-kappa B/rel family of transcription factors. Mol Cell Biol 14: 1039-1044, 1994[Abstract/Free Full Text].

42.   Lee, FS, Hagler J, Chen ZJ, and Maniatis T. Activation of the Ikappa Balpha kinase complex by MEKK1, a kinase of the JNK pathway. Cell 88: 213-222, 1997[Web of Science][Medline].

43.   Lin, KI, Lee SH, Narayanan R, Baraban JM, Hardwick JM, and Ratan RR. Thiol agents and Bcl-2 identify an alphavirus-induced apoptotic pathway that requires activation of the transcription factor NF-kappa B. J Cell Biol 131: 1149-1161, 1995[Abstract/Free Full Text].

44.   Lorentz, O, Duluc I, Arcangelis AD, Simon-Assmann P, Kedinger M, and Freund JN. Key role of the Cdx2 homeobox gene in extracellular matrix-mediated intestinal cell differentiation. J Cell Biol 139: 1553-1565, 1997[Abstract/Free Full Text].

45.   Lundqvist, C, Melgar S, Yeung MMW, Hammarstrom S, and Hammerstrom ML. Intraepithelial lymphocytes in human gut have lytic potential and a cytokine profile that suggest T helper 1 and cytotoxic functions. J Immunol 157: 1926-1934, 1996[Abstract].

46.   Manni, L, and Aloe L. Role of IL-1 beta and TNF-alpha in the regulation of NGF in experimentally induced arthritis in mice. Rheumatol Int 18: 97-102, 1998[Web of Science][Medline].

47.   Mercurio, F, Zhu H, Murray BW, Shevchenko A, Bennett BL, Li J, Young DB, Barbosa M, Mann M, Manning A, and Rao A. IKK-1 and IKK-2: cytokine-activated IkappaB kinases essential for NF-kappaB activation. Science 278: 860-866, 1997[Abstract/Free Full Text].

48.   Noguchi, M, Hiwatashi N, Liu Z, and Toyota T. Secretion imbalance between tumor necrosis factor and its inhibitor in inflammatory bowel disease. Gut 43: 203-209, 1998[Abstract/Free Full Text].

49.   Payne, CM, Crowley C, Washo-Stultz D, Briehl M, Bernstein H, Berstein C, Beard S, Holubec H, and Warneke J. The stress-response proteins poly(ADP-ribose) polymerase and NF-kappaB protect against bile salt-induced apoptosis. Cell Death Differ 5: 623-636, 1998[Web of Science][Medline].

50.   Potten, CS, and Allen TD. Ultrastructure of cell loss in intestinal mucosa. J Ultrastruct Res 60: 272-277, 1977[Web of Science][Medline].

51.   Reuther, JY, Reuther GW, Cortez D, Pendergast AM, and Baldwin AS, Jr. A requirement for NF-kappa B activation in Bcr-Abl-mediated transformation. Genes Dev 12: 968-981, 1998[Abstract/Free Full Text].

52.   Rogler, G, Brand K, Vogl D, Page S, Hofmeister R, Andus T, Knuechel R, Baeuerle PA, Scholmerich J, and Gross V. Nuclear factor kappa B is activated in macrophages and epithelial cells of inflamed mucosa. Gastroenterology 115: 357-369, 1998[Web of Science][Medline].

53.   Scherer, DC, Brockman JA, Chen Z, Maniatis T, and Ballard DW. Signal-induced degradation of I kappa B alpha requires site-specific ubiquitination. Proc Natl Acad Sci USA 92: 11259-11263, 1995[Abstract/Free Full Text].

54.   Seitz, CS, Lin Q, Deng H, and Khavari PH. Alterations in NF-kappa B function in transgenic epithelial tissue demonstrate a growth inhibitory role for NF-kappa B. Proc Natl Acad Sci USA 95: 2307-2312, 1998[Abstract/Free Full Text].

55.   Sha, WC, Liou H, Tuomanen EI, and Baltimore D. Targeted disruption of the p50 subunit of NF-kappa B leads to multifocal defects in immune cell responses. Cell 80: 321-330, 1995[Web of Science][Medline].

56.   Taglialatela, G, Robinson R, and Perez-Polo JR. Inhibition of nuclear factor kappa B (NF-kappa B) activity induces nerve growth factor-resistant apoptosis in PC12 cells. J Neurosci Res 47: 155-162, 1997[Web of Science][Medline].

57.   Thanos, D, and Maniatis T. NF-kappa B: a lesson in family values. Cell 80: 529-532, 1995[Web of Science][Medline].

58.   Thomas, DM, Nasim MM, Gullick WJ, and Alison MR. Immunoreactivity of transforming growth factor alpha in the normal adult gastrointestinal tract. Gut 33: 628-631, 1992[Abstract/Free Full Text].

59.   Thompson, JE, Phillips RJ, Erdjument-Bromage H, Tempst P, and Ghosh S. Ikappa B-beta regulates the persistent response in biphasic activation of NF-kappa B. Cell 80: 573-582, 1995[Web of Science][Medline].

60.   VanAntwerp, DJ, Martin SJ, Kafri T, Green DR, and Verma IM. Suppression of TNF-alpha -induced apoptosis by NF-kappa B. Science 274: 787-789, 1996[Abstract/Free Full Text].

61.   Varilek, GW, Neil GA, Bishop WP, Lin J, and Pantazis NJ. Nerve growth factor synthesis by intestinal epithelial cells. Am J Physiol Gastrointest Liver Physiol 269: G445-G452, 1995[Abstract/Free Full Text].

62.   Walker, WH, Stein B, Ganchi PA, Hoffman JA, Kaufman PA, Ballard DW, Hannink M, and Greene WC. The v-rel oncogene: insights into the mechanism of transcriptional activation, repression, and transformation. J Virol 66: 5018-5029, 1992[Abstract/Free Full Text].

63.   Wang, CY, Mayo MW, and Baldwin AS, Jr. TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-kappa B. Science 274: 784-787, 1996[Abstract/Free Full Text].

64.   Wang, QS, Papanikolaou A, Sabourin CLK, and Rosenberg DW. Altered expression of cyclin D1 and cyclin-dependent kinase 4 in AOM-induced mouse colon tumorigenesis. Carcinogenesis 11: 2001-2006, 1998[Abstract/Free Full Text].

65.   Watkins, PE, Warren BF, Stephens S, Ward P, and Foulkes R. Treatment of ulcerative colitis in the cottontop tamarin using antibody to tumour necrosis factor alpha. Gut 40: 628-633, 1997[Abstract/Free Full Text].

66.   Wu, GD, Huang N, Wen X, Keilbaugh SA, and Yang H. High-level expression of Ikappa Bbeta in the surface epithelium of the colon: in vitro evidence for an immunomodulatory role. J Leukoc Biol 66: 1049-1056, 1999[Abstract].

67.   Wu, M, Lee H, Bellas RE, Schauer SL, Arsura M, Katz D, FitzGerald MJ, Rothstein TL, Sherr DH, and Sonenshein GE. Inhibition of NF-kappa B/Rel induces apoptosis of murine B cells. EMBO J 15: 4682-4690, 1996[Web of Science][Medline].

68.   Yao, J, Mackman N, Edgington TS, and Fan ST. Lipopolysaccharide induction of the TNF-alpha promoter in human monocytic cells. Regulation by Egr-1, c-Jun, and NF-kappa B transcription factors. J Biol Chem 272: 17795-17801, 1997[Abstract/Free Full Text].

69.   Zandi, E, Rothwarf DM, Delhase M, Hayakawa M, and Karin M. The IkappaB kinase complex (IKK) contains two kinase subunits, IKKalpha and IKKbeta, necessary for IkappaB phosphorylation and NF-kappaB activation. Cell 91: 243-252, 1997[Web of Science][Medline].


Am J Physiol Gastrointest Liver Physiol 279(6):G1282-G1291
0193-1857/00 $5.00 Copyright © 2000 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
D. Laubitz, C. B. Larmonier, A. Bai, M. T. Midura-Kiela, M. A. Lipko, R. D. Thurston, P. R. Kiela, and F. K. Ghishan
Colonic gene expression profile in NHE3-deficient mice: evidence for spontaneous distal colitis
Am J Physiol Gastrointest Liver Physiol, July 1, 2008; 295(1): G63 - G77.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
L. A. Stark, K. Reid, O. J. Sansom, F. V. Din, S. Guichard, I. Mayer, D. I. Jodrell, A. R. Clarke, and M. G. Dunlop
Aspirin activates the NF-{kappa}B signalling pathway and induces apoptosis in intestinal neoplasia in two in vivo models of human colorectal cancer
Carcinogenesis, May 1, 2007; 28(5): 968 - 976.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. C. I. Singh, S. M. Cruickshank, D. J. Newton, L. Wakenshaw, A. Graham, J. Lan, J. P. A. Lodge, P. J. Felsburg, and S. R. Carding
Toll-like receptor-mediated responses of primary intestinal epithelial cells during the development of colitis
Am J Physiol Gastrointest Liver Physiol, March 1, 2005; 288(3): G514 - G524.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
P. R. Nambiar, C. Giardina, K. Guda, W. Aizu, R. Raja, and D. W. Rosenberg
Role of the Alternating Reading Frame (P19)-p53 Pathway in an in Vivo Murine Colon Tumor Model
Cancer Res., July 1, 2002; 62(13): 3667 - 3674.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (19)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Inan, M. S.
Right arrow Articles by Giardina, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Inan, M. S.
Right arrow Articles by Giardina, C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online