|
|
||||||||
1 Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261; 2 Millennium Pharmaceuticals, Cambridge, Massachusetts 02139; and 3 Bayer, West Haven, Connecticut 06516 - 4175
| |
ABSTRACT |
|---|
|
|
|---|
Agmatinase, which hydrolyzes agmatine to putrescine and urea, not only represents a potentially important mechanism for regulating the biological effects of agmatine in mammalian cells but also represents an alternative to ornithine decarboxylase for polyamine biosynthesis. We have isolated a full-length cDNA encoding human agmatinase whose function was confirmed by complementation in yeast. The single-copy human agmatinase gene located on chromosome 1 encodes a 352-residue protein with a putative mitochondrial targeting sequence at the NH3-terminus. Human agmatinase has about 30% identity to bacterial agmatinases and <20% identity to mammalian arginases. Residues required for binding of Mn2+ at the active site in bacterial agmatinase and other members of the arginase superfamily are fully conserved in human agmatinase. Agmatinase mRNA is most abundant in human liver and kidney but also is expressed in several other tissues, including skeletal muscle and brain. Its expression in human liver is induced during hepatitis B virus infection, suggesting that agmatinase may play a role in the pathophysiology of this disease.
brain; kidney; putrescine; arginase superfamily
| |
INTRODUCTION |
|---|
|
|
|---|
THE PATHWAY OF AGMATINE METABOLISM has long been recognized in bacteria, plants and invertebrates (40) where agmatine [4-(aminobutyl)guanidine] is synthesized from L-arginine by L-arginine decarboxylase (ADC). Agmatine, in turn, is hydrolyzed by agmatinase (agmatine ureohydrolase; EC 3.5.3.11) to form urea and putrescine, thus providing a route for polyamine biosynthesis that is an alternative to the better-known route, which uses L-ornithine decarboxylase (ODC). However, it was not until 1994 that agmatine synthesis by mammals was demonstrated (16). Since then, both ADC and agmatinase activities have been reported for several rodent tissues (30, 34, 35), indicating that ornithine decarboxylase is not the exclusive route for polyamine synthesis in mammals.
Because agmatine itself is biologically active, agmatinase may not only provide a route for putrescine synthesis but may represent a mechanism for regulating cell signaling via changes in agmatine levels. Examples of agmatine effects include inhibition of cell proliferation (29, 31, 36), stimulation of glomerular filtration rate (18), activation of constitutive nitric oxide synthase (23, 37), irreversible inactivation of neuronal nitric oxide synthase (10), inhibition of inducible nitric oxide synthase (1, 5, 12), and inhibition of monoamine oxidase (27). Moreover, the relative distributions of ADC and agmatinase activities in mammalian tissues are not identical (32), which is also consistent with the possibility that these enzymes do not simply comprise a pathway for putrescine biosynthesis. Accordingly, changes in activity or expression of agmatinase could play an important role in regulating the physiological actions of agmatine.
The physiological and pathophysiological roles of agmatinase in mammals have not yet been defined, in part, because no vertebrate agmatinase has been purified or cloned nor has agmatinase expression been determined for a broad range of mammalian tissues. Moreover, it has not previously been established that agmatinase is expressed in humans. To begin evaluating potential functions of agmatinase, we isolated a full-length cDNA for human agmatinase, demonstrated tissue-specific expression, and showed that its expression is altered in human disease. Cloning of human agmatinase provides opportunities to elucidate the function of endogenous agmatine via development of specific agmatinase inhibitors and the ability to manipulate agmatinase expression by recombinant DNA techniques.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Materials. Materials not described previously (21) were obtained from Sigma or were of the highest quality commercially available.
Isolation of cDNA clones. A human kidney cDNA library in phage lambda (Stratagene, La Jolla, CA) was screened with [32P]cDNA, using procedures described previously (20). Phage clones were converted to plasmids as recommended by Stratagene. Plasmids were sequenced using a ABI PRISM 377 sequencer at the University of Pittsburgh DNA Sequencing Facility.
Plasmid construction. With the use of appropriate restriction sites and standard procedures for subcloning, the entire 1.9-kb human agmatinase cDNA was inserted into the Pst I site downstream of the alcohol dehydrogenase promoter in the yeast expression plasmid pXZ134, which contains the ura3 selectable marker (42). The plasmid containing the agmatinase cDNA in the correct orientation was designated pXZ134-agmatinase and used for complementation.
Yeast strains and complementation. A yeast strain containing a disruption of the spe1 gene encoding ODC (strain yASG1-8), as well as strains complemented with the Escherichia coli speA gene encoding ADC (strain yASG1-8/pbADC), the E. coli speB gene encoding agmatinase (strain yASG1-8/pbAUH), or with both E. coli genes (strain yASG1-8/pbADC + pbAUH), were generously provided by Dr. Guan Zhu (Texas A&M University) and used for complementation studies essentially as described (15). Yeast strains were maintained on enriched medium or on yeast minimal medium (YMM) supplemented with the appropriate amino acids, nucleotides, or spermidine (10 µg/ml) as described (15).
The specific yeast strains designated in RESULTS were transformed with pXZ134-agmatinase by the lithium acetate procedure (14), and transformants were selected on medium lacking uracil. To test for complementation, each yeast strain was first incubated overnight in 10-ml liquid cultures of YMM supplemented with the appropriate amino acids, nucleotides, and spermidine (10 µg/ml). Each culture was then diluted to an optical density at 600 nm of 0.2, and 5 µl of serial 10-fold dilutions were spotted onto YMM plates containing appropriate amino acids and nucleotides, with and without 10 µg/ml spermidine. Complementation of the ODC deficiency was identified by growth on plates lacking spermidine after incubation at 30°C.RNA analysis by RT-PCR and Northern blot test. Normal human tissues were collected by the Millennium Pathology Department from various clinical sources. Hepatitis B virus (HBV)-infected liver needle biopsies and purified HBV-infected liver RNA were the kind gifts from Dr. Peter R. Galle (Johannes Gutenberg University, Mainz, Germany) and Dr. Fabio Marra (University of Florence, Florence, Italy). HepG2 and HepG2.2.15 cells were obtained from Dr. Erwin Graef (Bayer-AG, Wuppertal, Germany).
For real-time quantitative RT-PCR purposes, total RNA was purified from tissues and cells using RNA STAT-60 (Tel-Test, Friendswood, TX) according to the manufacturer's protocol. After DNAse-I treatment (Qiagen), total RNA went through a secondary purification using RNeasy columns (Qiagen). cDNA was synthesized using the Omniscript Reverse Transcriptase Kit (Qiagen) after the manufacturer's suggested protocol. Design of the PCR primers and Taqman probe for human agmatinase was done using Primer Express (Applied Biosystems) software. The forward primer was 5'- ACATAGCATCTCAAACAGCAGGTTAG, the reverse primer was 5'- AAGTTTCACCACCGTATGATCTTTC, and the Taqman probe was 5'FAM-CGCCAGCAGGGCTGTGTTCCC-3' TAMRA. Primers and the VIC-labeled Taqman probe for the housekeeping control gene human
2 microglobulin
(hu
2M) were purchased from Applied Biosystems. Real-time
quantitative RT-PCR analyses were performed with reagents recommended
by the manufacturer (Applied Biosystems) using an ABI PRISM 7700 Sequence Detection System instrument. Briefly, ~300 pg cDNA was added
to 250-µl reactions containing 12.5 µl of PCR Universal Mix
(Applied Biosystems), 600 nM agmatinase F primer, 600 nM agmatinase R
primer, 200 nM agmatinase Taqman probe, 200 nM hu
2M F primer, 200 nM hu
2M R primer, and 100 nM hu
2M Taqman probe. The number of
PCR cycles needed for FAM and VIC fluorescence to cross a threshold
where a statistically significant increase in change in fluorescense
(Ct = threshold cycle) was measured using Applied Biosystems
software according to their recommendations. Relative agmatinase RNA
expression was determined using the formula Rel Exp = 2
(
Ct) where 
Ct = (Ct agmatinase
Ct hu
2M in experimental sample)
(Ct agmatinase
Ct hu
2M in a
no-template control sample). Relative expression was plotted after
setting the sample with lowest measurable expression equal to 1. Taqman
RT-PCR experiments were performed in duplicate and were independently
repeated three to four times.
Total RNA samples were subjected to Northern blot analysis using
[32P]cDNA (a 1.25-kb EcoRI fragment of human agmatinase)
containing the entire open reading frame (ORF). Procedures for gel
electrophoresis and hybridization were as previously described
(22).
In situ hybridization and immunohistochemistry. For immunohistochemistry, frozen sections of infected or human liver were cut at 6 µm thickness, mounted on charged slides, fixed in cold acetone (Sigma), and immersed in 0.3% H2O2 in methanol for 10 min to block endogenous peroxidase. A 1:2,000 dilution of anti-HBV surface antigen (DAKO) was applied in 5% BSA/PBS for 30 min at room temperature. Slides were then incubated with anti-goat secondary antibody, followed by an alkaline phosphatase-labeled polymer (DAKO) for detection. After multiple PBS washes, fast red substrate-chromogen solution was applied for 10 min and the slides were then counterstained with hematoxylin.
For in situ hybridization, frozen 6-µm sections of infected or normal human liver were fixed in 4% paraformaldehyde, washed in 1× PBS, acetylated in 0.1M TEA-HCL and 0.25% acetic anhydride (Sigma) for 10 min, washed in 2× SSC, dehydrated with ethanol, and air dried. Slides were hybridized overnight at 55°C with 35S-labeled human agmatinase riboprobes at 2.5 × 106 cpm/slide. Slides were subsequently washed and dipped in photographic emulsion (Kodak) and exposed for 2 to 4 wk at 4°C, developed, and counterstained with hematoxylin.| |
RESULTS |
|---|
|
|
|---|
Isolation of full-length human agmatinase cDNA.
Based on the homology between arginases and bacterial agmatinases
(26), we initially identified several potential human agmatinase sequences by using the rat arginase I sequence as the query
in a basic local alignment search tool (BLAST) search (2) of the expressed sequence tag (EST) database at the National Center for
Biotechnology Information. Several candidate human EST clones were
obtained from the IMAGE Consortium, but none contained a complete ORF.
Based on preliminary Northern blot analyses of human RNAs with a
partial human agmatinase cDNA, we used one of the candidate EST clones
(GenBank accession no. AI653589) to screen a human kidney cDNA library.
We isolated a 1884-bp cDNA containing a short 5' untranslated region of
43 bp, a coding region of 1059 bp, and a longer 3' untranslated region
of 757 bp, plus a 25-bp polyA tail. The predicted ORF corresponds to a
protein of 352 residues with a calculated molecular weight of 37,731 daltons. Alignment of the cDNA sequence with sequences in the human
genome database identified a single-copy gene composed of eight exons spanning 12.6 kb on chromosome 1 (Fig.
1A).
|
Identification of human agmatinase by complementation in yeast.
Because it is generally very difficult to obtain enzymatically active
bacterial preparations of recombinant mammalian proteins that normally
undergo proteolytic processing into the final active form, we chose to
confirm the identity of the candidate human agmatinase by functional
complementation in yeast. Fortunately, polyamine-requiring yeast
strains suitable for such complementation studies have recently been
developed (15). Yeast strain yASG1-8 contains a
disruption in the spe1 gene encoding ODC and thus requires exogenous polyamines for growth. Transformants of yASG1-8
expressing either E. coli ADC (speA) or E. coli agmatinase (speB) also require exogenous
polyamines, but a yASG1-8 strain expressing both speA and speB genes can grow on minimal medium without polyamines
(15). The complementation scheme for yeast deficiency in
ODC is illustrated in Fig. 2A.
After transformation with plasmid pXZ134-agmatinase, the ability to
grow on minimal medium lacking polyamines was restored in the
yASG1-8 strain complemented with speA, whereas there
was little or no growth in the yASG1-8 strain complemented only
with speA or human agmatinase (Fig. 2B), thus
confirming the identity of our cloned cDNA as an agmatinase cDNA.
Transformation with the parental plasmid pXZ134 alone failed to restore
growth in the yASG1-8 strain complemented with speA
(not shown).
|
Expression of agmatinase in human tissues.
Because the expression of agmatinase in human tissues has not been
reported previously, agmatinase mRNA levels were determined for 30 tissue types (Fig. 3). Although there is
individual variation, agmatinase mRNA is most abundant in adult human
liver and kidney, with lesser amounts in skeletal muscle, fetal liver,
brain, testis, skin, and the gastrointestinal tract (Fig. 3). Human
tissue contains two hybridizing RNA species, one of about the same size
as the 1.9-kb human agmatinase cDNA and a larger molecular weight
species of ~3.9 kb (Fig. 4). In
contrast, only the smaller mRNA is found in rat and mouse. As shown in
the preceding sections, the smaller mRNA is of sufficient size to
encode a full-length agmatinase.
|
|
|
|
| |
DISCUSSION |
|---|
|
|
|---|
The existence of an alternate pathway for polyamine synthesis via ADC and agmatinase in mammals was discovered only recently (16, 17, 35). However, it has not been previously established that humans express either of these enzymes nor have these enzymes been characterized for any vertebrate species. As a first step in analyzing agmatine metabolism in humans, we set out to clone human agmatinase, identify the enzyme family to which it belongs, and characterize its expression in human tissues. A full-length human agmatinase cDNA was isolated, and an initial BLAST search of the EST databases with the human agmatinase sequence identified homologous sequences in rats, mice, pigs, and chickens (GenBank accession no. AF401291), indicating that this gene is expressed in a wide range of vertebrate species. Sequence alignments showed human agmatinase has significant similarity to bacterial agmatinases and thus is a member of the arginase superfamily (26, 38). The presence of key conserved residues indicates that human agmatinase likely requires two divalent manganese ions for full activity, as do the arginases and E. coli agmatinase (4, 8). More detailed studies of agmatinase structure and enzymatic properties will be useful in designing specific inhibitors that can be used in elucidating its physiological functions. On the basis of its general similarity to the NH3-termini of the precursor forms of mitochondrial type II arginases, the NH3-terminus of the human agmatinase ORF appears to represent a mitochondrial import/processing sequence. This also is consistent with the mitochondrial localization of agmatinase activity (35).
Although agmatinase is present in rodent tissues, including brain (35), liver (7), and a murine macrophage line (34), there is no published information on agmatinase expression in any human tissue. The present study shows that expression of agmatinase in humans is tissue specific, with the highest abundance of agmatinase mRNA in liver and kidney. The lower level of agmatinase mRNA in human brain likely represents high-level expression only in selected subpopulations of brain cells, consistent with reports of inhomogenous distribution of agmatinase activity in rat brain (35). The highest levels of agmatinase expression are not found in tissues with the highest rates of cell proliferation and turnover, suggesting that this enzyme does not serve the same role as ornithine decarboxylase. Instead, the primary function of agmatinase in organs with high expression may be to regulate levels of agmatine, which can act as a cell-signaling molecule. For example, agmatinase expression in liver may serve to limit the extent and duration of any increases in circulating levels of agmatine from endogenous or dietary sources. Because agmatine stimulates glomerular filtration rates in the kidney (18), renal expression of agmatinase may serve to modulate its effects in this organ. The presence of agmatinase in skeletal muscle may prevent inhibition of neuronal nitric oxide synthase, which can be irreversibly inactivated by agmatine (10). Similarly, the agmatinase in the brain likely modulates its activity as a cell-signaling molecule in that organ (33). Availability of a mammalian agmatinase cDNA will provide opportunities to begin testing these hypotheses.
Because the identification of circumstances and mechanisms involved in regulation of agmatinase expression will be important in establishing the physiological role(s) of this enzyme, we sought to identify cell culture models for studying regulation of agmatinase expression. Using primary cultures of rat hepatocytes readily responsive to cAMP and glucocorticoids (24), we found that levels of agmatinase mRNA were completely unaffected by these agents (results not shown), indicating that hepatic agmatinase expression is not regulated by hormonal signals commonly involved in responses to changes in diet or metabolic status. Because it expresses agmatinase and has increased agmatinase expression after infection with HBV, we identified the HepG2 hepatoma cell line as a potentially useful model for studying the regulation and function of hepatic agmatinase.
Regarding the increase in agmatinase expression after HBV infection, we note that HBV infection also upregulates another enzyme of arginine metabolism in human liver and in HepG2 cells, namely the inducible isoform of nitric oxide synthase (3, 19). Whether the elevated agmatinase expression is a direct effect of viral factors on agmatinase gene expression or is a secondary effect of the induced nitric oxide production remains to be determined. In any case, the elevated agmatinase expression may provide a source of polyamines for efficient viral replication (13, 28) and thus exacerbate the disease. If so, inhibition of hepatic agmatinase activity or expression could represent a new treatment strategy for patients with viral hepatitis. The possibilities described here are based on two assumptions: first, that increased agmatinase mRNA levels result in increased agmatinase activity. Although we believe this to be likely, it remains to be determined. The second assumption is that increases in agmatinase activity result in physiologically significant increases in polyamine production. Further experimentation is required also to test this assumption.
Physiological and pathophysiological roles of endogenous agmatine in mammals are poorly understood, in part, because relatively little is known regarding the location, regulation, and properties of the enzymes involved in synthesis and degradation of agmatine. Although most speculation as to the physiological roles of agmatinase in mammals has focused on its potential as a regulator of cell signaling via its catabolism of agmatine, it also is possible that a major function of this enzyme may be simply to participate in an alternate pathway for synthesis of putrescine regulated independently of ODC. These possibilities need not be mutually exclusive and one or the other function may predominate in different cell types. The availability of a cloned cDNA for human agmatinase provides exciting opportunities for elucidating new aspects of polyamine metabolism in health and disease.
| |
ACKNOWLEDGEMENTS |
|---|
We are grateful to Dr. G. Zhu for providing yeast strains; Dr. M. Schmidt and R. McCartney for valuable advice on procedures involving yeast; D. Kepka-Lenhart for excellent technical assistance; Drs. P. R. Galle, Dr. F. Marra, and Dr. E. Graef for HBV-infected tissues and cells; Dr. H. Ruebsamen-Waigmann for valuable discussions and support; and numerous colleagues at Millennium Pharmaceuticals, particularly Dr. R. Curtis, P. Hales, Dr. L. Dick, Dr. J. Gutierrez, Dr. C. Bulawa, and Dr. M. Donovan.
| |
FOOTNOTES |
|---|
This work was supported, in part, by National Institute of General Medical Sciences Grant GM57384 (to S. M. Morris, Jr.).
The human agmatinase cDNA sequence has been deposited in GenBank with accession no. AY057097.
Address for reprint requests and other correspondence: S. M. Morris, Jr., W1255 Biomedical Science Tower, Univ. of Pittsburgh, Pittsburgh, PA 15206 (E-mail: smorris{at}pitt.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajpgi.00386.2001
Received 30 August 2001; accepted in final form 1 October 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abe, K,
Abe Y,
and
Saito H.
Agmatine suppresses nitric oxide production in microglia.
Brain Res
872:
141-148,
2000[Web of Science][Medline].
2.
Altschul, SF,
Gish W,
Miller W,
Myers EW,
and
Lipman DJ.
Basic local alignment search tool.
J Mol Biol
215:
403-410,
1990[Web of Science][Medline].
3.
Amaro, MJ,
Bartolome J,
and
Carreno V.
Hepatitis B virus X protein transactivates the inducible nitric oxide synthase promoter.
Hepatology
29:
915-923,
1999[Web of Science][Medline].
4.
Ash, DE,
Cox JD,
and
Christianson DW.
Arginase: a binuclear manganese metalloenzyme.
In: Metal Ions in Biological Systems, edited by Sigel A,
and Sigel H.. New York: Dekker, 2000, p. 407-428.
5.
Auguet, M,
Viossat I,
Marin J-G,
and
Chabrier P-E.
Selective inhibition of inducible nitric oxide synthase by agmatine.
Jpn J Pharmacol
69:
285-287,
1995[Medline].
6.
Boyle, SM,
Markham GD,
Hafner EW,
Wright JM,
Tabor H,
and
Tabor CW.
Expression of the cloned genes encoding the putrescine biosynthetic enzymes and methionine adenosyltransferase of Escherichia coli (speA, speB, speC and metK).
Gene
30:
129-136,
1984[Web of Science][Medline].
7.
Cabella, C,
Gardini G,
Corpillo D,
Testore G,
Bedino S,
Solinas SP,
Cravanzola C,
Vargiu C,
Grillo MA,
and
Colombatto S.
Transport and metabolism of agmatine in rat hepatocyte cultures.
Eur J Biochem
268:
940-947,
2001[Web of Science][Medline].
8.
Carvajal, N,
Lopez V,
Salas M,
Uribe E,
Herrera P,
and
Cerpa J.
Manganese is essential for catalytic activity of Escherichia coli agmatinase.
Biochem Biophys Res Commun
258:
808-811,
1999[Web of Science][Medline].
9.
Carvajal, N,
Olate J,
Salas M,
Lopez V,
Cerpa J,
Herrera P,
and
Uribe E.
Evidence that histidine-163 is critical for catalytic activity, but not for substrate binding to Escherichia coli agmatinase.
Biochem Biophys Res Commun
264:
196-200,
1999[Web of Science][Medline].
10.
Demady, DR,
Jianmongkol S,
Vuletich JL,
Bender AT,
and
Osawa Y.
Agmatine enhances the NADPH oxidase activity of neuronal NO synthase and leads to oxidative inactivation of the enzyme.
Mol Pharmacol
59:
24-29,
2001
11.
Florea, L,
Hartzell G,
Zhang Z,
Rubin G,
and
Miller W.
A computer program for aligning a cDNA sequence with a genomic DNA sequence.
Genome Res
8:
967-974,
1998
12.
Galea, E,
Regunathan S,
Eliopoulos V,
Feinstein DL,
and
Reis DJ.
Inhibition of mammalian nitric oxide synthases by agmatine, an endogenous polyamine formed by decarboxylation of arginine.
Biochem J
316:
247-249,
1996.
13.
Gibson, W,
van Breemen R,
Fields A,
LaFemina R,
and
Irmiere A.
D,L-
-Difluoromethylornithine inhibits human cytomegalovirus replication.
J Virol
50:
145-154,
1984
14.
Gietz, D,
St Jean A,
Woods RA,
and
Schiestl RH.
Improved method for high efficiency transformation of intact yeast cells.
Nucleic Acids Res
20:
1425,
1992
15.
Klein, RD,
Geary TG,
Gibson AS,
Favreau MA,
Winterrowd CA,
Upton SJ,
Keithly JS,
Zhu G,
Malmberg RL,
Martinez MP,
and
Yarlett N.
Reconstitution of a bacterial/plant polyamine biosynthesis pathway in Saccharomyces cerevisiae.
Microbiology
145:
301-307,
1999
16.
Li, G,
Regunathan S,
Barrow J,
Eshraghi J,
Cooper R,
and
Reis DJ.
Agmatine: an endogenous clonidine-displacing substance in the brain.
Science
263:
966-969,
1994
17.
Li, G,
Regunathan S,
and
Reis DJ.
Agmatine is synthesized by a mitochondrial arginine decarboxylase in rat brain.
Ann NY Acad Sci
763:
325-329,
1995[Medline].
18.
Lortie, MJ,
Novotny WF,
Peterson OW,
Vallon V,
Malvey K,
Mendonca M,
Satriano J,
Insel P,
Thomson SC,
and
Blantz RC.
Agmatine, a bioactive metabolite of arginine. Production, degradation, and functional effects in the kidney of the rat.
J Clin Invest
97:
413-420,
1996[Web of Science][Medline].
19.
Majano, PL,
Garcia-Monzon C,
Lopez-Cabrera M,
Lara-Pezzi E,
Fernandez-Ruiz E,
Garcia-Iglesias C,
Borque MJ,
and
Moreno-Otero R.
Inducible nitric oxide synthase expression in chronic viral hepatitis. Evidence for a virus-induced gene upregulation.
J Clin Invest
101:
1343-1352,
1998[Web of Science][Medline].
20.
Morris, SM, Jr,
Bhamidipati D,
and
Kepka-Lenhart D.
Human type II arginase: sequence analysis and tissue-specific expression.
Gene
193:
157-161,
1997[Web of Science][Medline].
21.
Morris, SM, Jr,
Kepka-Lenhart D,
and
Chen LC.
Differential regulation of arginases and inducible nitric oxide synthase in murine macrophage cells.
Am J Physiol Endocrinol Metab
275:
E740-E747,
1998
22.
Morris, SM, Jr,
Moncman CL,
Rand KD,
Dizikes GJ,
Cederbaum SD,
and
O'Brien WE.
Regulation of mRNA levels for five urea cycle enzymes in rat liver by diet, cyclic AMP, and glucocorticoids.
Arch Biochem Biophys
256:
343-353,
1987[Web of Science][Medline].
23.
Morrissey, JJ,
and
Klahr S.
Agmatine activation of nitric oxide synthase in endothelial cells.
Proc Assn Am Phys
109:
51-57,
1997[Web of Science][Medline].
24.
Nebes, VL,
and
Morris SM, Jr.
Regulation of messenger ribonucleic acid levels for five urea cycle enzymes in cultured rat hepatocytes. Requirements for cyclic adenosine monophosphate, glucocorticoids, and ongoing protein synthesis.
Mol Endocrinol
2:
444-451,
1988
25.
Nicholas KB and Nicholas HB Jr. GeneDoc: analysis and
visualization of genetic variation, 1997 [Online]. Pittsburgh
Supercomputing Center http://www.psc.edu/biomed/genedoc/ [2001,
June 1].
26.
Perozich, J,
Hempel J,
and
Morris SM, Jr.
Roles of conserved residues in the arginase family.
Biochim Biophys Acta
1382:
23-37,
1998[Medline].
27.
Raasch, W,
Muhle H,
and
Dominak P.
Modulation of MAO activity by imidazoline and guanidine derivatives.
Ann NY Acad Sci
881:
313-331,
1999[Web of Science][Medline].
28.
Raina, A,
Tuomi K,
and
Mantyjarvi R.
Roles of polyamines in replication of animal viruses.
Med Biol
59:
428-432,
1981[Web of Science][Medline].
29.
Regunathan, S,
Feinstein DL,
and
Reis DJ.
Anti-proliferative and anti-inflammatory actions of imidazoline agents. Are imidazoline receptors involved?
Ann NY Acad Sci
881:
410-419,
1999[Web of Science][Medline].
30.
Regunathan, S,
and
Reis DJ.
Characterization of arginine decarboxylase in rat brain and liver: distinction from ornithine decarboxylase.
J Neurochem
74:
2201-2208,
2000[Web of Science][Medline].
31.
Regunathan, S,
Youngson C,
Raasch W,
Wang H,
and
Reis DJ.
Imidazoline receptors and agmatine in blood vessels: a novel system inhibiting vascular smooth muscle proliferation.
J Pharmacol Exp Ther
276:
1272-1282,
1996
32.
Reis, DJ,
and
Reganathan S.
Agmatine: a novel neurotransmitter?
Adv Pharmacol
42:
645-649,
1998.
33.
Reis, DJ,
and
Regunathan S.
Is agmatine a novel neurotransmitter in brain?
Trends Pharmacol Sci
21:
187-193,
2000[Medline].
34.
Sastre, M,
Galea E,
Feinstein D,
Reis DJ,
and
Regunathan S.
Metabolism of agmatine in macrophages: modulation by lipopolysaccharide and inhibitory cytokines.
Biochem J
330:
1405-1409,
1998.
35.
Sastre, M,
Regunathan S,
Galea E,
and
Reis DJ.
Agmatinase activity in rat brain: a metabolic pathway for the degradation of agmatine.
J Neurochem
67:
1761-1765,
1996[Web of Science][Medline].
36.
Satriano, J,
Matsufuji S,
Murakami Y,
Lortie MJ,
Schwartz D,
Kelly CJ,
Hayashi S,
and
Blantz RC.
Agmatine suppresses proliferation by frameshift induction of antizyme and attenuation of cellular polyamine levels.
J Biol Chem
273:
15313-15316,
1998
37.
Schwartz, D,
Peterson OW,
Mendonca M,
Satriano J,
Lortie M,
and
Blantz RC.
Agmatine affects glomerular filtration via a nitric oxide synthase-dependent mechanism.
Am J Physiol Renal Physiol
272:
F597-F601,
1997
38.
Sekowska, A,
Danchin A,
and
Risler JL.
Phylogeny of related functions: the case of polyamine biosynthetic enzymes.
Microbiology
146:
1815-1828,
2000
39.
Sells, MA,
Chen ML,
and
Acs G.
Production of hepatitis B virus particles in Hep G2 cells transfected with cloned hepatitis B virus DNA.
Proc Natl Acad Sci USA
84:
1005-1009,
1987
40.
Tabor, CW,
and
Tabor H.
Polyamines.
Annu Rev Biochem
53:
749-790,
1984[Web of Science][Medline].
41.
Thompson, JD,
Higgins DG,
and
Gibson TJ.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res
22:
4673-4680,
1994
42.
Zhan, WL,
and
Guan KL.
A specific protein-protein interaction accounts for the in vivo substrate selectivity of Ptp3 toward the Fus3 MAP kinase.
Genes Dev
13:
2811-2827,
1999
This article has been cited by other articles:
![]() |
B. Haenisch, I. von Kugelgen, H. Bonisch, M. Gothert, T. Sauerbruch, M. Schepke, G. Marklein, K. Hofling, D. Schroder, and G. J. Molderings Regulatory mechanisms underlying agmatine homeostasis in humans Am J Physiol Gastrointest Liver Physiol, November 1, 2008; 295(5): G1104 - G1110. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Deignan, J. C. Livesay, L. M. Shantz, A. E. Pegg, W. E. O'Brien, R. K. Iyer, S. D. Cederbaum, and W. W. Grody Polyamine homeostasis in arginase knockout mice Am J Physiol Cell Physiol, October 1, 2007; 293(4): C1296 - C1301. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Morris Jr. Arginine Metabolism: Boundaries of Our Knowledge J. Nutr., June 1, 2007; 137(6): 1602S - 1609S. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |