Section of Digestive and Liver Diseases, Department of Medicine,
University of Illinois at Chicago and West Side Veterans Affairs
Medical Center, Chicago, Illinois 60612
The current studies were undertaken to
establish an in vitro cellular model to study the transport of
SO
and Cl
and hormonal regulation and
to define the possible function of the downregulated in adenoma
(DRA) gene. Utilizing a postconfluent Caco-2 cell line, we
studied the OH
gradient-driven
35SO
and 36Cl
uptake. Our findings consistent with the presence of an apical carrier-mediated 35SO
/OH
exchange process in Caco-2 cells include: 1) demonstration
of saturation kinetics [Michaelis-Menten constant
(Km) of 0.2 ± 0.08 mM for
SO
and maximum velocity of 1.1 ± 0.2 pmol · mg protein
1 · 2 min
1]; 2) sensitivity to inhibition by DIDS
(Ki = 0.9 ± 0.3 µM); and 3) competitive inhibition by oxalate and Cl
but not by nitrate and short chain fatty acids, with a higher Ki (5.95 ± 1 mM) for Cl
compared with oxalate (Ki = 0.2 ± 0.03 mM). Our results also suggested that the
SO
/OH
and
Cl
/OH
exchange processes in Caco-2 cells
are distinct based on the following: 1) the
SO
/OH
exchange was highly sensitive
to inhibition by DIDS compared with Cl
/OH
exchange activity (Ki for DIDS of 0.3 ± 0.1 mM); 2) Cl
competitively inhibited the
SO
/OH
exchange activity with a high
Ki compared with the Km
for SO
, indicating a lower affinity for
Cl
; 3) DIDS competitively inhibited the
Cl
/OH
exchange process, whereas it
inhibited the SO
/OH
exchange activity
in a mixed-type manner; and 4) utilizing the RNase
protection assay, our results showed that 24-h incubation with 100 nM
of thyroxine significantly decreased the relative abundance of
DRA mRNA along with the
SO
/OH
exchange activity but without
any change in Cl
/OH
exchange process. In
summary, these studies demonstrated the feasibility of utilizing Caco-2
cell line as a model to study the apical
SO
/OH
and
Cl
/OH
exchange processes in the human
intestine and indicated that the two transporters are distinct and that
DRA may be predominantly a SO
transporter with a capacity to transport Cl
as well.
 |
INTRODUCTION |
CONGENITAL CHLORIDE DIARRHEA
(CLD) is a rare autosomal disease characterized by a watery stool with
high chloride concentration and metabolic alkalosis (24).
Previous perfusion studies have demonstrated that the basic defect in
these patients is in the ileal and colonic luminal membrane
Cl
/HCO
exchange process
(3). Recently, a gene family of anion exchangers (AE)
including AE1, AE2, bAE3, and cAE3 has been described (1).
Chow et al. (9) have reported that in the rabbit ileum,
AE2 protein is localized to the apical membrane of the ileal
enterocytes and suggested AE2 to be involved in the luminal chloride
absorption. In this regard, a gene, downregulated in adenoma
(DRA), was recently described that is expressed in the
normal differentiated epithelium in human colon, but its expression is
significantly decreased or lost in colonic adenoma and adenocarcinama (37). By genetic and physical mapping, recent studies
(15) have implicated that the DRA gene but not
any of the AE isoforms is a positional candidate for CLD. Moreover,
these studies (16) identified three mutations of the
DRA gene in CLD patients and suggested that DRA
may be involved in intestinal chloride transport. The cDNA sequence of
DRA has been shown to exhibit a high homology with two
sulfate transporters, the diastrophic dysplasia sulfate transporter
(DTDST) and rat liver sulfate anion transporter (Sat-1), but not with
any member of the AE family (37). Furthermore, early in
vitro studies showed that DRA was capable of transporting sulfate and oxalate (37). However, recent studies
(22, 23) have also shown that human and mouse
DRA are able to transport chloride as well.
Previous studies from our laboratory, utilizing purified apical plasma
membrane vesicles, have demonstrated the presence of Cl
/HCO
(OH
) exchange
process in the human colon (21). Additionally, we have
previously shown that AE2 and bAE3 but not AE1 and cAE3 are expressed
throughout the length of the human intestine (38). Our
immunoblotting studies demonstrated that the protein products of AE2
and bAE3 are localized to basolateral membranes of the epithelial cells
in all the regions of the human intestine (2). Recent
studies (39) from our laboratory have also demonstrated and characterized a sulfate/hydroxyl exchange process in the proximal colonic apical membrane vesicles and showed that this exchanger has
very low affinity for chloride compared with sulfate. The results of
these studies strongly suggested that the described sulfate/hydroxyl
exchange activity was distinct from the previously described
Cl
/HCO
(OH
) exchange
process. In light of the aforementioned, it is not yet clear whether
DRA protein product is in fact the apical anion exchanger
responsible for the Cl
/HCO
exchange
across the apical membranes of the human colonic epithelium or whether
it is mainly a sulfate and oxalate transporter that could also
transport chloride.
These intriguing findings warrant the development of a suitable in
vitro model to study the sulfate and chloride uptake, their substrate
specificity, and their regulation with various hormones and to examine
the role of DRA in intestinal electrolyte transport. The
colonic adenocarcinoma Caco-2 cell line has been shown to be a good
model to study the mechanisms of electrolyte transport in the intestine
(40). Additionally, thyroxine has previously been shown to
alter the level of expression and the function of a number of
electrolyte transporters in various tissues and cell lines (6, 8,
10). Therefore, our current studies were undertaken to examine
whether Caco-2 cell line could serve as a suitable model to study the
apical chloride and sulfate uptake mechanisms and their substrate
specificity. Also, we examined the possible role of thyroxine in
regulation of the expression of human DRA mRNA along with
chloride and sulfate uptake activities in Caco-2 cells.
Our current studies demonstrated that Caco-2 cells could serve as an
experimental model to study the apical intestinal
SO
/OH
and
Cl
/OH
exchange activities. Our data
demonstrated that the two transporters are distinct based on the
following: 1) in contrast to the
Cl
/OH
exchange process, the
SO
/OH
exchange activity was highly
sensitive to inhibition by DIDS (the AE inhibitor); 2) DIDS
competitively inhibited the Cl
/OH
exchange,
whereas it inhibited the SO
/OH
exchange in a mixed-type manner; 3) chloride inhibited the
SO
/OH
exchange competitively with a
high inhibition constant (Ki) for Cl
compared with the Michaelis-Menten consant
(Km) for SO
, indicating
lower affinity of chloride for this sulfate transporter; and
4) thyroxine significantly reduced the level of expression of human DRA mRNA along with
SO
/OH
exchange activity, whereas the
Cl
/OH
exchange activity was not altered by
thyroxine. These data indicate that DRA may be primarily
responsible for sulfate transport although capable of transporting
chloride and that it appears to be distinct from the previously
described Cl
/HCO
(OH
)
exchanger in the intestinal luminal membrane.
 |
MATERIAL AND METHODS |
Cell culture
Caco-2 cells were obtained from ATCC and cultured at 37°C in
an atmosphere of 5% CO2. Cells were maintained as
previously described (33) in Dulbecco's modified Eagle's
medium (DMEM) with 4.5 g/l glucose, 2 mM L-glutamine, 50 U/ml penicillin, 50 µg/ml streptomycin, 2 µg/ml gentamicin, 10 mM
HEPES, 1% essential and nonessential amino acids, and 20% fetal
bovine serum. For the uptake experiments, cells from passages between
20-25 were plated in 24-well plates at a density of 2 × 104 cell/ml. Confluent monolayers were then used for the
transport experiments at day 10 postplating. To study the
effect of 100 nM of thyroxine, we rendered cells quiescent by serum
removal for 48 h before study. Control cells were treated with
equivalent amounts of 100 nM NaOH (vehicle) to thyroxine-treated cells.
35SO
and
36Cl
uptake
Sulfate and chloride uptake experiments were performed
essentially as described by Olsnes et al. (25) with some
modifications. Caco-2 cells were incubated with DMEM base media
containing 20 mM HEPES/KOH, pH 8.5, for 1 h at room temperature.
All the subsequent steps were performed at room temperature. The media
were removed, and the cells were rapidly washed with 1 ml tracer-free
uptake mannitol buffer containing 260 mM mannitol, 20 mM MES/Tris, pH 7. The cells were then incubated with the uptake buffer for the indicated time. For SO
uptake studies, the uptake
buffer was the mannitol buffer including 50 µM (0.5 µCi/ml of
35SO
) sulfuric acid (DuPont). For
chloride uptake, mannitol buffer contained 2.7 mM (1.3 µCi/ml of
36Cl) hydrochloric acid. The uptake was terminated by two
rapid washes with 1 ml of ice-cold PBS. Finally, the cells were
solubilized with 0.5 N NaOH for 4 h. The protein concentration was
measured by the method of Bradford (4), and the
radioactivity was counted by Packard liquid scintillation analyzer,
Tri-CARB 1600-TR (Packard Instrument, Downers Grove, IL). Because the
2-min time point was in the linear range of the uptake for both
chloride and sulfate, the uptake was measured at 2 min and was
expressed as picomoles per milligram of protein per 2 min and nanomoles
per milligram per protein per 2 min for sulfate and chloride,
respectively. The uptake values were analyzed for simple
Km utilizing a nonlinear regression data
analysis from a computerized model (GraphPad, PRISM, San Diego, CA).
Lineweaver-Burk analysis (1/v vs. 1/[s]) was used to determine the
kinetics parameters [i.e., the apparent Km and
maximum velocity (Vmax)] utilizing linear
regression data analysis from the same program (GraphPad, PRISM).
Designing of PCR primers and PCR technique
The PCR primer sequences for human DRA were designed
from the human sequences that have been retrieved from the gene-bank CD-ROM utilizing GeneWorks software and as previously described (37). The primer sequences are 5' primer:
ACCATGATTGAACCCTTTGGGAATCAGTAT; 3'
primer: ATACACCTGCTGCAATCACG (length of amplified region
910 residues; nt 184-1094 of the human DRA). The PCR
was essentially performed according to the manufacturer's instructions
utilizing 2 µg of human colonic cDNA pool obtained from Invitrogen
(Carlsbad, CA) as a template, gene-specific human DRA PCR
primers, and the proofreading Elongase enzyme mix (GIBCO BRL,
Gaithersburg, MD). The reaction was performed in a total volume of 50 µl of PCR mixture containing 60 mM Tris-SO4 (pH 9.1 at
25°C), 18 mM NH4SO4, 1.8 mM
MgSO4, 200 µM each dNTPs, 400 nM of each primers, and 2 µl of the Elongase enzyme mix. The PCR was carried out using a
Microcycler programmable heating/cooling dry block (Perkin Elmer,
Norwalk, CT) for 40 cycles of amplification (94°C, 30 s; 52°C,
30 s; 68°C, 3 min) followed by 10 min at 68°C. PCR products
were separated by electrophoresis on 1% agarose gel containing
ethidium bromide (0.5 µg/ml). Bands of expected sizes were visualized
under ultraviolet light utilizing Eagle eye II Still Video System
(Stratagene, La Jolla, CA). The 910-bp PCR products were excised from
the agarose, purified utilizing Sephaglas BandPrep Kit (Amersham
Pharmacia Biotech, Piscataway, NJ), and subjected to A-tailing reaction by heating at 70°C for 30 min in a final volume of 10 µl containing 100 mM Tris · HCl (pH 8.3), 2.5 mM MgCl2, 50 mM
KCl, 200 µM dATP, and 5 units of Taq DNA polymerase (GIBCO
BRL). Two microliters of the reaction were ligated into a pGEM-T Easy
vector (Promega, Madison, WI). The orientation and the sequence of the
insert were confirmed by sequencing utilizing the Sequenase Kit
(Amersham Pharmacia Biotech). The constructed DRA vector,
p5'DRA, was then utilized for making cRNA probe for the
RNase protection assay.
Isolation of RNA
Total RNA was extracted from Caco-2 cells by the method of
Chomczynski and Sacchi (7) using RNAzol solution supplied
by the manufacturer (Tel-Test, Friendswood, TX) and essentially using the manufacturer's protocol.
Generation of cRNA probes and RNase protection assay
p5'DRA vector was linearized by digestion with Ava II
and transcribed with T7 RNA polymerase in the presence of
[32P]CTP utilizing the riboprobe Gemini transcription
system (Promega, Madison, WI). [32P]cRNA riboprobe for
human DRA contained 579 bp, and the protected fragment
corresponded to 527 bp. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) vector was constructed, and cRNA riboprobe for GAPDH was generated as described previously by us (11).
[32P]cRNA for GAPDH contained 300 bp, and predicted
protected fragment corresponded to 210 bp.
For the RNase protection assay, total RNA (20-30 µg) was
coprecipitated with 107 counts/min of high specific
activity 32P-labeled DRA riboprobe and
105 counts/min of low specific activity
32P-labeled GAPDH riboprobe. Samples were then resuspended
in a hybridization buffer containing 75% formamide, 400 mM NaCl, 1 mM
EDTA, and 40 mM PIPES, pH 6.4, and were hybridized at 45°C for
12-18 h. Samples were then diluted in 10 vol of 300 mM NaCl, 5 mM
EDTA, and 10 mM Tris pH 7.5, and 1,400 units of T1 ribonuclease were
added to each sample. After a 45-min incubation at 37°C, samples were
added to a stop solution containing 4 M LiCl and 5 µg tRNA and
precipitated with 2 vol of ethanol. Precipitates were resuspended in a
small volume of dye solution (xylene cyanole and bromophenol blue in
90% formamide and 10 mM EDTA, pH 7.5). The double-stranded
32P-cRNA fragments that were protected from the RNase
digestion were heated at 95°C for 5 min and analyzed by
electrophoresis on a denaturing polyacrylamide gel containing 8 M urea.
The gels were dried and exposed to storage phosphor screen overnight
and then analyzed utilizing a PhosphorImager (Molecular Dynamics, Sunnyvale, CA). The relative abundance of DRA was calculated
by comparing the number of counts of radioactivity of DRA
band in response to thyroxine treatment or vehicle alone after
normalization to the number of counts in the GAPDH band. Because GAPDH
mRNA is expressed in very high abundance compared with DRA,
~20-fold lower specific activity of 32P-labeled GAPDH
compared with DRA probes were synthesized by including more
cold CTP in the transcription reaction. This was specifically done to
keep the density of GAPDH band in a readable range on final scan while
enabling the detection of DRA band. The procedure of
labeling was exactly the same every time, and once the probes were
synthesized, the batch of probes was simultaneously utilized for
hybridization with equal amounts of RNA.
Statistical analysis
Data are means ± SE of at least 3-6 independent
determinations (performed in separate wells) repeated on at least two
to three occasions. When error bars are not visible in the figures,
they are smaller than the symbol. Statistical differences were analyzed by Student's t-test, and a P value of <0.05 was
considered statistically significant.
 |
RESULTS |
The OH
gradient-stimulated
35SO
uptake in Caco-2 cells
Time course of OH
gradient-stimulated
35SO
uptake.
Previous studies have shown the protein product of DRA gene
to be a sulfate and oxalate transporter. Additionally, Caco-2 cells
have previously been utilized to characterize electrolyte transport in
the human intestine. Therefore, to establish an in vitro cellular model
to study the role of DRA in anion transport in the human
intestine and its regulation by the hormones, we first examined the
OH
gradient-dependent apical
35SO
uptake in monolayers of 5-7
days postconfluent well-differentiated Caco-2 cells. As shown in Fig. 1, OH
gradient-driven
35SO
uptake in Caco-2 cells was linear as a function of time for up to 7 min and was significantly inhibited by 0.3 mM DIDS (the AE inhibitor). Therefore, a 2-min incubation time
was used in all subsequent experiments.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 1.
Time course of OH gradient-stimulated
35SO uptake in Caco-2 cells. Caco-2
cells, 5-7 days postconfluent, were incubated for 1 h at room
temperature in the HEPES/KOH medium adjusted to pH 8.5. Cells were then
washed and incubated with the uptake buffer, pH 7, containing
35SO (50 µM) as described in
MATERIALS AND METHODS, in the absence ( ) or
the presence ( ) of 0.3 mM DIDS. Uptake was then
terminated by 2 washes with ice-cold PBS buffer at indicated time
points (x-axis). Results are means ± SE of 6 uptake
determinations performed on 2 separate occasions.
|
|
Kinetics of SO
/OH
exchange process in Caco-2 cells.
To further characterize the apical
SO
/OH
exchange process in Caco-2
cells, we examined the kinetic parameters of the exchanger by measuring
sulfate uptake in the presence of increasing concentrations of
extracellular SO
(50 µM to 1.5 mM). Figure
2A shows that the apical
OH
gradient-stimulated
35SO
uptake in Caco-2 cells exhibited saturation kinetics in the presence of increasing concentrations of
sulfate. Lineweaver-Burk plot (Fig. 2B) demonstrated a
straight line with an apparent Km of 0.2 ± 0.08 mM for sulfate and a Vmax of 1.1 ± 0.2 nmol · mg protein
1 · 2 min
1. These data indicate a carrier-mediated process for
the OH
gradient-driven apical sulfate uptake in Caco-2
cells.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 2.
Kinetics of SO /OH
exchange process in Caco-2 cells. Postconfluent Caco-2 cells were
incubated for 1 h at room temperature in the HEPES/KOH medium
adjusted to pH 8.5. Cells were then washed and incubated with the
35SO uptake buffer, described in
MATERIALS AND METHODS, in the presence of increasing
concentrations of extracellular SO (50-1,500
µM). A: Michaelis-Menton plot of SO
uptake as a function of the SO concentration;
B: Lineweaver-Burk plot for data. Results are means ± SE of 10 uptake determinations performed on 4 separate occasions.
|
|
35SO
uptake inhibition by
DIDS.
As shown above, the SO
/OH
exchange process was highly sensitive to inhibition by DIDS. To further examine the characteristics of the exchanger, we studied the effect of
DIDS on kinetic parameters of the apical
35SO
uptake in Caco-2 cells.
Lineweaver-Burk plot, as shown in Fig. 3,
demonstrated that 35SO
uptake was
inhibited by 50 µM DIDS in a mixed-type manner, with an increase in
the apparent Km for sulfate from 0.22 to 0.73 mM
and a decrease in the Vmax from 1.57 to 0.23 nmol · mg protein
1 · 2 min
1. These experiments were repeated using different
concentrations of DIDS (0.015, 0.025, and 0.05 mM; not shown) and
demonstrated the same pattern of inhibition with a
Ki of 0.9 ± 0.3 µM.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 3.
Effect of DIDS on the kinetics of
SO /OH exchange activity in Caco-2
cells. Postconfluent Caco-2 cells were preincubated for 1 h at
room temperature in HEPES/KOH medium adjusted to pH 8.5. OH gradient-stimulated SO uptake in
Caco-2 cells, in the presence ( ) or the absence
( ) of 0.05 mM DIDS, was determined as described in Fig.
2 legend. Lineweaver-Burk plot for data is shown. Results are
means ± SE of 4 uptake determinations performed on 2 separate
occasions.
|
|
Effect of anions on 35SO
uptake.
Recent studies (22, 23) have suggested that the
DRA protein product is a
Cl
/HCO
(OH
)
exchanger. Previously, DRA was shown to be a sulfate
and oxalate transporter. To examine the anion specificity of the apical
SO
/OH
exchanger in Caco-2 cells, we
investigated the effect of various anions on the sulfate uptake in
Caco-2 cells. As shown in Fig. 4, 5 mM
cis-concentration of butyrate, formate, lactate, succinate, and nitrate failed to significantly inhibit
35SO
(50 µM) uptake in Caco-2 cells. On the other hand, 5 mM cis-concentration of oxalate and
chloride inhibited 35SO
(50 µM)
uptake by ~90 and ~30%, respectively. These findings suggest that
oxalate and chloride but not butyrate, formate, lactate, succinate, or
nitrate could serve as alternative substrates for the
SO
/OH
antiporter in Caco-2 cells.
These results also indicate that the exchanger has a markedly higher
affinity for oxalate compared with chloride.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 4.
Effects of anions on OH gradient-driven
35SO uptake in Caco-2 cells. Caco-2
cells preincubated with the HEPES medium, pH 8.5, were incubated with
35SO uptake buffer, containing 50 µM
of 35SO , in the presence of 5 mM
concentration of different anions. Results are a percentage of uptake
in the presence of each anion compared with control (100%) and are
means ± SE of 6 uptake determinations (*P < 0.05) from 3 separate occasions.
|
|
The mechanism(s) of 35SO
uptake
inhibition by oxalate and chloride.
Because oxalate and chloride significantly inhibited the apical
OH
gradient-stimulated
35SO
uptake in Caco-2 cells, we further investigated the mechanisms by which oxalate and chloride inhibited the
35SO
uptake. Figure
5 shows the effect of 0.5 mM
concentration of oxalate on the kinetics of
35SO
uptake, which demonstrates a
competitive inhibition. The experiment was repeated using different
concentrations of oxalate (0.3, 0.5, and 1 mM; not shown) and showed
the same type of inhibition with a Ki of
0.2 ± 0.03 mM for oxalate. On the other hand, as shown in Fig.
6, 35SO
uptake was also competitively inhibited by 10 mM concentration of
chloride. Repeating the experiment with different concentrations of
chloride (5, 10, and 25 mM; not shown) revealed the same pattern of
inhibition with a Ki of 5.9 ± 1 mM for
chloride. These findings suggest that although the SO
/OH
exchanger could use oxalate and
chloride as alternative substrates in addition to sulfate, it appears
that the antiporter has a markedly higher affinity for both sulfate and
oxalate compared with chloride.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 5.
Effect of oxalate on the kinetics of
SO /OH exchange process in Caco-2
cells. OH gradient-stimulated SO
uptake in Caco-2 cells in the presence ( ) or the
absence ( ) of 0.5 mM concentration of oxalate was
determined as described in Fig. 2 legend. Lineweaver-Burk plot for data
is shown. Results are means ± SE of 8 uptake determinations
performed on 3 separate occasions.
|
|

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of Cl on
35SO in Caco-2 cells. pH
gradient-driven SO uptake in postconfluent Caco-2
cells was measured in the presence ( ) or the absence
( ) of 10 mM concentration of Cl as
described in Fig. 2 legend. Lineweaver-Burk plot for data is shown.
Results are means ± SE of 4 uptake determinations performed on 2 separate occasions.
|
|
OH
gradient-stimulated 36Cl
uptake in Caco-2 cells
Time course of OH
gradient-stimulated
36Cl
uptake.
We have previously characterized
Cl
/HCO
(OH
) exchange
process in the human colonic proximal and distal apical plasma membrane
vesicles. To investigate whether Caco-2 cells could also serve as a
model to study the chloride uptake, we examined the effect of outwardly
directed OH
gradient on the time course of
36Cl
uptake in Caco-2 cells. As shown in Fig.
7, OH
gradient-dependent
36Cl
uptake in Caco-2 cells was linear as a
function of time up to 7 min and it was inhibited by DIDS. It should be
noted that in contrast to SO
/OH
exchange activity, OH
gradient-stimulated
36Cl
uptake was much less sensitive to
inhibition by DIDS. These data suggest that in Caco-2 cells the two
processes may be occurring via two distinct transporters.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 7.
Time course of OH gradient-stimulated
36Cl uptake in Caco-2 cells. Postconfluent
Caco-2 cells were incubated for 1 h at room temperature in
HEPES/KOH medium adjusted to pH 8.5. Cells were then washed and
incubated with uptake buffer, pH 7, containing
36Cl as described in MATERIALS AND
METHODS, in the absence ( ) or the presence
( ) of 0.3 mM DIDS. Uptake was then terminated by 2 washes with ice-cold PBS buffer at indicated time. Results are
means ± SE of 6 uptake determinations performed on 3 separate
occasions.
|
|
The OH
gradient-stimulated
36Cl
uptake inhibition by DIDS.
Because the SO
/OH
exchange process
was shown to be inhibited by DIDS in a mixed-type manner and Cl
/OH
exchange appeared to be more
resistant to inhibition by DIDS, we examined the mechanism of
Cl
/OH
exchange inhibition by DIDS in Caco-2
cells. As shown in Fig. 8, 0.35 mM DIDS
altered the apparent Km for chloride, whereas no
significant changes occurred in the Vmax. The
data also indicated a competitive mode of inhibition. These experiments
were repeated using different concentrations of DIDS (0.2, 0.5, and 1 mM; not shown) and demonstrated the same pattern of inhibition with a Ki of 0.3 ± 0.1 mM.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 8.
Effect of DIDS on kinetics of
Cl /OH exchange activity in Caco-2 cells.
OH gradient-stimulated 36Cl
uptake was determined as described in MATERIALS AND METHODS
in presence of increasing concentrations of Cl
(2.7-50 mM). Uptake was measured in the presence
( ) or the absence ( ) of 0.35 mM DIDS.
Lineweaver-Burk plot for data is shown. Results are means ± SE of
6 uptake determinations performed on 2 separate occasions.
|
|
The differences in the sensitivity and the mechanism of inhibition by
DIDS, along with different Ki, indicate that the
apical SO
/OH
and
Cl
/OH
exchange activities in Caco-2 cells
could occur via distinct transporters.
The effect of thyroxine on OH
gradient-stimulated
35SO
and
36Cl
uptake in Caco-2 cells
Thyroxine has previously been shown to alter the level of
expression and the function of various electrolyte transporters in a
number of tissue and cell lines (6, 8, 10). To investigate the role of thyroxine in the possible regulation of chloride and sulfate uptake in Caco-2 cells, we incubated Caco-2 cells with 100 nM
of thyroxine for 24 h and studied its effect on both
SO
/OH
and
Cl
/OH
exchange processes. As shown in Fig.
9A, the OH
gradient-driven 35SO
uptake was
significantly reduced in Caco-2 cells incubated with thyroxine by
45.3 ± 8.6% compared with control (vehicle alone). In contrast,
36Cl
uptake showed no significant changes
after thyroxine treatment (Fig. 9B). These results further
support the notion of the presence of distinct
SO
/OH
and
Cl
/OH
transporters in Caco-2 cells. To
further analyze the effect of thyroxine on the
SO
/OH
exchange process in Caco-2
cells, we examined the effect of thyroxine treatment on the kinetic
parameters of 35SO
uptake. As shown in
Fig. 10, the Vmax of 35SO
uptake was significantly decreased (3.4 ± 0.28 compared with
5.1 ± 0.42 nmol · mg protein
1 · 2 min
1) in response to thyroxine treatment compared with
vehicle alone. The differences in Vmax values of
vehicle-treated cells alone compared with our basal values in Caco-2
cells appear to be due to a different batch of Caco-2 cells utilized
here. Also, thyroxine treatment resulted in a decrease in the
Km for SO
(0.09 ± 0.04 compared with 0.18 ± 0.05 mM in vehicle alone).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 9.
Effect of thyroxine on OH
gradient-stimulated 35SO and
36Cl uptake in Caco-2 cells. Postconfluent
Caco-2 cells were serum-starved for 24 h and then incubated for
24 h with 100 nM of thyroxine or vehicle alone (NaOH).
35SO (A) and
36Cl (B) uptakes were determined
as described in MATERIALS AND METHODS. Data are a
percentage of uptake compared with control (100%). Results are
means ± SE of 8 uptake determinations (*P < 0.05) performed on 4 separate occasions.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 10.
Effect of thyroxine on the kinetics of
35SO uptake in Caco-2 cells.
Postconfluent Caco-2 cells were treated with thyroxine ( ) or vehicle
(NaOH) alone ( ) as described in Fig. 9.
35SO uptake was measured in the
presence of increasing concentration of SO .
Michaelis-Menton plot of 6 uptake determinations performed on 3 separate occasions is shown.
|
|
The effect of thyroxine on the relative abundance of human
DRA mRNA
To investigate the possible mechanism of reduced
SO
/OH
exchange activity in Caco-2
cells, we examined the effect of thyroxine on the level of expression
of DRA mRNA, utilizing an RNase protection assay. The
[32P]cRNA probes for human DRA and GAPDH
(internal standard) were hybridized to total RNA extracted from control
and thyroxine-treated Caco-2 cells. Subsequently, RNase-digested bands
with the predicted sizes were observed in quantitative manner for human
DRA and GAPDH mRNA. Figure
11A shows a representative
RNase protection assay blot for human DRA and GAPDH in
Caco-2 cells treated with 100 nM thyroxine or vehicle alone for 12, 20, and 24 h. The data demonstrate protected fragments for human
DRA and GAPDH with the appropriate expected sizes. The human
DRA mRNA, as shown in Fig. 11A, was reduced in a
time-dependent manner in response to thyroxine treatment compared with
vehicle alone with a maximal reduction at 24-h time point. Analysis of
the quantification for human DRA mRNA in Caco-2 cells after
24-h incubation with thyroxine or vehicle alone is depicted in Fig.
11B (n = 4). The relative abundance of human
DRA mRNA was calculated by taking the ratio of their
representative densities to that of GAPDH. As shown in the Fig.
11B, incubation of Caco-2 cells for 24 h with 100 nM
thyroxine reduced the relative abundance of DRA mRNA by
57.5 ± 0.81% compared with control. These data along with the
reduction in the Vmax of
35SO
with no changes in the
36Cl
uptake in these cells suggest that
DRA may be involved directly in the apical
SO
/OH
but not in
Cl
/OH
exchange in Caco-2 cells.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 11.
Effect of thyroxine on the relative abundance of
DRA mRNA in Caco-2 cells. A: representative RNase
protection assay autoradiogram for human DRA and GAPDH
(internal control). Lanes A, C, and E:
protected fragments for human DRA and GAPDH (indicated by
arrows) after hybridization to total RNA extracted from Caco-2 cells
incubated for 12, 20, and 24 h with vehicle alone (NaOH),
respectively. Lanes B, D, and F: protected
fragments for human DRA and GAPDH from total RNA extracted
from Caco-2 cells incubated with 100 nM thyroxine for 12, 20, and
24 h, respectively. B: percentage of relative abundance
of human DRA mRNA in 24-h thyroxine treated Caco-2 cells
compared with control (cells treated with vehicle alone). Results are
means ± SE (*P < 0.05) from 4 independent
experiments.
|
|
 |
DISCUSSION |
In our current studies, we have established an in vitro cellular
model to study sulfate and chloride transport and have defined the
possible role of DRA in the anion transport in the human
intestine. Our results demonstrated that the Caco-2 cell line could
serve as a suitable model to study sulfate and chloride transport. The data of our studies demonstrated and characterized the presence of an
apical SO
/OH
exchange process in
Caco-2 cells. The findings consistent with a carrier-mediated activity
for the OH
gradient-stimulated
35SO
uptake are: 1)
35SO
uptake exhibited saturation
kinetics; 2) 35SO
uptake was
significantly inhibited by DIDS (the AE inhibitor); and 3)
oxalate and chloride (but not butyrate, formate, lactate, succinate,
and nitrate), competitively inhibited the
SO
/OH
exchange process, indicating
the presence of an anion antiporter that could use oxalate and chloride
as alternative substrates in addition to sulfate. Furthermore, the
results of the present studies indicated that the apical
SO
/OH
and
Cl
/OH
exchange in Caco-2 cells are distinct
processes based on the following: 1)
SO
/OH
exchange activity was more
sensitive to inhibition by DIDS compared with
Cl
/OH
exchange process; 2)
SO
/OH
exchange process was inhibited
by DIDS in a mixed-type manner, whereas
Cl
/OH
exchange was competitively inhibited
by DIDS; 3) incubation with 100 nM thyroxine inhibited the
OH
gradient-stimulated
35SO
but not
36Cl
uptake in Caco-2 cells; and
4) in parallel to reduced SO
uptake,
thyroxine treatment also reduced the relative abundance of
DRA mRNA.
Previous studies have shown that postconfluent differentiated Caco-2
cells possess many of the functional and structural characteristics of
the native enterocyte including similar transport mechanisms and
regulatory pathways (27). Therefore, Caco-2 cells have
been previously used as a model to characterize the electrolyte
transport in the small intestine and colon (40). Silberg
et al. (37) have recently shown that the DRA
gene is expressed in postconfluent but not preconfluent Caco-2 cells.
Consistent with the previous studies of Silberg et al., our results
showed that 5-7 days postconfluent but not preconfluent Caco-2
cells expressed the DRA gene (data not shown) and possess
apical SO
/OH
and
Cl
/OH
exchange activities. Therefore, these
cells have been utilized here as an in vitro cellular model to study
the regulation of the DRA expression by thyroxine and
delineate the interactions between sulfate, chloride, and oxalate
transport in the human intestine.
The apical SO
/OH
exchange in the
polarized monolayers of Caco-2 cells appeared to be a carrier-mediated process. The SO
/OH
exchanger in
Caco-2 cells exhibited kinetic characteristics similar to
SO
/OH
or
SO
/HCO
exchangers in other
systems. For instance, Km of 0.2 mM for
SO
uptake in Caco-2 cells is comparable to
SO
/OH
exchanger in rabbit ileal BBM
(0.475 mM; Ref. 34),
SO
/HCO
exchanger in rabbit ileal
BLM (0.122 mM;Ref. 20), rat liver lysosomal sulfate
transporter (0.213 mM; Ref. 8), and human proximal colon
BBM (0.8 mM; Ref. 39). Furthermore, the
SO
/OH
exchanger in Caco-2 cells
appears to be highly sensitive to DIDS. Our results showed that the
effect of DIDS on 35SO
uptake occurs in
a linear mixed type of inhibition with a Ki of
0.9 ± 0.3 µM for DIDS. This Ki value is
also comparable with the Ki of DIDS inhibition
of SO
/HCO
exchanger in the
rabbit ileum BLM (6 µM; Ref. 20). Although the mechanism
of inhibition by DIDS of the SO
/OH
exchange process needs more detailed characterization, this kind of
inhibition suggests that DIDS and SO
have different
binding sites on the exchanger and that DIDS, upon binding to its site,
may alter the affinity of the transporter for substrates probably via
inducing conformational changes in the antiporter.
The apical SO
/OH
exchange process in
Caco-2 cells appeared to be specific for SO
, Cl
, and oxalate but not for the other anions such as
nitrate and short chain fatty acids. Our kinetic studies demonstrated
that both Cl
and oxalate inhibited the OH
gradient-stimulated 35SO
uptake in
Caco-2 cells in a competitive manner. The Ki
values for Cl
and oxalate suggest that although the
exchanger can transport Cl
and oxalate in addition to
SO
, it has higher affinity for
SO
(Km = 0.2 mM) and
oxalate (Ki = 0.2 mM) compared with
Cl
(Ki = 5.9 mM). In
agreement with the previous studies of Silberg et al.
(37), which demonstrated that DRA gene product
is a sulfate and oxalate transporter, our results indicate that
DRA may be responsible for the
SO
/OH
exchange process in Caco-2
cells. On the other hand, previous studies in the human proximal colon
and rabbit ileum (18, 21) have shown that nitrate and
bromide could substitute for chloride in the
Cl
/HCO
(OH
) exchange
processes. Because the SO
/OH
exchanger in the current study exhibited lower affinity for chloride and nitrate did not alter the OH
gradient-stimulated
35SO
uptake, the data of the current study suggest that SO
/OH
and
Cl
/HCO
(OH
) exchange
activities in the human intestine may be distinct processes.
We have previously characterized a
Cl
/HCO3
(OH
)
exchange process in the human small intestine and proximal colon (21,
29). These studies demonstrated that Cl
uptake into the
human colonic apical membrane vesicles was stimulated in the presence
of a pH gradient. The OH
gradient-stimulated
Cl
uptake into these vesicles was further stimulated in
the presence of a HCO
gradient. The data of these studies clearly demonstrated that in the human small intestine and
colon, Cl
/HCO
and
Cl
/OH
exchange activities were mediated via
the same transporter. In the present study, we intended to examine
whether Caco-2 cells could also serve as a suitable model to study
chloride transport. Our data demonstrated the presence of an outwardly
OH
gradient-stimulated 36Cl
uptake that was linear as a function of time and could be inhibited by
DIDS. Because Caco-2 cells were derived from human colon adenocarcinoma and when confluent demonstrate the characterstics of differentiated enterocytes (27), it is most likely that the
OH
gradient-driven 36Cl
uptake
into these cells represents the activity of the same transporter that
is also responsible for Cl
/HCO
exchange process. In this regard, previous studies by Rajendran and
Binder (28) have shown the presence of two distinct
transporters, Cl
/OH
and
Cl
/HCO
exchangers in rat distal
colonic apical membrane vesicles. In these studies, the pH
gradient-dependent 36Cl
uptake was not
(unlike our previous studies with human colonic apical membrane
vesicles) affected by imposing a HCO
gradient.
Additionally, in these studies with rat colonic apical membrane
vesicles, bumetanide was shown to preferentially inhibit the
Cl
/OH
but not the
Cl
/HCO
exchange process
(28). In contrast, in our current studies, bumetanide
inhibited both 36Cl
and
35SO
uptake to the same extent
(~30-40%, data not shown) ruling out the possibility that,
similar to rat distal colon, Caco-2 cells may also possess two
different Cl
/HCO3
and
Cl
/OH
exchange processes with one that
could take 35SO
as a substrate.
Similar to our previous findings in the human proximal colonic apical
membrane and to other intestinal AEs such as of rabbit and human ileum
(13, 18, 21, 29), the Cl
/OH
exchange process in Caco-2 cells appeared to be relatively less sensitive to inhibition by DIDS. It has previously been suggested that
the possible explanation for the poor inhibition may be a result of
competition with the substrate (5). In agreement with
that, our findings showed that Cl
/OH
exchange process in Caco-2 is competitively inhibited by DIDS with a
Ki of 0.3 mM. The Ki
value for Cl
uptake inhibition by DIDS is also comparable
with other systems such as Cl
/HCO
exchange in the rabbit ileal basolateral membrane, with a
Ki of 0.28 mM (19). The fact that SO
/OH
and
Cl
/OH
exchange activities in Caco-2 cells
have different sensitivities and mechanisms of inhibition by DIDS with
different Ki values further supports the notion
that they are mediated via distinct transporters. Recent studies
(22, 23) have shown that DRA is capable of
transporting Cl
and suggested that DRA is the
intestinal apical Cl
/HCO
exchanger. The data in the current study showed that
SO
uptake is competitively inhibited by
Cl
with a Ki of 5.9 mM indicating
that SO
/OH
exchanger is able to
transport Cl
but with a low affinity compared with
SO
.
The thyroid hormone thyroxine has been shown to have a widespread
effect on membrane transport of amino acids (12), glucose (35), and ions (6, 8, 10) in various tissues
and cell lines. For instance, Cano et al. (6) demonstrated
a stimulation of renal Na+/H+ exchanger by
transcripitional activation in OK cell line by thyroxine. Furthermore,
Chou et al. (8) have reported that the lysosomal sulfate
transport in the rat liver is decreased by thyroxine treatment. Additionally, thyroxine has been previously shown to play an important role in the developmental changes of a number of intestinal digestive enzymes and transporters (14). In this regard, Chow et al.
(10) have previously shown that thyroxine treatment to
suckling rats was followed by a 60% decrease in the expression of AE2
in the small intestine. The novel finding in the current study is that, in Caco-2 cells, 24-h treatment with thyroxine significantly decreased the OH