AJP - GI Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 280: G1163-G1171, 2001;
0193-1857/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rühl, A.
Right arrow Articles by Stremmel, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rühl, A.
Right arrow Articles by Stremmel, W.
Vol. 280, Issue 6, G1163-G1171, June 2001

Interleukin-6 expression and regulation in rat enteric glial cells

A. Rühl1, S. Franzke1, S. M. Collins2, and W. Stremmel1

1 Department of Gastroenterology, University of Heidelberg, D-69115 Heidelberg, Germany; and 2 Intestinal Disease Research Program, McMaster University Medical Centre, Hamilton, Ontario, Canada L8N-3Z5


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

As yet, little is known about the function of the glia of the enteric nervous system (ENS), particularly in an immune-stimulated environment. This prompted us to study the potential of cultured enteroglial cells for cytokine synthesis and secretion. Jejunal myenteric plexus preparations from adult rats were enzymatically dissociated, and enteroglial cells were purified by complement-mediated cytolysis and grown in tissue culture. Cultured cells were stimulated with recombinant rat interleukin (IL)-1beta , IL-6, and tumor necrosis factor (TNF)-alpha , and IL-6 mRNA expression and secretion were assessed using RT-PCR and a bioassay, respectively. Stimulation with TNF-alpha did not affect IL-6 mRNA expression, whereas IL-1beta stimulated IL-6 mRNA and protein synthesis in a time- and concentration-dependent fashion. In contrast, IL-6 significantly and dose-dependently suppressed IL-6 mRNA expression. In summary, we have presented evidence that enteric glial cells are a potential source of IL-6 in the myenteric plexus and that cytokine production by enteric glial cells can be regulated by cytokines. These findings strongly support the contention that enteric glial cells act as immunomodulatory cells in the enteric nervous system.

enteric glia; tissue culture


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

INFLAMMATORY CONDITIONS of the gut, ranging from peptic esophagitis to ulcerative colitis, induce alterations of gastrointestinal motility and sensory perception (for review, see Ref. 12). In animal models, a causal relationship between the presence of mucosal inflammation and altered sensory-motor function has been established (12). However, functional changes in the neuromuscular compartment of the gut wall can often be observed in the absence of an inflammatory infiltrate, which remains largely within the lamina propria (8, 12). Furthermore, neuromuscular dysfunction may persist after mucosal inflammation has subsided (5). These observations suggest that mediators of neuromuscular dysfunction are produced locally within the deeper neuromuscular layers of the intestinal wall.

Several studies have provided evidence that cytokines are important mediators of neuromuscular dysfunction in the inflamed intestine (13, 14, 28, 30, 39, 46, 50). Although activated mononuclear cells are generally considered to be the primary source of proinflammatory cytokines, findings suggesting that cytokine synthesis in the myenteric plexus does not depend on the presence of immunocytes implicate tissue structural cells as sources of cytokines in the enteric nervous system (ENS) (12). This notion is sustained by the recent finding that intestinal smooth muscle cells are indeed sources of and targets for cytokines such as interleukin (IL)-1beta and IL-6, suggesting a role for these cells as a secondary source of mediators in the amplification and perpetuation of the inflammatory response (36, 37).

However, another cell type is in a strategically much better position to modulate nerve function in the neuromuscular compartment of the gut wall, namely the enteric glial cells (EGC). EGC are closest to the ganglionic neurons, comprising the interface between neurons and extraganglionic cells (17) like smooth muscle cells, fibroblasts, or resident macrophages, which have recently been described in the rat intestinal muscularis (35). Although EGC have been known for more than a century (reviewed in Ref. 49), little is known about their functional role in the ENS, particularly during intestinal inflammation.

This lack of knowledge is even more evident when the glial cells of the ENS and the central nervous system (CNS) are compared. During CNS inflammation cytokine synthesis is detectable long before mononuclear cells have passed the blood-brain barrier, and there is evidence that cytokine synthesis by resident CNS cells is essential for the attraction of immunocytes and enables them to pass the blood-brain barrier. So far, two different types of glial cells have been demonstrated to produce cytokines in the CNS, namely, astrocytes (15) and microglia (19, 20). The cytokine whose synthesis has gained the highest attention is IL-6, and IL-6 production by CNS astrocytes has been demonstrated in response to a vast array of stimuli, including IL-1beta , IL-6, tumor necrosis factor (TNF)-alpha , and cAMP (6, 7, 22, 23, 51, 52, 55).

In view of the potential of CNS astrocytes to synthesize IL-6, we designed the present study to investigate whether this capacity is shared by glial fibrillary acidic protein (GFAP)-positive EGC. Because the understanding of the physiological properties of specific cell types is greatly facilitated by the ability to study purified populations of these cells in vitro, we have developed a procedure that allows us to culture EGC without contamination by other cell types (45, 47). Using this approach, we have found evidence that EGC are a potential source of cytokines in the myenteric plexus and that cytokine production by EGC can be regulated by cytokines. These findings strongly support the contention that EGC play a key role in the immunomodulation of enteric nerve function.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Materials

DMEM, FBS, and horse serum were purchased from Life Technologies Gibco (Karlsruhe, Germany); Hanks' balanced salt solution (HBSS), HEPES, antibiotic-antimycotic solution, trypsin, cytosine arabinoside (Ara-C), forskolin, Triton X-100, bovine serum albumin (BSA), 3,3'-diaminobenzidine tetrahydrochloride (DAB), and peroxidase-antiperoxidase complex (PAP) from Sigma-Aldrich (Deisenhofen, Germany); and bovine pituitary extract (BPE) from Linaris (Wertheim, Germany). Polyclonal rabbit anti-cow antibodies directed against GFAP and S-100 and horseradish peroxidase (HRP)-conjugated goat anti-rabbit Ig were supplied by Dako (Hamburg, Germany). Dispase was from Boehringer Mannheim Biochemica, and murine monoclonal anti-CD 90 (mouse anti-rat Thy-1.1; MRC OX-7), HRP-conjugated goat anti-mouse Ig, and preimmune sera used for controls were purchased from Camon-Serotec (Wiesbaden, Germany). Guinea pig complement was obtained from Biozol (Eching, Germany). Rat recombinant (rr) IL-1beta and TNF-alpha and human recombinant (hr) IL-1 receptor antagonist (IRAP) were from R&D Systems (Wiesbaden, Germany); and rrIL-6 was from PeproTech (London, UK). Primers were from Eurogentec (Seraing, Belgium).

Preparation of EGC Cultures

Primary cultures of enteric glia were generated from enzymatically dissociated preparations of rat longitudinal muscle-myenteric plexus preparations as previously described (47). Briefly, the entire jejunum was taken from adult male Sprague-Dawley rats (180-200 g) under sterile conditions and divided into segments ~4-6 cm in length that were opened along the mesentery and pinned flat with the serosal side up. Under a Leitz dissection microscope, the myenteric plexus with the longitudinal muscle layer attached was gently peeled off the underlying circular muscle using a pair of fine dissection forceps, cut into pieces of ~5 mm, and placed into 6 U/ml dispase in DMEM at 37°C for 30-60 min. Dissociated cells were plated into T-75 flasks and maintained in DMEM supplemented with 10% FBS, 1% antibiotic-antimycotic solution, and the antimitotic agent Ara-C at a concentration of 10-5 M. After 2 wk, Ara-C was replaced by BPE (500 µg/ml) and forskolin (1 µM) (34). After ~3-4 wk, cultures had grown to near confluence and the cells were dislodged from their substrate using 0.125% trypsin. To lyse potentially contaminating fibroblasts, suspended cells were treated with a 1:100 dilution of the monoclonal mouse anti-rat Thy-1.1 antibody at 37°C for 30 min. Thereafter, cells were incubated with a 1:50 dilution of guinea pig complement at 37°C for 20 min. Finally, cells were thoroughly washed in HBSS and replated into T-75 flasks. Forskolin and BPE were added to culture media until cultures had once again grown to confluence; subsequently, these supplements were omitted from the culture media.

Immunocytochemistry

Cultured cells were morphologically and immunocytochemically characterized. Morphological assessment was performed by phase-contrast microscopy. To further identify EGC and to exclude contamination with other cell types, tissue cultures were stained with polyclonal antibodies directed against GFAP and S-100, respectively, and a monoclonal antibody directed against Thy-1.1. GFAP is a cytoskeletal intermediate filament protein, whereas S-100 is an intracellular acidic protein that binds Ca2+ and belongs to a family of calcium-binding proteins (11). In the gastrointestinal tract, both GFAP and S-100 are considered to be specific markers of glial cells (16, 31). Thy-1.1 is an epitope present on the surface of rodent myofibroblasts (2, 9). For immunohistochemistry, EGC were plated onto 22-mm2 glass coverslips, placed into tissue culture dishes, and grown to subconfluence. All immunostaining procedures were performed at room temperature.

For GFAP and Thy-1.1 immunolabeling, cultures were fixed in acid ethanol and blocked with 5% horse serum in PBS for 30 min. Subsequently, they were incubated with rabbit anti-GFAP antibody (1:200 dilution) or murine monoclonal anti-CD90 antibody (MRC OX-7; 1:100 dilution) for 60 min, thoroughly washed in PBS, and incubated with HRP-conjugated goat anti-rabbit Ig (1:500 dilution) or HRP-conjugated goat anti-mouse Ig (1:500 dilution), respectively, for a further 60 min. After another washing step, PAP (1:150 dilution) was added for 30 min. Finally, DAB (1 mg/ml) made up freshly in PBS with 0.01% H2O2 was added to the rinsed coverslips for 3-15 min, during which time color development was visually controlled. For S-100 immunolabeling, cultures were fixed in 4% paraformaldehyde for 10 min followed by treatment with methanol at -20°C for 10 min. The subsequent steps were identical to the GFAP immunolabeling protocol, except that anti-S-100 antibody (1:200 dilution) was used as primary antibody. Negative controls using preimmune rabbit or mouse serum, respectively, and the relevant secondary antibodies were included in all experiments. A nuclear hematoxylin counterstain was added after immunolabeling if required. After completion of the staining procedures, coverslips were mounted on glass slides and examined with ×10, ×20, or ×40 objectives on a Zeiss microscope.

Assessment of IL-6 Production by EGC

Stimulation protocols. To investigate whether EGC can synthesize IL-6, EGC were plated into T-75 flasks and grown to subconfluence. Growth medium was changed twice weekly and 24 h before the experiments. At the beginning of each experiment, medium was removed and cultures were carefully washed. DMEM supplemented with 10% FBS and the required concentration of rrIL-1beta , rrTNF-alpha , or rrIL-6 was then added to the cells. Control cells were incubated with DMEM plus 10% FBS. A series of control experiments was performed in which the cytokines were heat inactivated by vigorous boiling for 20 min.

RNA extraction and IL-6 RT-PCR. After stimulation of the cells, total cellular RNA was harvested using a kit based on the phenol-chloroform extraction procedure followed by RNA precipitation with isopropanol (Fast RNA Green Kit; Oncor Appligene, Heidelberg, Germany). The yield of RNA was quantitated spectrophotometrically by absorption at 260 nm. The quality of RNA was checked by formaldehyde agarose gel electrophoresis.

Synthesis of full-length cDNA templates for RT-PCR was performed at 37°C for 60 min after RNA samples had been denatured at 65°C for 10 min. For reverse transcription we used glassified reaction mixes made up from Not I-(dT)18 primer, M-MuLV reverse transcriptase, RNase inhibitor, and nucleotides (Ready-To-Go T-Primed First-Strand Kit; Amersham Pharmacia Biotech, Freiburg, Germany). Semiquantitative PCR amplification of the resulting cDNA was performed using specific primers (10 pmol/µl) for rat IL-6 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as housekeeping gene and a master mix consisting of Taq DNA polymerase and nucleotides in the appropriate buffer system. The master mix was provided in an ambient-temperature-stable reaction bead (Ready-To-Go PCR Beads; Amersham Pharmacia Biotech). The sequence of the forward primer used for IL-6 amplification was 5'GAGGATACCACCCACACCAGACCAGTA 3' (172 bp-198 bp) and of the reverse primer was 5'GGTTTGCCGAGTAGACCTCATAGTGAC 3' (670 bp-696 bp) resulting in a PCR product of 525 bp. IL-6 amplification was performed for 35 cycles with an annealing temperature of 66.5°C. The sequence of the forward primer for GAPDH amplification was 5'ACTGGCGTCTTCACCACCAT (319 bp-338bp) and of the reverse primer 3'TCCACCACCGTGTTGCTGTA (982 bp-1,001 bp), resulting in a PCR product of 683 bp. GAPDH amplification was performed for 26 cycles with an annealing temperature of 68°C. Identical amounts of cDNA were used for IL-6 and the corresponding GAPDH amplifications. Controls using RNA samples without reverse transcription or controls without cDNA were used to demonstrate absence of contaminating DNA. PCR products were analyzed on ethidium bromide-stained 1.5% agarose gels, and densitometry was performed using a Bioprofil 1D image analysis system with Bio-1D V.97 software (Vilbert Lourmat, France).

Measurement of IL-6 protein. After cell stimulation, culture media were sterilely removed and spun at 3,500 rpm for 20 min to obtain cell-free supernatants. These supernatants were frozen and kept at -70°C for further processing but never for more than 2 wk.

Secreted IL-6 concentrations were determined using a well-established bioassay, the B9 assay (1). In this assay, the proliferation rate of IL-6-dependent murine B9 hybridoma cells is evaluated quantitatively after incubation of the cells with test samples. The B9 bioassay is highly sensitive, and IL-6 concentrations as low as 10 pg/ml can be detected (1).

To assay IL-6 concentrations, collected supernatants were thawed and vortexed and serial dilutions of the samples in parallel with IL-6 standards were plated into 96-well plates. Thoroughly washed B9 cells were added to each well at a density of 2.5 × 103 cells/well, and the plates were incubated at 37°C for 72 h. Subsequently, the tetrazolium salt 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; 5 mg/ml dissolved in PBS) was added to each well, and the plates were incubated for a further 4 h (41). After the second incubation period Triton X-100 (10% in 0.5 M HCl) was added to each well, and the plates were left at 37°C until the dark blue color was fully developed. When color development was finished, the plates were read on an ELISA reader using a wavelength of 570 nm. A standard curve of absorbance versus concentration of IL-6 was plotted, and IL-6 bioactivity in the supernatants was determined by comparison with the standard curve and expressed in nanograms per milliliter of supernatant.

In addition to samples and experimental controls, fresh DMEM supplemented with 10% FBS and DMEM supplemented with 10% FBS and 100 ng/ml of hrIL-1beta were tested for their ability to induce proliferation of B9 cells.

Data Expression and Statistical Analysis

After PCR amplification, signal intensity of IL-6 and GAPDH PCR products was quantified densitometrically and relative amounts of IL-6 amplimers were normalized to the values for GAPDH amplimers for each experiment. Ratios of IL-6 amplimers to GAPDH amplimers were expressed as a percentage of control. Each experiment was repeated six times using different cell culture preparations, and the resulting ratios are summarized as means ± SE. Differences between the different experimental groups were analyzed by one-way ANOVA followed by post hoc Scheffé tests.

Variances of IL-6 protein data were stabilized using logarithmic transformation. Transformed data were analyzed by Kruskal-Wallis ANOVA, and post hoc comparisons between groups were done by Mann-Whitney U-test for independent samples. In all analyses, the level of statistical significance was set at P < 0.05.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Morphology and Growth Pattern of Purified EGC In Vitro

Purified cultures of EGC consisted of homogeneous cell populations as evidenced by phase-contrast microscopy and immunohistochemistry (Fig. 1). When subconfluent, EGC typically exhibit a spindle-shaped or stellate morphology. Proliferation continues until stable flat monolayers are formed. Confluent cells are polygonal with indistinct or invisible intercellular borders. Immunohistochemical analyses confirmed that purified cultures were free from contaminating cell types. Although 100% of the cells exhibited strong immunoreactivities for the enteroglial markers GFAP and S-100 (Fig. 1), no immunoreactivity was detectable for the fibroblast marker Thy-1.1.


View larger version (63K):
[in this window]
[in a new window]
 
Fig. 1.   Purified culture of enteric glial cells (EGC) consisting of a homogeneous population of spindle-shaped or stellate cells. Cells were stained with anti-glial fibrillary acidic protein (GFAP). Brightfield micrograph. Scale bar = 40 µm.

IL-6 Production by Cultured EGC

Induction of IL-6 mRNA expression. To assess whether IL-6 transcription can be induced in EGC, subconfluent cells were incubated with rrIL-1beta or rrTNF-alpha at concentrations ranging from 1 to 100 ng/ml for 2, 4, 8, 12, 24 and 48 h. As shown in Fig. 2, there was a minute amount of constitutive IL-6 mRNA expression. Stimulation of EGC with TNF-alpha did not affect IL-6 mRNA expression (data not shown). In contrast, when EGC were stimulated with IL-1beta , a marked upregulation of IL-6 transcription occurred that was time- and concentration dependent (Fig. 2). The maximum increase of IL-6 mRNA expression occurred after 24 h of stimulation with 100 ng/ml of IL-1beta (Fig. 2E). Densitometric analysis of IL-6 mRNA expression after 24 h was performed for six separate experiments and revealed a significant increase after stimulation with IL-1beta at concentrations of 10 (175 ± 32% of control; P < 0.02) and 100 (280 ± 65% of control; P < 0.01) ng/ml (Fig. 3).


View larger version (84K):
[in this window]
[in a new window]
 
Fig. 2.   Induction of interleukin (IL)-6 mRNA expression. Subconfluent EGC were incubated with 0, 1, 10 and 100 ng/ml recombinant rat (rr) IL-1beta . Subsequently, total cellular RNA was harvested and IL-6 mRNA was semiquantitatively assessed by RT-PCR using glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA expression as internal control. PCR products were analyzed on ethidium bromide-stained agarose gels. Stimulation for 2 (A), 4 (B), or 6 (C) h did not affect IL-6 mRNA expression at any concentration. Note that at 2 h in nonstimulated controls, there was a minute amount of constitutive IL-6 mRNA expression. D: 12-h stimulation did not affect IL-6 mRNA expression at 1 ng/ml IL-1beta , but there was an upregulation of IL-6 mRNA expression after stimulation with 10 and 100 ng/ml IL-1beta . E: 24-h stimulation did not affect IL-6 mRNA expression at 1 ng/ml IL-1beta , but there was a marked upregulation of IL-6 mRNA expression after stimulation with 10 and 100 ng/ml IL-1beta . Upregulation of IL-6 mRNA expression was more pronounced after 24 h of stimulation than after 12 h of stimulation. F: 48-h stimulation did not affect IL-6 mRNA expression at 1 ng/ml IL-1beta , but there was an upregulation of IL-6 mRNA expression after stimulation with 10 and 100 ng/ml IL-1beta . Upregulation of IL-6 mRNA expression was less pronounced than after 24 h of stimulation but more pronounced than after 12 h of stimulation.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3.   Effect of IL-1beta on IL-6 mRNA expression. EGC were incubated with rrIL-1beta at a concentration of 1, 10 or 100 ng/ml for 24 h. Total cellular RNA was extracted, and RT-PCR was performed with specific primers for rat IL-6 and GAPDH. PCR products were semiquantified by densitometry after separation on ethidium bromide-stained agarose gels. Relative amounts of IL-6 amplimers were normalized to the values for GAPDH amplimers, and ratios of IL-6 amplimers to GAPDH amplimers were expressed as a percentage of control. Each experiment was repeated 6 times using different cell culture preparations, and the resulting ratios are summarized as means ± SE. *Significantly different from control (P < 0.02).

The level of GAPDH mRNA was unaffected by cytokine stimulation. Over the dose range used in this study, neither TNF-alpha nor IL-1beta affected EGC viability as assessed by morphological appearance, adherence, and trypan blue exclusion.

Effect of IL-1beta on IL-6 protein. To examine whether the observed effects of IL-1beta on IL-6 mRNA expression translated into IL-6 protein synthesis and secretion, purified EGC were incubated with rrIL-1beta at a concentration of 100 ng/ml for 2, 4, 8, 12, and 24 h. After cell stimulation, IL-6 bioactivity in tissue culture supernatants was assessed using the B9 assay. In supernatants from nonstimulated controls, a very small amount of IL-6 bioactivity was detectable, probably reflecting basal secretion of IL-6 (0.33 ± 1.1 ng/ml). After 12 h of stimulation detectable IL-6 bioactivity was raised to 29.2 ± 12.6 ng/ml (P < 0.01 compared with control), and after 24 h IL-6 bioactivity in the supernatants was 107.7 ± 32.6 ng/ml (P < 0.01) (Fig. 4).


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 4.   Effect of IL-1beta on IL-6 protein. EGC were incubated with rrIL-1beta at a concentration of 100 ng/ml for 2, 4, 8, 12 and 24 h. Subsequently, IL-6 bioactivity was assessed in cell-free tissue culture supernatants using the B9 assay. The results from 6 separate experiments with different cell culture preparations are summarized as means ± SE. *Significantly different from control (P < 0.01).

Specificity of action of IL-1beta . Another set of experiments was performed to investigate whether the observed effects of IL-1beta on IL-6 production were receptor mediated. Preincubation of EGC with a specific IRAP at a concentration of 10 µg/ml for 30 min completely blocked the effects of subsequent stimulation with IL-1beta (10 ng/ml) (110 ± 36% of control), indicating that these effects are receptor mediated (Fig. 5). IRAP alone did not significantly affect IL-6 transcription (80 ± 42% of control; Fig. 5).


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 5.   The effect of IL-1beta is receptor mediated. EGC were preincubated with or without 10 µg/ml IL-1 receptor antagonist (IRAP) for 30 min followed by stimulation with or without 10 ng/ml IL-1beta for 24 h. After stimulation, total cellular RNA was extracted and RT-PCR was performed with specific primers for rat IL-6 and GAPDH. PCR products were semiquantified by densitometry after separation on ethidium bromide-stained agarose gels. Relative amounts of IL-6 amplimers were normalized to the values for GAPDH amplimers, and ratios of IL-6 amplimers to GAPDH amplimers were expressed as a percentage of control. Experiments were repeated 6 times using different cell culture preparations, and the resulting ratios are summarized as means ± SE. *Significantly different from control (P < 0.05).

In another set of control experiments, IL-1beta was heat inactivated by vigorous boiling for 20 min. Subsequent stimulation of EGC showed that the effects of IL-1beta on IL-6 production were heat sensitive and were completely abolished after boiling of the cytokine. After stimulation with preboiled IL-1beta , detectable IL-6 bioactivity was 3.5 ± 2.8 ng/ml (Fig. 6).


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 6.   The effect of IL-1beta is heat sensitive. EGC were incubated with 10 ng/ml rrIL-1beta for 24 h. Subsequently, IL-6 bioactivity was assessed in cell-free tissue culture supernatants using the B9 assay. In parallel, cells were incubated with the same amount of rrIL-1beta that had been heat inactivated by vigorous boiling for 20 min. The results from 6 separate experiments with different cell culture preparations are summarized and expressed as means ± SE. *Significantly different from control (P < 0.02); **significantly different from cells after stimulation with IL-1beta (P < 0.01).

Autoregulation of IL-6 expression. In contrast to the upregulation of IL-6 mRNA expression that occurred after stimulation of EGC with exogenous IL-1beta , there was a dose-dependent inhibition of IL-6 expression when cells were incubated with exogenous IL-6 for 24 h (Fig. 7). IL-6 significantly suppressed IL-6 mRNA expression in concentrations as low as 1 ng/ml (80 ± 2.5% of control; P < 0.05). This effect was more pronounced with higher cytokine concentrations, reaching a maximum after stimulation with 100 ng/ml of IL-6, which suppressed IL-6 mRNA expression to 57 ± 13% of control (P < 0.01; Fig. 7).


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 7.   Autoinhibition of IL-6 expression. EGC were incubated with rrIL-6 at a concentration of 1, 10 or 100 ng/ml for 24 h. Total cellular RNA was extracted and RT-PCR performed with specific primers for rat IL-6 and GAPDH. PCR products were semiquantified by densitometry after separation on ethidium bromide-stained agarose gels. Relative amounts of IL-6 amplimers were normalized to the values for GAPDH amplimers, and ratios of IL-6 amplimers to GAPDH amplimers were expressed as a percentage of control. Each experiment was repeated 6 times using different cell culture preparations, and the resulting ratios are summarized as means ± SE. *Significantly different from control (P < 0.05).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We present evidence here that EGC are a potential source of cytokines in the myenteric plexus and that cytokine production by EGC can be regulated by cytokines. These findings strongly support the contention that EGC play a key role in the immunomodulation of enteric nerve function. Specifically, we have demonstrated that EGC from rat myenteric plexus produce the proinflammatory cytokine IL-6 and that this is regulated by the proinflammatory cytokines IL-beta and IL-6 but not TNF-alpha .

To assess the ability of EGC to produce cytokines, we have used a novel tissue culture technique yielding purified cultures of EGC from the myenteric plexus of adult rat intestine (45, 47). We have chosen to study the immunophysiological properties of EGC from adult tissues because this approach may offer several advantages over embryonic or newborn tissues. Because the effect of development in an artificial environment should be minimized in such cultures, findings in cultures derived from mature intestine may be more directly comparable with adult tissue (48). This implies a clear superiority of such cultures for our purposes because the investigation of enteroglial immunophysiology is relevant for inflammatory bowel disease (IBD), which occurs mostly in adolescent or adult intestine. Furthermore, adult tissues tend to be more readily available and are more easily handled experimentally.

EGC cultures were purified by a combination of the antimitotic agent Ara-C and complement-mediated cell lysis (47). This procedure provides tissue cultures consisting of homogeneous populations of distinctive stellate or spindle-shaped cells that were morphologically assessed as EGC. Lineage and purity of the cells were further ascertained by immunohistochemistry using antibodies directed against GFAP and S-100, which in the gastrointestinal tract are considered to be specific markers of glial cells (16, 31). Cultures containing typical EGC as predicted by morphology showed 100% positive staining with both antibodies, supporting the notion that we have raised pure EGC populations.

This purity allows for the first time the use of EGC for experimentation with subsequent molecular and biochemical analyses of cell products and hence offers the opportunity to study the role of EGC in the inflammatory response of the neuromuscular compartment of the gut wall. A recent study in transgenic mice found that ablation of enteric glia is followed by fulminant jejunoileitis, implicating these cells in the maintenance of small bowel structure and function (10). Nevertheless, the immunophysiological properties of enteric glia and their contribution to the development and propagation of IBD are not well understood. Enteric glia resembles central nervous system astroglia in its anatomic relationships to neurons and shares the expression of a number of antigens with astrocytes and non-myelin-forming Schwann cells of the peripheral nervous system (16, 31-33). These anatomic and molecular similarities suggest that enteric glia, astrocytes, and nonmyelinating Schwann cells may share common functions. Astrocytes both produce and respond to a variety of cytokines and have long been implicated in an array of immunological processes within the CNS (42). However, because there are fundamental differences between the CNS and ENS in terms of anatomic composition and overall function, cellular functions may be significantly different between CNS and ENS glia despite morphological similarities. Compared with published data on astrocytes, our findings in EGC suggest both functional similarities and significant differences between astrocytes and EGC.

Studying IL-6 expression in isolated and purified EGC, we have found that stimulation of these cells with TNF-alpha did not affect IL-6 transcription, whereas stimulation with IL-1beta resulted in a marked time- and concentration-dependent upregulation with a maximum increase after 24 h of stimulation. Assessment of IL-6 bioactivity in tissue culture supernatants confirmed that augmented IL-6 mRNA expression is translated into IL-6 protein synthesis and secretion with corresponding time courses.

In the CNS, astrocytes synthesize IL-6 in response to stimulation with IL-1beta but, in contrast to enteric glia, also in response to TNF-alpha (7, 43, 52). Moreover, IL-6 stimulates its own expression in astrocytes (53), whereas we have found a significant and dose-dependent inhibition of IL-6 expression when cells were incubated with exogenous IL-6, providing evidence for a feedback inhibition of IL-6 production in enteric glia. This feedback inhibition may play a crucial role in the regulation of inflammatory processes in the ENS and may provide a functional basis for the postulated anti-inflammatory potential of EGC (10).

In astrocytes, IL-1beta effects are receptor mediated (4, 25). Similarly, our data provide functional evidence for IL-1 receptors on EGC because IL-1beta -induced IL-6 expression could be inhibited by a specific IL-1 receptor antagonist. The heat sensitivity of the recombinant cytokine effects proves that the actions of IL-1beta and IL-6 are not attributable to endotoxin or other heat-resistant bacterial contaminants.

The physiological consequences of IL-6 production by EGC are as yet unknown. In the CNS, the function of this cytokine is complex; IL-6 exerts neurotrophic and neuroprotective effects (23, 52), but it can also function as a mediator of inflammation, demyelination, and astrogliosis, depending on the cellular context (23, 40, 51, 52, 55). Studies in IL-6-deficient mice have demonstrated that IL-6 is crucial for the recruitment of inflammatory cells and activation of glial cells after brain injury with disruption of the blood brain barrier (44). However, in the same model it was demonstrated that IL-6 is important for neuroprotection and may facilitate nerve regeneration (44).

In the intestine, proinflammatory cytokines have been demonstrated to play a key role in the pathogenesis of IBD. Specifically, a role for IL-6 in the pathogenesis of Crohn's disease has been repeatedly demonstrated (21, 29). Elevation of local IL-6 activity may be a characteristic feature of active IBD, and macrophages and colonic epithelial cells have been implicated as the major cell types responsible for this phenomenon in the mucosa of patients with chronic intestinal inflammation (27, 38). Recently, a crucial role for IL-6 in the pathogenesis of murine colitis has been suggested, and anti-IL-6 receptor monoclonal antibody therapy has been proposed for treatment of human Crohn's disease (56). In another recent report, the mechanisms by which IL-6 may contribute to the perpetuation of chronic intestinal inflammation have been further elucidated because it was demonstrated that IL-6 mediates resistance of T cells to apoptosis in Crohn's disease (3).

On the basis of these observations, we propose that enteric glia is involved in the immune response in the neuromuscular compartment of the gut wall by production of IL-6. It has been demonstrated that IL-6 levels in the neuromuscular layers of the uninflamed intestine wall are low (37), whereas elevated expression occurs in infection and inflammation (12, 37). The observation that there is constitutive expression of inflammatory cytokines in the absence of an inflammatory infiltrate argues for the existence of a tissue-resident source of cytokines. Furthermore, in most animal models of intestinal inflammation, the inflammatory infiltrate originates in the mucosa and lamina propria and does not penetrate the myenteric plexus. Nevertheless, intestinal inflammation is accompanied by marked neuromuscular dysfunction (12, 54). Because it has been demonstrated that cytokines alter myenteric neural function (14, 28, 46), inflammation-associated neuromuscular dysfunction can be assumed to reflect a cascade of events involving the induction and release of cytokines within the plexus. The question emerges as to the origin of these cytokines in the myenteric plexus. Although other cell types have also been proposed to play a role in immune processes in the neuromuscular layers of the gut wall and to modify the immunological environment (8, 26, 36), EGC could nevertheless be the most strategic cell type for the amplification and perpetuation of the inflammatory response in the ENS because of their close anatomic association with enteric neurons and their location at the edge of the plexus ganglia, which provide them with features of a putative interface between the various extraganglionic cells and intraganglionic neurons (18).

In summary, we have provided evidence that EGC produce the proinflammatory cytokine IL-6 using purified primary cultures of EGC from adult rat myenteric plexus. On the basis of these findings, we propose that activated enteric glia may be the predominant source of IL-6 in the ENS, contributing to the amplification and perpetuation of the inflammatory response of the neuromuscular compartment of the gut wall.


    ACKNOWLEDGEMENTS

We thank Jane Anne Schroeder for expert technical help with the B9 bioassay and Dr. J. Gauldie, Dept. of Pathology, McMaster University, for the B9 hybridoma cells.


    FOOTNOTES

This work was supported by the Deutsche Forschungsgemeinschaft (Ru 528/5).

Address for reprint requests and other correspondence: A. Rühl, Innere Medizin IV, Universitätsklinikum, Bergheimer Str. 58, D-69115 Heidelberg (E-mail: anne.ruehl{at}med.uni-heidelberg.de).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 5 November 2000; accepted in final form 22 January 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Aarden, LA, De Groot ER, Schaap OL, and Lansdorp PM. Production of hybridoma growth factor by human monocytes. Eur J Immunol 17: 1411-1416, 1987[Web of Science][Medline].

2.   Assouline, JG, Bosch EP, and Lim R. Purification of rat Schwann cells from cultures of peripheral nerve: an immunoselective method using surfaces coated with anti-immunoglobulin antibodies. Brain Res 277: 389-392, 1983[Web of Science][Medline].

3.   Atreya, R, Mudter J, Finotto S, Mullberg J, Jostock T, Wirtz S, Schutz M, Bartsch B, Holtmann M, Becker C, Strand D, Czaja J, Schlaak JF, Lehr HA, Autschbach F, Schurmann G, Nishimoto N, Yoshizaki K, Ito H, Kishimoto T, Galle PR, Rose-John S, and Neurath MF. Blockade of interleukin 6 trans signaling suppresses T-cell resistance against apoptosis in chronic intestinal inflammation: evidence in Crohn disease and experimental colitis in vivo. Nat Med 6: 583-588, 2000[Web of Science][Medline].

4.   Ban, EM, Sarlieve LL, and Haour FG. Interleukin-1 binding sites on astrocytes. Neuroscience 52: 725-733, 1993[Web of Science][Medline].

5.   Barbara, G, Vallance BA, and Collins SM. Persistent intestinal neuromuscular dysfunction after acute nematode infection in mice. Gastroenterology 113: 1224-1232, 1997[Web of Science][Medline].

6.   Benveniste, EN. Inflammatory cytokines within the central nervous system: sources, function, and mechanism of action. Am J Physiol Cell Physiol 263: C1-C16, 1992[Abstract/Free Full Text].

7.   Benveniste, EN, Sparacio SM, Norris JG, Grenett HE, and Fuller GM. Induction and regulation of interleukin-6 gene expression in rat astrocytes. J Neuroimmunol 30: 201-212, 1990[Web of Science][Medline].

8.   Berezin, I, Huizinga JD, and Collins SM. Structural relationships between immune cells and longitudinal muscle during a Trichinella spiralis infection in the rat intestine. Neurogastroenterol Motil 11: 179-192, 1999[Web of Science][Medline].

9.   Brockes, JP, Fields KL, and Raff MC. A surface antigenic marker for rat Schwann cells. Nature 266: 364-366, 1977[Medline].

10.   Bush, TG, Savidge TC, Freeman TC, Cox HJ, Campbell EA, Mucke L, Johnson MH, and Sofroniew MV. Fulminant jejuno-ileitis following ablation of enteric glia in adult transgenic mice. Cell 93: 189-201, 1998[Web of Science][Medline].

11.   Calissano, P, Moore BW, and Friesen A. Effect of calcium ion on S-100, a protein of the nervous system. Biochemistry 8: 4318-4326, 1969[Medline].

12.   Collins, SM. The immunomodulation of enteric neuromuscular function: implications for motility and inflammatory disorders. Gastroenterology 111: 1683-1699, 1996[Web of Science][Medline].

13.   Collins, SM, Blennerhassett PA, Blennerhassett MG, and Vermillion DL. Impaired acetylcholine release from the myenteric plexus of Trichinella-infected rats. Am J Physiol Gastrointest Liver Physiol 257: G898-G903, 1989[Abstract/Free Full Text].

14.   Collins, SM, Hurst SM, Main C, Stanley E, Khan I, Blennerhassett P, and Swain M. Effect of inflammation of enteric nerves. Cytokine-induced changes in neurotransmitter content and release. Ann NY Acad Sci 664: 415-424, 1992[Web of Science][Medline].

15.   Eddleston, M, and Mucke L. Molecular profile of reactive astrocytes---implications for their role in neurologic disease. Neuroscience 54: 15-36, 1993[Web of Science][Medline].

16.   Ferri, GL, Probert L, Cocchia D, Michetti F, Marangos PJ, and Polak JM. Evidence for the presence of S-100 protein in the glial component of the human enteric nervous system. Nature 297: 409-410, 1982[Medline].

17.   Gabella, G. Ultrastructure of the nerve plexuses of the mammalian intestine: the enteric glial cells. Neuroscience 6: 425-436, 1981[Web of Science][Medline].

18.   Gershon, MD, and Bursztajn S. Properties of the enteric nervous system: limitation of access of intravascular macromolecules to the myenteric plexus and muscularis externa. J Comp Neurol 180: 467-488, 1978[Web of Science][Medline].

19.   Giulian, D. Ameboid microglia as effectors of inflammation in the central nervous system. J Neurosci Res 18: 155-153, 1987[Web of Science][Medline].

20.   Giulian, D, Baker TJ, Shih LC, and Lachman LB. Interleukin 1 of the central nervous system is produced by ameboid microglia. J Exp Med 164: 594-604, 1986[Abstract/Free Full Text].

21.   Gross, V, Andus T, Caesar I, Roth M, and Scholmerich J. Evidence for continuous stimulation of interleukin-6 production in Crohn's disease. Gastroenterology 102: 514-519, 1992[Web of Science][Medline].

22.   Hama, T, Kushima Y, Miyamoto M, Kubota M, Takei N, and Hatanaka H. Interleukin-6 improves the survival of mesencephalic catecholaminergic and septal cholinergic neurons from postnatal, two-week-old rats in cultures. Neuroscience 40: 445-452, 1991[Web of Science][Medline].

23.   Hama, T, Miyamoto M, Tsukui H, Nishio C, and Hatanaka H. Interleukin-6 as a neurotrophic factor for promoting the survival of cultured basal forebrain cholinergic neurons from postnatal rats. Neurosci Lett 104: 340-344, 1989[Web of Science][Medline].

25.   Hammond, EA, Smart D, Toulmond S, Suman-Chauhan N, Hughes J, and Hall MD. The interleukin-1 type I receptor is expressed in human hypothalamus. Brain 122: 1697-1707, 1999[Abstract/Free Full Text].

26.   Hogaboam, CM, Snider DP, and Collins SM. Cytokine modulation of T-lymphocyte activation by intestinal smooth muscle cells. Gastroenterology 112: 1986-1995, 1997[Web of Science][Medline].

27.   Hosokawa, T, Kusugami K, Ina K, Ando T, Shinoda M, Imada A, Ohsuga M, Sakai T, Matsuura T, Ito K, and Kaneshiro K. Interleukin-6 and soluble interleukin-6 receptor in the colonic mucosa of inflammatory bowel disease. J Gastroenterol Hepatol 14: 987-996, 1999[Web of Science][Medline].

28.   Hurst, S, and Collins SM. Interleukin-1beta modulation of norepinephrine release from rat myenteric nerves. Am J Physiol Gastrointest Liver Physiol 264: G30-G35, 1993[Abstract/Free Full Text].

29.   Hyams, JS, Fitzgerald JE, Treem WR, Wyzga N, and Kreutzer DL. Relationship of functional and antigenic interleukin 6 to disease activity in inflammatory bowel disease. Gastroenterology 104: 1285-1292, 1993[Web of Science][Medline].

30.   Jacobson, K, McHugh K, and Collins SM. The mechanism of altered neural function in a rat model of acute colitis. Gastroenterology 112: 156-162, 1997[Web of Science][Medline].

31.   Jessen, KR, and Mirsky R. Glial cells in the enteric nervous system contain glial fibrillary acidic protein. Nature 286: 736-737, 1980[Medline].

32.   Jessen, KR, and Mirsky R. Astrocyte-like glia in the peripheral nervous system: an immunohistochemical study of enteric glia. J Neurosci 3: 2206-2218, 1983[Abstract].

33.   Jessen, KR, and Mirsky R. Glial fibrillary acidic polypeptides in peripheral glia. Molecular weight, heterogeneity and distribution. J Neuroimmunol 8: 377-393, 1985[Web of Science][Medline].

34.   Jessen, KR, and Mirsky R. Schwann cell precursors and their development. Glia 4: 185-194, 1991[Web of Science][Medline].

35.   Kalff, JC, Schwarz NT, Walgenbach KJ, Schraut WH, and Bauer AJ. Leukocytes of the intestinal muscularis: their phenotype and isolation. J Leukoc Biol 63: 683-691, 1998[Abstract].

36.   Khan, I, Blennerhassett MG, Kataeva GV, and Collins SM. Interleukin 1beta induces the expression of interleukin 6 in rat intestinal smooth muscle cells. Gastroenterology 108: 1720-1728, 1995[Web of Science][Medline].

37.   Khan, I, and Collins SM. Expression of cytokines in the longitudinal muscle myenteric plexus of the inflamed intestine of rat. Gastroenterology 107: 691-700, 1994[Web of Science][Medline].

38.   Kusugami, K, Fukatsu A, Tanimoto M, Shinoda M, Haruta J, Kuroiwa A, Ina K, Kanayama K, Ando T, and Matsuura T. Elevation of interleukin-6 in inflammatory bowel disease is macrophage- and epithelial cell-dependent. Dig Dis Sci 40: 949-959, 1995[Web of Science][Medline].

39.   Main, C, Blennerhassett P, and Collins SM. Human recombinant interleukin 1beta suppresses acetylcholine release from rat myenteric plexus. Gastroenterology 104: 1648-1654, 1993[Web of Science][Medline].

40.   Merrill, JE, and Benveniste EN. Cytokines in inflammatory brain lesions: helpful and harmful. Trends Neurosci 19: 331-338, 1996[Web of Science][Medline].

41.   Mosmann, T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 65: 55-63, 1983[Web of Science][Medline].

42.   Mucke, L, and Eddleston M. Astrocytes in infectious and immune-mediated diseases of the central nervous system. FASEB J 7: 1226-1232, 1993[Abstract].

43.   Norris, JG, Tang LP, Sparacio SM, and Benveniste EN. Signal transduction pathways mediating astrocyte IL-6 induction by IL-1beta and tumor necrosis factor-alpha . J Immunol 152: 841-850, 1994[Abstract].

44.   Penkowa, M, Moos T, Carrasco J, Hadberg H, Molinero A, Bluethmann H, and Hidalgo J. Strongly compromised inflammatory response to brain injury in interleukin-6-deficient mice. Glia 25: 343-357, 1999[Web of Science][Medline].

45.   Rühl, A, Denefleh B, and Stremmel W. Isolation and characterization of immortalized enteroglial cell lines from the myenteric plexus of adult rat (Abstract). Gastroenterology 114: A1072, 1998.

46.   Rühl, A, Hurst S, and Collins SM. Synergism between interleukins 1beta and 6 on noradrenergic nerves in rat myenteric plexus. Gastroenterology 107: 993-1001, 1994[Web of Science][Medline].

47.   Rühl, A, Trotter J, and Stremmel W. Isolation of enteric glia and establishment of transformed enteroglial cell lines from the myenteric plexus of adult rat. Neurogastroenterol Motil 13: 95-106, 2001[Web of Science][Medline].

48.   Schäfer, KH, and Mestres P. Human newborn and adult myenteric plexus grows in different patterns. Cell Mol Biol 43: 1171-1180, 1997.

49.   Stöhr, P. Zusammenfassende Ergebnisse über die mikroskopische Innervation des Magen-Darmkanals. Ergebn Anat Entwick 34: 250-401, 1952.

50.   Swain, MG, Blennerhassett PA, and Collins SM. Impaired sympathetic nerve function in the inflamed rat intestine. Gastroenterology 100: 675-682, 1991[Web of Science][Medline].

51.   Tilg, H, Dinarello CA, and Mier JW. IL-6 and APPs: anti-inflammatory and immunosuppressive mediators. Immunol Today 18: 428-432, 1997[Web of Science][Medline].

52.   Van Wagoner, NJ, and Benveniste EN. Interleukin-6 expression and regulation in astrocytes. J Neuroimmunol 100: 124-139, 1999[Web of Science][Medline].

53.   Van Wagoner, NJ, Oh JW, Repovic P, and Benveniste EN. Interleukin-6 (IL-6) production by astrocytes: autocrine regulation by IL-6 and the soluble IL-6 receptor. J Neurosci 19: 5236-5244, 1999[Abstract/Free Full Text].

54.   Vermillion, DL, Huizinga JD, Riddell RH, and Collins SM. Altered small intestinal smooth muscle function in Crohn's disease. Gastroenterology 104: 1692-1699, 1993[Web of Science][Medline].

55.   Wagner, JA. Is IL-6 both a cytokine and a neurotrophic factor? J Exp Med 183: 2417-2419, 1996[Free Full Text].

56.   Yamamoto, M, Yoshizaki K, Kishimoto T, and Ito H. IL-6 is required for the development of Th1 cell-mediated murine colitis. J Immunol 164: 4878-4882, 2000[Abstract/Free Full Text].


Am J Physiol Gastrointest Liver Physiol 280(6):G1163-G1171
0193-1857/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. Duncan, A. Mouihate, K. Mackie, C. M. Keenan, N. E. Buckley, J. S. Davison, K. D. Patel, Q. J. Pittman, and K. A. Sharkey
Cannabinoid CB2 receptors in the enteric nervous system modulate gastrointestinal contractility in lipopolysaccharide-treated rats
Am J Physiol Gastrointest Liver Physiol, July 1, 2008; 295(1): G78 - G87.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. Neunlist, P. Aubert, S. Bonnaud, L. Van Landeghem, E. Coron, T. Wedel, P. Naveilhan, A. Ruhl, B. Lardeux, T. Savidge, et al.
Enteric glia inhibit intestinal epithelial cell proliferation partly through a TGF-beta1-dependent pathway
Am J Physiol Gastrointest Liver Physiol, January 1, 2007; 292(1): G231 - G241.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
C. L. Green, W. Ho, K. A. Sharkey, and D. M. McKay
Dextran sodium sulfate-induced colitis reveals nicotinic modulation of ion transport via iNOS-derived NO
Am J Physiol Gastrointest Liver Physiol, September 1, 2004; 287(3): G706 - G714.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rühl, A.
Right arrow Articles by Stremmel, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rühl, A.
Right arrow Articles by Stremmel, W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online