|
|
||||||||
1 Department of Veterans Affairs Medical Center, Long Beach 90822; and Departments of 2 Medicine, 3 Physiology/Biophysics, and 4 Neurobiology and Behavior, University of California, Irvine, California 92697
| |
ABSTRACT |
|---|
|
|
|---|
The major cellular pathway for uptake of the vitamin folic acid, including its absorption in the intestine, is via a plasma membrane carrier system, the reduced folate carrier (RFC). Very little is known about the mechanisms that control intracellular trafficking and plasma membrane targeting of RFC. To begin addressing these issues, we used Xenopus oocyte as a model system and examined whether the signal that targets the protein to the plasma membrane is located in the COOH-terminal cytoplasmic tail or in the backbone of the polypeptide. We also examined the role of microtubules and microfilaments in intracellular trafficking of the protein. Confocal imaging of human RFC (hRFC) fused to the enhanced green fluorescent protein (hRFC-EGFP) showed that the protein was expressed at the plasma membrane, with expression confined almost entirely to the animal pole of the oocyte. Localization of hRFC at the plasma membrane was not affected by partial or total truncation of the COOH-terminal tail of the polypeptide, whereas a construct of the cytoplasmic tail fused to EGFP was not found at the plasma membrane. Disruption of microtubules, but not microfilaments, prevented hRFC expression at the plasma membrane. These results demonstrate that the molecular determinant(s) that directs plasma membrane targeting of hRFC is located within the backbone of the polypeptide and that intact microtubules, but not microfilaments, are essential for intracellular trafficking of the protein.
folate membrane transporter; cell biology
| |
INTRODUCTION |
|---|
|
|
|---|
THE COENZYME DERIVATIVES of folic acid are necessary for the synthesis of purine and pyrimidine precursors of nucleic acids, the metabolism of certain amino acids, and initiation of protein synthesis in mitochondria (3, 40). Mammals cannot synthesize folate and must obtain the vitamin from exogenous sources via intestinal absorption followed by distribution to different cell types. The major pathway for cellular uptake of folate (including its absorption in the small intestine) occurs via a specialized plasma membrane carrier system (24, 35-37) identified as the reduced folate carrier (RFC) (8, 27, 29, 44, 45). To date, RFCs have been cloned from several species including human (27, 29, 45), mouse (8), hamster (44), and rat (S. A. Rubin, Dept. of Medicine, Univ. of California at Los Angeles, Los Angeles, CA; GenBank accession no. U38180) and have been shown to be integral membrane proteins with 12 predicted transmembrane domains (12, 37). The human RFC (hRFC) protein has 591 amino acids with a long (139 amino acids) cytoplasmic COOH-terminal tail (12, 37). Functional identity of the cloned RFCs has been confirmed by expression in mammalian cells (12, 20, 37, 43) and Xenopus oocytes (20).
In contrast to our knowledge of the molecular identity, functional properties, and distribution of the RFC uptake system, little is known about the mechanisms that control intracellular trafficking and membrane targeting of RFC. Recent studies investigating the membrane targeting of a variety of transporters demonstrated the involvement of specific molecular determinants (motifs/residues, e.g., tyrosine/leucine) responsible for guiding their delivery to the plasma membrane (4, 5, 25). In many cases, these motifs/residues are located within the COOH-terminal cytoplasmic tail of the polypeptide (see, e.g., Refs. 19, 23, 28); in other cases, however, the location was found in the backbone sequence of the polypeptide (2, 17, 18). In the case of hRFC, this polypeptide appears to have a number of such candidate targeting signals (e.g., leucine/tyrosine motifs) both within its backbone sequence and within the COOH-terminal cytoplasmic tail. Furthermore, other studies have shown that the cytoskeletal network plays an important role in the intracellular trafficking of membrane transporters to the cell surface (1, 4, 9, 13). Therefore, we were interested in identifying the domains and molecular signals that target hRFC to the plasma membrane and in assessing the role of the cytoskeleton in the intracellular trafficking of hRFC in different cells.
To begin addressing these issues, we sought in the present study to determine the location of the membrane-targeting signal of hRFC to sequence within the long COOH-terminal cytoplasmic tail of the protein or, alternatively, to sequence in the preceding backbone region of the polypeptide. We also determined the role of microtubules and microfilaments in the intracellular trafficking of hRFC. We used the Xenopus oocyte as an in vitro model system, because it faithfully expresses RFC (29) and other exogenous proteins and because of its convenient size and established utility in similar studies with other transporters (10, 14). Our results show that hRFC fused to the enhanced green fluorescent protein (hRFC-EGFP) is functionally expressed at the plasma membrane of Xenopus oocytes, with the majority of expression localized to the animal hemisphere. Deletion of the COOH-terminal cytoplasmic tail did not affect targeting of hRFC to the plasma membrane, whereas a construct of COOH-terminal cytoplasmic tail fused to EGFP was not found at the plasma membrane. These findings suggest that the membrane-targeting signal of hRFC is located in the backbone of the polypeptide. Furthermore, our results show that the intracellular trafficking of hRFC is critically dependent on intact microtubules but not microfilaments.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials. [3',5',7,9-3H(N)]folinic acid (specific activity, 12.7 Ci/mmol) was obtained from Moravek Biochemicals (Brea, CA). Fura red was from Molecular Probes (Eugene, OR). The fluorescent protein constructs [enhanced yellow fluorescent protein (EYFP)-endoplasmic reticulum (ER), EYFP-actin, EGFP-tubulin, and EGFP-aminoterminus (N3)] were from Clontech (Palo Alto, CA). Cytochalasin D and nocodazole were from Calbiochem (La Jolla, CA). All other reagents were obtained from suppliers as outlined previously (29, 31).
Construction of hRFC-EGFP and truncated constructs. The coding region of the full-length hRFC and its truncated constructs were generated by PCR using combinations of the following primers: F1 (5'CCGCTCGAGATGGTGCCCTCCAGCCCAGCG3'), F2 (5'CCGCTCGAGATGGCCTGCGGCACT-GCC3'), R1 (5'CGGGATCCCTGGTTCACATTCTGAACACCG3'), R2 (5'CGGGATCCGGCC-GGGGCCTGGGCCAG3'), and R3 (5'CGGGATCCCAGC-ATGGCCCCCAAGAAGTAG3'). For the full-length hRFC [base pairs (bp) 1-1773, corresponding to amino acids 1-591], primers F1 and R1 were used. For the hRFC construct with a partially truncated COOH-terminal cytoplasmic tail (bp 1-1590, corresponding to amino acids 1-530), primers F1 and R2 were used. For the hRFC construct with total truncation of the COOH-terminal cytoplasmic tail (bp 1-1356, corresponding to amino acids 1-452), primers F1 and R3 were used. We also prepared a construct of the COOH-terminal cytoplasmic tail of the hRFC alone (bp 1357-1773, corresponding to amino acids 452-591) using primers F2 and R1. In all cases, EGFP was fused to the COOH terminus of hRFC. Briefly, the PCR conditions were 94°C for 3 min, followed by 33 cycles of 30 s at 94°C, 30 s at 55°C, and 4 min at 68°C, with a final 10 min at 68°C to yield products of 1,773, 1,590, 1,356, and 417 bp. The PCR products and the EGFP-N3 vector were then digested with BamHI and XhoI, and the products were gel isolated and ligated together, generating in-frame fusion proteins under the control of the human cytomegalovirus promoter. The nucleotide sequence of each construct was confirmed by sequencing (SeqWright, Houston, TX). The amino acid sequence of the resulting constructs is shown schematically in Fig. 4A.
Procurement and nuclear microinjection of Xenopus oocytes. Female adult Xenopus laevis frogs were anesthetized by immersion in 0.1% aqueous solution of 3-aminobenzoic acid ethyl ester (MS-222) for 15 min, and after death by decapitation, whole ovaries were removed. The epithelial layers of stage VI oocytes (11) were removed using watchmakers' forceps, and oocytes were then treated with collagenase (0.5 mg/ml for 30 min) in dissociation solution (in mM: 82.5 NaCl, 2.5 KCl, 10 Na2HPO4, and 5 HEPES, pH 7.8) to ensure complete defolliculation. Oocytes were left to recover for 24 h before microinjection. For expression studies, ~2 ng of plasmid cDNA in 5 nl of intracellular solution (in mM: 140 KCl, 10 HEPES, 3 MgCl2, 1 EGTA, and 0.5 CaCl2, pH 7.3) were injected with a Drummond microinjector into the nucleus of each oocyte. Injected oocytes were separated and maintained in Barth's solution [88 mM NaCl, 1 mM KCl, 2.4 mM NaHCO3, 0.83 mM MgSO4, 0.33 mM Ca(NO3)2, 0.41 mM CaCl2, 10 mM HEPES, 550 mg/l Na pyruvate, and 0.05 mg/ml gentamycin; pH 7.4 at 18°C] with repeated changes of solution at least every 12 h. Additional oocytes from the same donor were injected with ~5 nl of intracellular solution and maintained as parallel controls for viability and uptake assays.
Assay of [3H]folinic acid uptake. With methods reported previously (29), batches of eight oocytes that scored positive for EGFP fluorescence (48-72 h after microinjection) were incubated at room temperature for 1 h in 200 µl of Barth's solution supplemented with 120 nM [3H]folinic acid. Uptake was terminated by addition of 5 ml of ice-cold Barth's solution. Oocytes were transferred individually to scintillation vials and dissolved in 250 µl of 10% SDS before addition of scintillation fluid.
Confocal imaging of hRFC constructs. Oocytes were monitored for hRFC-EGFP expression using a custom-built laser scanning confocal microscope based on an Olympus IX70 inverted microscope fitted with a 40× oil-immersion objective (31). EGFP was excited using the 488-nm line from an argon ion laser, and emitted fluorescence was monitored with a 530 ± 20-nm bandpass filter. Autofluorescence (monitored in mock-injected oocytes) was negligible (<2%) compared with oocytes expressing EGFP-tagged constructs. Confocal images were obtained by scanning the laser scan line either laterally (x-y scans) or axially (x-z scans) within the oocyte. All measurements of EGFP fluorescence were averaged from more than six independent scans in several oocytes from more than three donor frogs, and all results are presented as means ± SE. All fluorescence images were collected at room temperature with the oocytes bathed in Barth's solution.
| |
RESULTS |
|---|
|
|
|---|
Expression of hRFC-EGFP in Xenopus oocytes.
To investigate the targeting of hRFC by the endogenous protein
trafficking mechanisms within Xenopus oocytes, we injected cDNA encoding hRFC-EGFP into the nucleus of stage VI oocytes. Two days
after microinjection, oocytes were imaged by confocal microscopy for
expression of hRFC-EGFP. In all oocytes examined (n = 40 oocytes, 10 donor animals) hRFC-EGFP fluorescence was confined to
the animal hemisphere (Fig.
1A), with an average 15.5 ± 2.5-fold greater peak fluorescence in the animal compared with the
vegetal pole (n = 40 cells, 10 donors). Little, if any,
EGFP fluorescence was detectable in the vegetal hemisphere, as
fluorescent intensities were similar to autofluorescence in the vegetal
hemisphere of mock-injected oocytes maintained as parallel controls
(data not shown). Within the animal hemisphere, hRFC-EGFP expression was confined to a radial band 5.6 ± 1.2 µm wide [full width at half-maximal intensity; n = 40 cells, 10 donors],
consistent with the dimensions of the highly convoluted oocyte plasma
membrane. Furthermore, hRFC-EGFP fluorescence was localized more
superficially than red fluorescence observed with a microinjected
cytosolic marker (fura red, 30 µM), suggesting that the majority of
expressed hRFC-EGFP was targeted to the plasma membrane (Fig.
1B).
|
Distribution of hRFC-EGFP within animal hemisphere.
To image the subcellular distribution of hRFC-EGFP within the animal
hemisphere of the oocyte, we collected lateral
(x-y) confocal images at increasing depths into
the oocyte (Fig. 2A) and
compared this distribution to that observed with an ER-targeted EYFP
construct (EYFP-ER). The fluorescence distribution with each of these
constructs was clearly different (Fig. 2), with the presence of
microvilli and the peripheral localization of hRFC-EGFP within confocal
sections (Figs. 1 and 2) strongly suggesting plasma membrane localization. Most obviously, in oocytes in which surface structure was
well preserved after collagenase treatment, hRFC-EGFP expression was
evident in long microvilli (up to ~10-µm length) projecting superficially from the plasma membrane (Fig. 2A), which
appeared as ~0.5-µm-wide cylinders in cross section (Fig.
2B). The fluorescence signal of hRFC-EGFP became more
uniform within the plasma membrane proper, at which depth ER structure
first became visible (Fig. 2C). Further inside the oocyte,
hRFC-EGFP was resolved as highly punctate vesicular structures (~0.6
µm in diameter) located within a more diffusively stained network
(Fig. 2, D and E). These vesicles were also
evident in axial (x-z) sections in which
individual vesicles were transected by the laser scan line (see, e.g.,
Fig. 2A). This network was most likely the cortical ER of
the oocyte, because the fluorescence signal in oocytes expressing
EYFP-ER displayed an anastomosing network of tubules at this same level (Fig. 2, D and E). Therefore, it is likely that
the bright punctate structures represent hRFC-EGFP localized within
trafficking vesicles that are being transported through the ER to the
cell surface.
|
hRFC-EGFP is functionally expressed in plasma membrane.
Implicit in these studies is the verification that fusion of hRFC with
EGFP (27 kDa) does not alter the normal plasma membrane targeting and
activity of hRFC (12, 41). This was confirmed by
measurements of [3H]folinic acid uptake, showing levels
2.7-fold higher in oocytes expressing hRFC-EGFP cDNA compared with the
endogenous uptake in water-injected controls (Fig.
3; 6.58 ± 0.59 vs. 2.45 ± 0.24 fmol · oocyte
1 · h
1,
respectively). These data are consistent with a 2.4-fold enhancement of
uptake reported previously in oocytes injected with cRNA encoding hRFC
alone (29). Together, the results from Figs. 1, 2, and 3
confirm that EGFP tagging of hRFC affects neither its localization at
the plasma membrane nor the functional ability of hRFC to transport folinic acid.
|
Relative importance of COOH-terminal cytoplasmic tail of hRFC
compared with backbone sequence in targeting protein to plasma
membrane.
In this study, we examined whether the motif(s)/signal(s) that
determines membrane targeting of the hRFC protein is endowed to a
sequence at the COOH-terminal cytoplasmic tail of the protein or to a
sequence in the backbone region of the polypeptide. To do so, we
designed two hRFC constructs fused to EGFP with partial (F1R2: amino
acids 1-530) or complete (F1R3: amino acids 1-452) truncation
of the COOH-terminal cytoplasmic tail (Fig.
4A). We also designed an EGFP-fusion protein of the COOH-terminal sequence alone (F2R1: amino acids 452-591).
|
Role of cytoskeleton in hRFC localization.
If the cytoskeleton plays a role in intracellular trafficking of
hRFC-EGFP to the plasma membrane, then a simple explanation for the
observed asymmetric distribution of hRFC-EGFP could be a polarized
distribution of cytoskeletal filaments across the oocyte. We therefore
performed separate nuclear injections of plasmids encoding either an
EYFP-
-actin fusion construct (EYFP-actin) or an EGFP-
-tubulin
fusion construct (EGFP-tubulin). Fig.
5A shows
axial (x-z) scans of the animal and vegetal hemispheres of
oocytes from the same donor animal expressing hRFC-EGFP, EYFP-actin, or
EGFP-tubulin. In contrast to the striking hemispheric polarity observed
with hRFC-EGFP (~15-fold; Figs. 1 and 5), the distribution of both
EYFP-actin and EGFP-tubulin was more uniform across the cell. The peak
fluorescence of EYFP-actin was only ~1.5-fold greater in the animal
compared with the vegetal hemisphere (1.47 ± 0.05-fold, n = 6 cells), and the width of the fluorescence signal
was similar in animal (6.70 ± 0.51 µm) and vegetal (6.35 ± 0.47 µm) hemispheres. The distribution of EGFP-tubulin paralleled
that of EYFP-actin: the peak fluorescence was similarly only
~1.5-fold greater in the animal hemisphere (1.42 ± 0.15-fold;
n = 8 oocytes), although the depth of resolution of
EGFP-tubulin was greater in the vegetal (8.45 ± 0.23 µm) than
the animal (4.91 ± 0.18 µm) hemisphere. In summary, these data
demonstrate that the observed distribution of hRFC-EGFP in the oocyte
plasma membrane is much more asymmetric than that seen with actin and
tubulin.
|
| |
DISCUSSION |
|---|
|
|
|---|
The use of Xenopus oocytes as a model system for studying cell biology of membrane transporters has precedence (10, 14), having been selected as a model because of several advantages for studying intracellular trafficking and targeting of membrane proteins. First, the oocyte is an unusually large cell (~1-µl volume) with an extensive membrane surface area further enhanced by the plasma membrane microvilli that are especially enriched in the animal hemisphere (7, 46). The rate of vesicle trafficking to and from the plasma membrane is high (46), such that the system is ideal for observation of near-membrane trafficking events. Our visualization of hRFC-EGFP in vesicles moving through the ER toward the cell membrane (Fig. 2D) confirms the potential of the oocyte for trafficking studies. Second, Xenopus oocytes faithfully express exogenous proteins and target them to the correct cellular compartment. Finally, the Xenopus oocyte is a prototype polarized cell, displaying structural and functional asymmetry along an animal-vegetal axis specified during oogenesis (11, 42). Many endogenous membrane proteins are localized asymmetrically across the oocyte, with some preferentially expressed within the cell membrane of the animal hemisphere (16, 26), others within the cell membrane of the vegetal hemisphere (21, 30), and others distributed more uniformly (22). Similarly, exogenously expressed membrane proteins are targeted to the animal hemisphere (30, 32), the vegetal hemisphere (21), or throughout the entire oocyte surface (34, 38). Thus the cellular mechanisms that sort endogenous/exogenous proteins to different regions of the cell surface potentially can be exploited to investigate the molecular determinants that direct targeting of proteins to the cell membrane.
Our current interest in the cell biology and physiology of RFC relates to identifying the molecular signal(s)/motif(s) that guide the targeting of the protein to the plasma membrane and in assessing the role of the cytoskeleton in the intracellular trafficking of hRFC in different cell types. To begin addressing these issues, we used Xenopus oocytes directly injected into the nucleus with hRFC cDNA (39). In contrast to cRNA injection, this approach ensures that expressed protein will pass through the oocyte's endogenous machinery for transcription, translation, and trafficking, maintaining the effects of regulatory mechanisms active at the transcriptional and translational levels. Our results showed that Xenopus oocytes express functional hRFC-EGFP protein at the plasma membrane, with a greater peak fluorescence signal (~15-fold) in the animal compared with the vegetal pole. This asymmetric distribution of hRFC-EGFP is maintained for at least 7 days after injection (Fig. 1C), suggesting that polarity does not simply result from the closer spatial positioning of the oocyte nucleus to the animal pole (33) but is an actively maintained phenomenon. The asymmetric distribution of hRFC-EGFP at the cell surface did not result from an endogenous asymmetry of the oocyte cytoskeleton, because EYFP-actin and EGFP-tubulin were expressed with only slight differences between each hemisphere (Fig. 5).
To determine whether the membrane-targeting signal is located in the COOH-terminal cytoplasmic tail of the hRFC protein or in a sequence in the backbone region of the polypeptide, we engineered specific constructs of the hRFC polypeptide fused to EGFP that totally or partially lack the COOH-terminal cytoplasmic tail. We also generated a fusion protein of the COOH-terminal cytoplasmic tail of hRFC fused to EGFP (F2R1). Our results showed that partial or complete truncation of the COOH-terminal tail of hRFC has no effect on targeting of hRFC to the plasma membrane (Fig. 4B). The ratio of expression at the plasma membrane of animal and vegetal hemispheres, however, varied significantly from that observed with full-length hRFC-EGFP (Fig. 4C). With the completely truncated construct F1R3, weak expression was detectable in the vegetal pole (thereby decreasing the observed asymmetry), suggesting that the COOH-terminal tail of hRFC may play some role in asymmetric targeting of the protein to oocyte plasma membrane. However, with partial truncation of the COOH-terminal cytoplasmic tail (F1R2), enhancement of polarity over full-length protein was observed. This is possibly caused by a greater efficiency of trafficking or resistance to degradation. With the F2R1 construct, comprising the COOH-terminal cytoplasmic tail fused to EGFP, no fluorescence was found at the plasma membrane, suggesting that, if translated, the protein was not membrane targeted. These results suggest that for hRFC polypeptide, the membrane-targeting motif(s)/signal(s) is most likely located in the backbone sequence of the hRFC polypeptide, i.e., outside its COOH-terminal cytoplasmic tail. Further studies are required to determine the nature and specific location of the membrane-targeting motif(s)/signal(s) of the hRFC protein. Results similar to those described in this study were recently observed in our laboratory for membrane targeting of hRFC in mammalian cells (renal epithelial HEK-293 cells; unpublished observations).
Whereas previous work demonstrated a role for the cytoskeleton in intracellular trafficking of other membrane transporters (1, 4, 9, 13), little is known about the role played by the cytoskeleton in the intracellular trafficking of hRFC. In this study, we used nocodazole and cytochalasin D to investigate the respective roles of microtubules and the actin cytoskeleton in hRFC trafficking. Although both drug are effective in disrupting the oocyte cytoskeleton (6, 15), long-term (<50 h) incubation of oocytes with either drug does not impair cell viability, as assessed by measurements of membrane potential and resistance (32), membrane morphology (6), or synthesis of heterologous proteins (6, 32). Our results showed that incubation of oocytes with nocodazole markedly reduced the rate of expression of hRFC-EGFP at the animal pole (Fig. 5C) but not the polarity of hRFC-EGFP expression. When nocodazole was applied soon (3-6 h) after nuclear injection, many oocytes displayed no measurable fluorescence 30 h later (Fig. 5B). However, it was unclear whether this lack of fluorescence simply resulted from a complete inhibition of hRFC-EGFP transport or simply a slowed trafficking of hRFC-EGFP throughout the incubation period. In either case, these results demonstrate, for the first time, the importance of intact microtubules for intracellular hRFC trafficking. In contrast, disruption of actin filaments with cytochalasin D had little effect on hRFC-EGFP trafficking: the percentage of oocytes expressing hRFC-EGFP at the plasma membrane (Fig. 5B), the rate of hRFC trafficking (Fig. 5C), and the observed polarity were similar to those in control cells.
In summary, our results demonstrate that hRFC is targeted to the plasma membrane in Xenopus oocytes and is expressed asymmetrically across the cell. In addition, the molecular determinant(s) responsible for targeting the hRFC protein to the cell membrane in Xenopus oocytes resides within a sequence in the backbone of the polypeptide and not within the COOH-terminal cytoplasmic tail. Finally, an intact microtubule network appears to be essential for hRFC intracellular trafficking in the Xenopus oocyte. These results provide a basis for further investigations into the cell biology of trafficking and membrane targeting of hRFC in a variety of other cellular contexts.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported by the Department of Veterans Affairs and National Institutes of Health Grants DK-56061, DK-58057, and GM-48071. J. S. Marchant was supported by a Wellcome Trust Fellowship (no. 053102).
| |
FOOTNOTES |
|---|
* V. S. Subramanian and J. S. Marchant contributed equally to this work.
Address for reprint requests and other correspondence: H. M. Said, VA Medical Center, Long Beach, CA 90822 (E-mail: hmsaid{at}uci.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Received 9 August 2001; accepted in final form 4 September 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Achler, C,
Filmer D,
Mertre C,
and
Drenckhahn D.
Role of microtubules in polarized delivery of apical membrane proteins to the brush border of the intestinal epithelium.
J Cell Biol
109:
179-189,
1989
2.
Alonso, MA,
Fan L,
and
Alarcon B.
Multiple sorting signals determine apical localization of a nonglycosylated integral membrane protein.
J Biol Chem
272:
30748-30752,
1997
3.
Blakley, RL,
and
Whitehead VA.
Folates and Pterins. Nutritional, Pharmacological and Physiological Aspects. New York: Wiley, 1986.
4.
Brown, D.
Targeting of membrane transporters in renal epithelia: when cell biology meets physiology.
Am J Physiol Renal Physiol
278:
F192-F201,
2000
5.
Caplan, MJ.
Membrane polarity in epithelial cells: protein sorting and establishment of polarized membrane domains.
Am J Physiol Renal Physiol
272:
F425-F429,
1997
6.
Colman, A,
Morser J,
Lane C,
Besley J,
Wylie C,
and
Valle G.
Fate of secretory proteins trapped in oocytes of Xenopus laevis by disruption of the cytoskeleton or by imbalanced subunit synthesis.
J Cell Biol
91:
770-780,
1981
7.
Dascal, N.
The use of Xenopus oocytes for the study of ion channels.
Crit Rev Biochem
22:
317-387,
1987[Web of Science][Medline].
8.
Dixon, KH,
Lanpher BC,
Chiu J,
Kelley K,
and
Cowan KH.
A novel cDNA restores reduced folate carrier activity and methotrexate sensitivity to transport deficient cells.
J Biol Chem
269:
17-20,
1994
9.
Dranoff, JA,
McClure M,
Burgstahler AD,
Denson LA,
Crawford AR,
Crawford JM,
Karpen SJ,
and
Nathanson MH.
Short-term regulation of bile acid uptake by microfilament-dependent translocation of rat ntcp to the plasma membrane.
Hepatology
30:
223-229,
1999[Web of Science][Medline].
10.
Due, AD,
Zhi-Chao Q,
Thomas JM,
Buchs A,
Powers AC,
and
May JM.
Role of the C-terminal tail of the GLUT1 glucose transporter in its expression and function in Xenopus laevis oocytes.
Biochemistry
34:
5462-5471,
1995[Medline].
11.
Dumont, JN.
Oogenesis in Xenopus laevis (Daudin). I. Stages of oocyte development in laboratory maintained animals.
J Morphol
136:
153-180,
1972[Web of Science][Medline].
12.
Ferguson, PL,
and
Flintoff WF.
Topological and functional analysis of the human reduced folate carrier by haemagglutinin epitope insertion.
J Biol Chem
23:
16269-16278,
1999.
13.
Fletcher, LM,
Welsh GI,
Oatey PB,
and
Tavare JM.
Role for the microtubule cytoskeleton in GLUT4 vesicle trafficking and in the regulation of insulin-stimulated glucose uptake.
Biochem J
352:
267-276,
2000.
14.
Garcia, JC,
Strube M,
Leingang K,
Keller K,
and
Mueckler MM.
Amino acid substitutions at tryptophan 388 and tryptophan 412 of the HepG2 (Glut1) glucose transporter inhibit transport activity and targeting to the plasma membrane in Xenopus oocytes.
J Biol Chem
267:
7770-7776,
1992
15.
Gard, DL,
Cha BJ,
and
King E.
The organization and animal-vegetal asymmetry of cytokeratin filaments in stage VI Xenopus oocytes is dependent upon F-actin and microtubules.
Dev Biol
184:
95-114,
1997[Web of Science][Medline].
16.
Gomez-Hernandez, J-M,
Stühmer W,
and
Parekh AB.
Calcium dependence and distribution of calcium-activated chloride channels in Xenopus oocytes.
J Physiol (Lond)
502:
569-574,
1997
17.
Gut, A,
Kappeler F,
Hyka N,
Balda MS,
Hauri HP,
and
Matter K.
Carbohydrate-mediated Golgi to cell surface transport and apical targeting of membrane proteins.
EMBO J
17:
1919-1929,
1998[Web of Science][Medline].
18.
Hernando, N,
Traebert M,
Forster I,
and
Murer H.
Effect of two tyrosine mutations on the activity and regulation of the renal type II Na/Pi-cotransporter expressed in oocytes.
J Membr Biol
168:
275-282,
1999[Web of Science][Medline].
19.
Karim-Jimenez, Z,
Hernando N,
Biber J,
and
Murer H.
Requirement of a leucine residue for (apical) membrane expression of type IIb NaPi cotransporters.
Proc Natl Acad Sci USA
97:
2916-2921,
2000
20.
Kumar, CK,
Nguyen TT,
Gonzales FB,
and
Said HM.
Comparison of intestinal folate carrier clone expressed in IEC-6 cells and in Xenopus oocytes.
Am J Physiol Cell Physiol
274:
C289-C294,
1998
21.
Levine, E,
Werner R,
Neuhaus I,
and
Dahl G.
Asymmetry of gap junction formation along the animal-vegetal axis of Xenopus oocytes.
Dev Biol
156:
490-499,
1993[Web of Science][Medline].
22.
Machaca, K,
and
Hartzell HC.
Asymmetrical distribution of Ca-activated Cl channels in Xenopus oocytes.
Biophys J
74:
1286-1295,
1998[Web of Science][Medline].
23.
Marshall, BA,
Murata H,
Hresko RC,
and
Mueckler MM.
Domains that confer intracellular sequestration of the Glut4 glucose transporter in Xenopus oocytes.
J Biol Chem
35:
26193-26199,
1993.
24.
Mason, JB,
and
Rosenberg IH.
Intestinal Absorption of Folate. New York: Raven, 1994, p. 1979-1995.
25.
Matter, K,
and
Mellman I.
Mechanisms of cell polarity: sorting and transport in epithelial cells.
Curr Opin Cell Biol
6:
545-554,
1994[Web of Science][Medline].
26.
Matus-Leibovitch, N,
Lupu-Meiri M,
and
Oron Y.
Two types of intrinsic muscarinic responses in Xenopus oocytes.
Pflügers Arch
417:
194-199,
1990[Web of Science][Medline].
27.
Moscow, JA,
Gong M,
He R,
Sgagias MK,
Dixon KH,
Anzick SL,
Mettzer PS,
and
Cowan KH.
Isolation of a gene encoding a human reduced folate carrier (RFC1) and analysis of its expression in transport-deficient, methotrexate-resistance human breast cancer cells.
Cancer Res
55:
3790-3794,
1995
28.
Muth, TR,
Ahn J,
and
Caplan MJ.
Identification of sorting determinants in the C-terminal cytoplasmic tails of the
-aminobutyric acid transporters GAT-2 and GAT-3.
J Biol Chem
40:
25616-25627,
1998.
29.
Nguyen, TT,
Dyer DL,
Dunning DD,
Rubin SA,
Grant KE,
and
Said HM.
Human intestinal folate transport: cloning, expression, and distribution of complementary RNA.
Gastroenterology
112:
783-791,
1997[Web of Science][Medline].
30.
Oron, Y,
Gillo B,
and
Gershengorn MC.
Differences in receptor-evoked membrane electrical responses in native and mRNA-injected Xenopus oocytes.
Proc Natl Acad Sci USA
85:
3820-3824,
1988
31.
Parker, I,
Callamaras N,
and
Wier WG.
A high-resolution, confocal laser-scanning microscope and flash photolysis system for physiological studies.
Cell Calcium
21:
441-452,
1997[Web of Science][Medline].
32.
Peter, AB,
Schittny JC,
Niggli V,
Reuter H,
and
Sigel E.
The polarized distribution of the poly(A+)-mRNA-induced functional ion channels in the Xenopus oocyte plasma membrane is prevented by anticytoskeletal drugs.
J Cell Biol
114:
455-464,
1991
33.
Pfeiffer, DC,
and
Gard DL.
Microtubules in Xenopus oocytes are orientated with their minus-ends towards the cortex.
Cell Motil Cytoskeleton
44:
34-43,
1999[Web of Science][Medline].
34.
Roberts, SJ,
Leaf DS,
Moore H-P,
and
Gerhart JC.
The establishment of polarized membrane traffic in Xenopus laevis embryos.
J Cell Biol
118:
1359-1369,
1992
35.
Said, HM,
and
Kumar C.
Intestinal absorption of vitamins.
Curr Concept Gastroenterol
15:
172-176,
1999.
36.
Said, HM,
Rose R,
and
Seetharam B.
Intestinal Absorption of Water-Soluble Vitamins: Cellular and Molecular Aspects. San Diego: Academic, 2000, p. 35-75.
37.
Sirotnak, FM,
and
Tolner B.
Carrier-mediated transport of folates in mammalian cells.
Annu Rev Nutr
19:
91-122,
1999[Web of Science][Medline].
38.
Sweet, DH,
Miller DS,
and
Pritchard JB.
Basolateral localization of organic cation transporter 2 in intact renal proximal tubules.
Am J Physiol Renal Physiol
279:
F826-F834,
2000
39.
Swick, AG,
Janicot M,
Cheneval-Kastelic T,
McLenithan JC,
and
Lane MD.
Promoter-cDNA directed heterologous expression in Xenopus laevis oocytes.
Proc Natl Acad Sci USA
89:
1812-1816,
1992
40.
Titus, SA,
and
Moran RG.
Retrovirally mediated complementation of the glyB phenotype.
J Biol Chem
275:
36811-36817,
2000
41.
Tsien, RY.
The green fluorescent protein.
Annu Rev Biochem
67:
509-544,
1998[Web of Science][Medline].
42.
Ubbels, GA.
Establishment of polarities in the oocyte of Xenopus laevis: the provisional axial symmetry of the full-grown oocyte of Xenopus laevis.
Cell Mol Life Sci
53:
382-409,
1997[Web of Science][Medline].
43.
Williams, FMR,
and
Flintoff WF.
Isolation of a human cDNA that complements a mutant hamster cell defective in methotrexate uptake.
J Biol Chem
270:
2987-2992,
1995
44.
Williams, FMR,
Murray RC,
Underhill TM,
and
Flintoff WF.
Isolation of a hamster cDNA clone coding for a function involved in methotrexate uptake.
J Biol Chem
269:
5810-5816,
1994
45.
Wong, SC,
Proefke SA,
Bhusan A,
and
Matherly LH.
Isolation of human cDNAs that restore methotrexate sensitivity and reduced folate carrier activity in methotrexate transport-defective Chinese hamster ovary cells.
J Biol Chem
270:
17468-17475,
1995
46.
Zampighi, GA,
Loo DDF,
Kreman M,
Eskandari S,
and
Wright EM.
Functional and morphological correlates of Connexin50 expressed in Xenopus laevis oocytes.
J Gen Physiol
113:
507-523,
1999
This article has been cited by other articles:
![]() |
J. F. Collins Novel insights into intestinal and renal folate transport. Focus on "Apical membrane targeting and trafficking of the human proton-coupled folate transporter in polarized epithelia" Am J Physiol Cell Physiol, February 1, 2008; 294(2): C381 - C382. [Full Text] [PDF] |
||||
![]() |
V. S. Subramanian, J. S. Marchant, and H. M. Said Apical membrane targeting and trafficking of the human proton-coupled transporter in polarized epithelia Am J Physiol Cell Physiol, January 1, 2008; 294(1): C233 - C240. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. S. Marchant, V. S. Subramanian, I. Parker, and H. M. Said Intracellular Trafficking and Membrane Targeting Mechanisms of the Human Reduced Folate Carrier in Mammalian Epithelial Cells J. Biol. Chem., August 30, 2002; 277(36): 33325 - 33333. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |