AJP - GI  AJP: Regulatory, Integrative and Comparative Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 282: G375-G381, 2002; doi:10.1152/ajpgi.00386.2001
0193-1857/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mistry, S. K.
Right arrow Articles by Morris, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mistry, S. K.
Right arrow Articles by Morris, S. M., Jr
Vol. 282, Issue 2, G375-G381, February 2002

Cloning of human agmatinase. An alternate path for polyamine synthesis induced in liver by hepatitis B virus

Sanjay K. Mistry1, Tim J. Burwell2, Rebecca M. Chambers2, Laura Rudolph-Owen2, Frank Spaltmann3, W. Jim Cook2, and Sidney M. Morris Jr1

1 Department of Molecular Genetics and Biochemistry, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15261; 2 Millennium Pharmaceuticals, Cambridge, Massachusetts 02139; and 3 Bayer, West Haven, Connecticut 06516 - 4175


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Agmatinase, which hydrolyzes agmatine to putrescine and urea, not only represents a potentially important mechanism for regulating the biological effects of agmatine in mammalian cells but also represents an alternative to ornithine decarboxylase for polyamine biosynthesis. We have isolated a full-length cDNA encoding human agmatinase whose function was confirmed by complementation in yeast. The single-copy human agmatinase gene located on chromosome 1 encodes a 352-residue protein with a putative mitochondrial targeting sequence at the NH3-terminus. Human agmatinase has about 30% identity to bacterial agmatinases and <20% identity to mammalian arginases. Residues required for binding of Mn2+ at the active site in bacterial agmatinase and other members of the arginase superfamily are fully conserved in human agmatinase. Agmatinase mRNA is most abundant in human liver and kidney but also is expressed in several other tissues, including skeletal muscle and brain. Its expression in human liver is induced during hepatitis B virus infection, suggesting that agmatinase may play a role in the pathophysiology of this disease.

brain; kidney; putrescine; arginase superfamily


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE PATHWAY OF AGMATINE METABOLISM has long been recognized in bacteria, plants and invertebrates (40) where agmatine [4-(aminobutyl)guanidine] is synthesized from L-arginine by L-arginine decarboxylase (ADC). Agmatine, in turn, is hydrolyzed by agmatinase (agmatine ureohydrolase; EC 3.5.3.11) to form urea and putrescine, thus providing a route for polyamine biosynthesis that is an alternative to the better-known route, which uses L-ornithine decarboxylase (ODC). However, it was not until 1994 that agmatine synthesis by mammals was demonstrated (16). Since then, both ADC and agmatinase activities have been reported for several rodent tissues (30, 34, 35), indicating that ornithine decarboxylase is not the exclusive route for polyamine synthesis in mammals.

Because agmatine itself is biologically active, agmatinase may not only provide a route for putrescine synthesis but may represent a mechanism for regulating cell signaling via changes in agmatine levels. Examples of agmatine effects include inhibition of cell proliferation (29, 31, 36), stimulation of glomerular filtration rate (18), activation of constitutive nitric oxide synthase (23, 37), irreversible inactivation of neuronal nitric oxide synthase (10), inhibition of inducible nitric oxide synthase (1, 5, 12), and inhibition of monoamine oxidase (27). Moreover, the relative distributions of ADC and agmatinase activities in mammalian tissues are not identical (32), which is also consistent with the possibility that these enzymes do not simply comprise a pathway for putrescine biosynthesis. Accordingly, changes in activity or expression of agmatinase could play an important role in regulating the physiological actions of agmatine.

The physiological and pathophysiological roles of agmatinase in mammals have not yet been defined, in part, because no vertebrate agmatinase has been purified or cloned nor has agmatinase expression been determined for a broad range of mammalian tissues. Moreover, it has not previously been established that agmatinase is expressed in humans. To begin evaluating potential functions of agmatinase, we isolated a full-length cDNA for human agmatinase, demonstrated tissue-specific expression, and showed that its expression is altered in human disease. Cloning of human agmatinase provides opportunities to elucidate the function of endogenous agmatine via development of specific agmatinase inhibitors and the ability to manipulate agmatinase expression by recombinant DNA techniques.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Materials. Materials not described previously (21) were obtained from Sigma or were of the highest quality commercially available.

Isolation of cDNA clones. A human kidney cDNA library in phage lambda (Stratagene, La Jolla, CA) was screened with [32P]cDNA, using procedures described previously (20). Phage clones were converted to plasmids as recommended by Stratagene. Plasmids were sequenced using a ABI PRISM 377 sequencer at the University of Pittsburgh DNA Sequencing Facility.

Plasmid construction. With the use of appropriate restriction sites and standard procedures for subcloning, the entire 1.9-kb human agmatinase cDNA was inserted into the Pst I site downstream of the alcohol dehydrogenase promoter in the yeast expression plasmid pXZ134, which contains the ura3 selectable marker (42). The plasmid containing the agmatinase cDNA in the correct orientation was designated pXZ134-agmatinase and used for complementation.

Yeast strains and complementation. A yeast strain containing a disruption of the spe1 gene encoding ODC (strain yASG1-8), as well as strains complemented with the Escherichia coli speA gene encoding ADC (strain yASG1-8/pbADC), the E. coli speB gene encoding agmatinase (strain yASG1-8/pbAUH), or with both E. coli genes (strain yASG1-8/pbADC + pbAUH), were generously provided by Dr. Guan Zhu (Texas A&M University) and used for complementation studies essentially as described (15). Yeast strains were maintained on enriched medium or on yeast minimal medium (YMM) supplemented with the appropriate amino acids, nucleotides, or spermidine (10 µg/ml) as described (15).

The specific yeast strains designated in RESULTS were transformed with pXZ134-agmatinase by the lithium acetate procedure (14), and transformants were selected on medium lacking uracil. To test for complementation, each yeast strain was first incubated overnight in 10-ml liquid cultures of YMM supplemented with the appropriate amino acids, nucleotides, and spermidine (10 µg/ml). Each culture was then diluted to an optical density at 600 nm of 0.2, and 5 µl of serial 10-fold dilutions were spotted onto YMM plates containing appropriate amino acids and nucleotides, with and without 10 µg/ml spermidine. Complementation of the ODC deficiency was identified by growth on plates lacking spermidine after incubation at 30°C.

RNA analysis by RT-PCR and Northern blot test. Normal human tissues were collected by the Millennium Pathology Department from various clinical sources. Hepatitis B virus (HBV)-infected liver needle biopsies and purified HBV-infected liver RNA were the kind gifts from Dr. Peter R. Galle (Johannes Gutenberg University, Mainz, Germany) and Dr. Fabio Marra (University of Florence, Florence, Italy). HepG2 and HepG2.2.15 cells were obtained from Dr. Erwin Graef (Bayer-AG, Wuppertal, Germany).

For real-time quantitative RT-PCR purposes, total RNA was purified from tissues and cells using RNA STAT-60 (Tel-Test, Friendswood, TX) according to the manufacturer's protocol. After DNAse-I treatment (Qiagen), total RNA went through a secondary purification using RNeasy columns (Qiagen). cDNA was synthesized using the Omniscript Reverse Transcriptase Kit (Qiagen) after the manufacturer's suggested protocol. Design of the PCR primers and Taqman probe for human agmatinase was done using Primer Express (Applied Biosystems) software. The forward primer was 5'- ACATAGCATCTCAAACAGCAGGTTAG, the reverse primer was 5'- AAGTTTCACCACCGTATGATCTTTC, and the Taqman probe was 5'FAM-CGCCAGCAGGGCTGTGTTCCC-3' TAMRA. Primers and the VIC-labeled Taqman probe for the housekeeping control gene human beta 2 microglobulin (hu beta 2M) were purchased from Applied Biosystems. Real-time quantitative RT-PCR analyses were performed with reagents recommended by the manufacturer (Applied Biosystems) using an ABI PRISM 7700 Sequence Detection System instrument. Briefly, ~300 pg cDNA was added to 250-µl reactions containing 12.5 µl of PCR Universal Mix (Applied Biosystems), 600 nM agmatinase F primer, 600 nM agmatinase R primer, 200 nM agmatinase Taqman probe, 200 nM hu beta 2M F primer, 200 nM hu beta 2M R primer, and 100 nM hu beta 2M Taqman probe. The number of PCR cycles needed for FAM and VIC fluorescence to cross a threshold where a statistically significant increase in change in fluorescense (Ct = threshold cycle) was measured using Applied Biosystems software according to their recommendations. Relative agmatinase RNA expression was determined using the formula Rel Exp = 2-(Delta Delta Ct) where Delta Delta Ct = (Ct agmatinase-Ct hu beta 2M in experimental sample)-(Ct agmatinase-Ct hu beta 2M in a no-template control sample). Relative expression was plotted after setting the sample with lowest measurable expression equal to 1. Taqman RT-PCR experiments were performed in duplicate and were independently repeated three to four times.

Total RNA samples were subjected to Northern blot analysis using [32P]cDNA (a 1.25-kb EcoRI fragment of human agmatinase) containing the entire open reading frame (ORF). Procedures for gel electrophoresis and hybridization were as previously described (22).

In situ hybridization and immunohistochemistry. For immunohistochemistry, frozen sections of infected or human liver were cut at 6 µm thickness, mounted on charged slides, fixed in cold acetone (Sigma), and immersed in 0.3% H2O2 in methanol for 10 min to block endogenous peroxidase. A 1:2,000 dilution of anti-HBV surface antigen (DAKO) was applied in 5% BSA/PBS for 30 min at room temperature. Slides were then incubated with anti-goat secondary antibody, followed by an alkaline phosphatase-labeled polymer (DAKO) for detection. After multiple PBS washes, fast red substrate-chromogen solution was applied for 10 min and the slides were then counterstained with hematoxylin.

For in situ hybridization, frozen 6-µm sections of infected or normal human liver were fixed in 4% paraformaldehyde, washed in 1× PBS, acetylated in 0.1M TEA-HCL and 0.25% acetic anhydride (Sigma) for 10 min, washed in 2× SSC, dehydrated with ethanol, and air dried. Slides were hybridized overnight at 55°C with 35S-labeled human agmatinase riboprobes at 2.5 × 106 cpm/slide. Slides were subsequently washed and dipped in photographic emulsion (Kodak) and exposed for 2 to 4 wk at 4°C, developed, and counterstained with hematoxylin.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Isolation of full-length human agmatinase cDNA. Based on the homology between arginases and bacterial agmatinases (26), we initially identified several potential human agmatinase sequences by using the rat arginase I sequence as the query in a basic local alignment search tool (BLAST) search (2) of the expressed sequence tag (EST) database at the National Center for Biotechnology Information. Several candidate human EST clones were obtained from the IMAGE Consortium, but none contained a complete ORF. Based on preliminary Northern blot analyses of human RNAs with a partial human agmatinase cDNA, we used one of the candidate EST clones (GenBank accession no. AI653589) to screen a human kidney cDNA library. We isolated a 1884-bp cDNA containing a short 5' untranslated region of 43 bp, a coding region of 1059 bp, and a longer 3' untranslated region of 757 bp, plus a 25-bp polyA tail. The predicted ORF corresponds to a protein of 352 residues with a calculated molecular weight of 37,731 daltons. Alignment of the cDNA sequence with sequences in the human genome database identified a single-copy gene composed of eight exons spanning 12.6 kb on chromosome 1 (Fig. 1A).


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 1.   Human agmatinase gene and protein sequence. A: the exon-intron structure is diagrammed according to the scale shown. Regions of exons encoding the ORF are indicated by open boxes above the line. The size of each exon in bp is indicated. The sim4 program (11) was used to generate the alignment between cDNA and genomic sequences. B: human and bacterial agmatinases are compared. Bacterial agmatinases are from Escherichia coli (PIR accession no. C42604) and Neisseria meningitidis (PIR accession no. B81196). The alignment was generated by the CLUSTAL W program, version 1.8, (41), and the results are displayed by the GENEDOC program (25). To simplify comparisons, both absolutely conserved residues and conservative substitutions are represented by black-on-white lettering. The seven conserved histidine and aspartic acid residues required for metal ligand binding and enzymatic activity are indicated directly below the alignment.

As shown in Fig. 1B, the predicted ORF exhibits ~30% identity to two bacterial agmatinases whose activity has been established (6, 38), but it has <20% identity to either human arginase I or arginase II (not shown). However, human agmatinase does contain all amino acid residues that are absolutely conserved in the arginase superfamily (26, 38). These residues include the six aspartic acids and histidines (Fig. 1B) that bind divalent manganese ions required for activity of the arginases and bacterial agmatinases (4, 8). An additional histidine required for maximal activity of E. coli agmatinase (9) also is conserved in the human enzyme.

Identification of human agmatinase by complementation in yeast. Because it is generally very difficult to obtain enzymatically active bacterial preparations of recombinant mammalian proteins that normally undergo proteolytic processing into the final active form, we chose to confirm the identity of the candidate human agmatinase by functional complementation in yeast. Fortunately, polyamine-requiring yeast strains suitable for such complementation studies have recently been developed (15). Yeast strain yASG1-8 contains a disruption in the spe1 gene encoding ODC and thus requires exogenous polyamines for growth. Transformants of yASG1-8 expressing either E. coli ADC (speA) or E. coli agmatinase (speB) also require exogenous polyamines, but a yASG1-8 strain expressing both speA and speB genes can grow on minimal medium without polyamines (15). The complementation scheme for yeast deficiency in ODC is illustrated in Fig. 2A. After transformation with plasmid pXZ134-agmatinase, the ability to grow on minimal medium lacking polyamines was restored in the yASG1-8 strain complemented with speA, whereas there was little or no growth in the yASG1-8 strain complemented only with speA or human agmatinase (Fig. 2B), thus confirming the identity of our cloned cDNA as an agmatinase cDNA. Transformation with the parental plasmid pXZ134 alone failed to restore growth in the yASG1-8 strain complemented with speA (not shown).


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 2.   Identification of human agmatinase by complementation in yeast. A: scheme for complementing yeast deficiency in L-ornithine decarboxylase. B: serial dilutions of yeast cultures were plated on minimal media in the presence or absence of spermidine as indicated. Key to strains: A, yASG1-8/pbADC; B, yASG1-8/ pXZ134-agmatinase; C, yASG1-8/pbADC + pXZ134-agmatinase.

Expression of agmatinase in human tissues. Because the expression of agmatinase in human tissues has not been reported previously, agmatinase mRNA levels were determined for 30 tissue types (Fig. 3). Although there is individual variation, agmatinase mRNA is most abundant in adult human liver and kidney, with lesser amounts in skeletal muscle, fetal liver, brain, testis, skin, and the gastrointestinal tract (Fig. 3). Human tissue contains two hybridizing RNA species, one of about the same size as the 1.9-kb human agmatinase cDNA and a larger molecular weight species of ~3.9 kb (Fig. 4). In contrast, only the smaller mRNA is found in rat and mouse. As shown in the preceding sections, the smaller mRNA is of sufficient size to encode a full-length agmatinase.


View larger version (16K):
[in this window]
[in a new window]
 
Fig. 3.   Relative abundance of agmatinase mRNA in human tissues. Real-time RT-PCR (Taqman) was used to determine levels of agmatinase in RNA samples purified from normal human tissues. For many tissues, two different donor samples were analyzed to indicate individual variation. Relative agmatinase expression was calculated based on the difference in the number of PCR cycles required to reach a threshold cycle (the Ct value) for human agmatinase and the human beta 2 microglobulin (hu beta 2M) endogenous control as described in MATERIALS AND METHODS. All values are plotted relative to the level of agmatinase mRNA in human vein, which was arbitrarily assigned a value of 1.0.



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 4.   Northern blot analysis of agmatinase mRNA in human and rat tissues. RNA samples from human liver (5 µg polyA+ RNA; lane 1), rat kidney (20 µg total RNA; lane 2), and rat liver (20 µg total RNA; lane 3) were subjected to Northern blot analyses using a [32P]cDNA (human agmatinase) probe as described in MATERIALS AND METHODS. Mobilities of the 28 and 18S rRNAs are indicated.

Changes in agmatinase activity or expression may be informative for elucidating the physiological or pathophysiological roles of this enzyme. Because agmatinase is strongly expressed in liver, we investigated whether its expression could be altered in this organ. We found that agmatinase mRNA is induced two- to threefold in HBV-infected liver (Fig. 5). This induction is cell autonomous, because agmatinase mRNA levels also are elevated in the human hepatoma cell line HepG2.2.15, which expresses infectious HBV (Fig. 5) (39). Immunohistochemical analysis and in situ hybridization revealed that agmatinase and HBV antigen were coexpressed within virtually all cells in the field, primarily parenchymal cells (Fig. 6).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 5.   Elevation of agmatinase mRNA in hepatitis B virus infected human liver (HBV-LIV) and human HepG2 cells stably transfected with HBV (HepG2.2.15). Levels of agmatinase mRNA were measured by real-time RT-PCR (Taqman) using the hu beta 2M gene as the endogenous control as described in Fig. 3 and MATERIALS AND METHODS. All values are plotted relative to the level of agmatinase mRNA in normal liver sample 3, which was arbitrarily assigned a value of 1.0.



View larger version (71K):
[in this window]
[in a new window]
 
Fig. 6.   Localization of agmatinase mRNA in human liver by in situ hybridization. Serial sections are from HBV-infected (A, C, and E) and control liver (B, D, and F). Shown are dark-field views of liver sections hybridized with antisense (A and B) or sense (C and D) probes for human agmatinase. Hybridization is indicated by bright white spots. E and F: sections of liver after immunohistochemical staining (in red) for HBV surface antigen are shown.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The existence of an alternate pathway for polyamine synthesis via ADC and agmatinase in mammals was discovered only recently (16, 17, 35). However, it has not been previously established that humans express either of these enzymes nor have these enzymes been characterized for any vertebrate species. As a first step in analyzing agmatine metabolism in humans, we set out to clone human agmatinase, identify the enzyme family to which it belongs, and characterize its expression in human tissues. A full-length human agmatinase cDNA was isolated, and an initial BLAST search of the EST databases with the human agmatinase sequence identified homologous sequences in rats, mice, pigs, and chickens (GenBank accession no. AF401291), indicating that this gene is expressed in a wide range of vertebrate species. Sequence alignments showed human agmatinase has significant similarity to bacterial agmatinases and thus is a member of the arginase superfamily (26, 38). The presence of key conserved residues indicates that human agmatinase likely requires two divalent manganese ions for full activity, as do the arginases and E. coli agmatinase (4, 8). More detailed studies of agmatinase structure and enzymatic properties will be useful in designing specific inhibitors that can be used in elucidating its physiological functions. On the basis of its general similarity to the NH3-termini of the precursor forms of mitochondrial type II arginases, the NH3-terminus of the human agmatinase ORF appears to represent a mitochondrial import/processing sequence. This also is consistent with the mitochondrial localization of agmatinase activity (35).

Although agmatinase is present in rodent tissues, including brain (35), liver (7), and a murine macrophage line (34), there is no published information on agmatinase expression in any human tissue. The present study shows that expression of agmatinase in humans is tissue specific, with the highest abundance of agmatinase mRNA in liver and kidney. The lower level of agmatinase mRNA in human brain likely represents high-level expression only in selected subpopulations of brain cells, consistent with reports of inhomogenous distribution of agmatinase activity in rat brain (35). The highest levels of agmatinase expression are not found in tissues with the highest rates of cell proliferation and turnover, suggesting that this enzyme does not serve the same role as ornithine decarboxylase. Instead, the primary function of agmatinase in organs with high expression may be to regulate levels of agmatine, which can act as a cell-signaling molecule. For example, agmatinase expression in liver may serve to limit the extent and duration of any increases in circulating levels of agmatine from endogenous or dietary sources. Because agmatine stimulates glomerular filtration rates in the kidney (18), renal expression of agmatinase may serve to modulate its effects in this organ. The presence of agmatinase in skeletal muscle may prevent inhibition of neuronal nitric oxide synthase, which can be irreversibly inactivated by agmatine (10). Similarly, the agmatinase in the brain likely modulates its activity as a cell-signaling molecule in that organ (33). Availability of a mammalian agmatinase cDNA will provide opportunities to begin testing these hypotheses.

Because the identification of circumstances and mechanisms involved in regulation of agmatinase expression will be important in establishing the physiological role(s) of this enzyme, we sought to identify cell culture models for studying regulation of agmatinase expression. Using primary cultures of rat hepatocytes readily responsive to cAMP and glucocorticoids (24), we found that levels of agmatinase mRNA were completely unaffected by these agents (results not shown), indicating that hepatic agmatinase expression is not regulated by hormonal signals commonly involved in responses to changes in diet or metabolic status. Because it expresses agmatinase and has increased agmatinase expression after infection with HBV, we identified the HepG2 hepatoma cell line as a potentially useful model for studying the regulation and function of hepatic agmatinase.

Regarding the increase in agmatinase expression after HBV infection, we note that HBV infection also upregulates another enzyme of arginine metabolism in human liver and in HepG2 cells, namely the inducible isoform of nitric oxide synthase (3, 19). Whether the elevated agmatinase expression is a direct effect of viral factors on agmatinase gene expression or is a secondary effect of the induced nitric oxide production remains to be determined. In any case, the elevated agmatinase expression may provide a source of polyamines for efficient viral replication (13, 28) and thus exacerbate the disease. If so, inhibition of hepatic agmatinase activity or expression could represent a new treatment strategy for patients with viral hepatitis. The possibilities described here are based on two assumptions: first, that increased agmatinase mRNA levels result in increased agmatinase activity. Although we believe this to be likely, it remains to be determined. The second assumption is that increases in agmatinase activity result in physiologically significant increases in polyamine production. Further experimentation is required also to test this assumption.

Physiological and pathophysiological roles of endogenous agmatine in mammals are poorly understood, in part, because relatively little is known regarding the location, regulation, and properties of the enzymes involved in synthesis and degradation of agmatine. Although most speculation as to the physiological roles of agmatinase in mammals has focused on its potential as a regulator of cell signaling via its catabolism of agmatine, it also is possible that a major function of this enzyme may be simply to participate in an alternate pathway for synthesis of putrescine regulated independently of ODC. These possibilities need not be mutually exclusive and one or the other function may predominate in different cell types. The availability of a cloned cDNA for human agmatinase provides exciting opportunities for elucidating new aspects of polyamine metabolism in health and disease.


    ACKNOWLEDGEMENTS

We are grateful to Dr. G. Zhu for providing yeast strains; Dr. M. Schmidt and R. McCartney for valuable advice on procedures involving yeast; D. Kepka-Lenhart for excellent technical assistance; Drs. P. R. Galle, Dr. F. Marra, and Dr. E. Graef for HBV-infected tissues and cells; Dr. H. Ruebsamen-Waigmann for valuable discussions and support; and numerous colleagues at Millennium Pharmaceuticals, particularly Dr. R. Curtis, P. Hales, Dr. L. Dick, Dr. J. Gutierrez, Dr. C. Bulawa, and Dr. M. Donovan.


    FOOTNOTES

This work was supported, in part, by National Institute of General Medical Sciences Grant GM57384 (to S. M. Morris, Jr.).

The human agmatinase cDNA sequence has been deposited in GenBank with accession no. AY057097.

Address for reprint requests and other correspondence: S. M. Morris, Jr., W1255 Biomedical Science Tower, Univ. of Pittsburgh, Pittsburgh, PA 15206 (E-mail: smorris{at}pitt.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajpgi.00386.2001

Received 30 August 2001; accepted in final form 1 October 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Abe, K, Abe Y, and Saito H. Agmatine suppresses nitric oxide production in microglia. Brain Res 872: 141-148, 2000[Web of Science][Medline].

2.   Altschul, SF, Gish W, Miller W, Myers EW, and Lipman DJ. Basic local alignment search tool. J Mol Biol 215: 403-410, 1990[Web of Science][Medline].

3.   Amaro, MJ, Bartolome J, and Carreno V. Hepatitis B virus X protein transactivates the inducible nitric oxide synthase promoter. Hepatology 29: 915-923, 1999[Web of Science][Medline].

4.   Ash, DE, Cox JD, and Christianson DW. Arginase: a binuclear manganese metalloenzyme. In: Metal Ions in Biological Systems, edited by Sigel A, and Sigel H.. New York: Dekker, 2000, p. 407-428.

5.   Auguet, M, Viossat I, Marin J-G, and Chabrier P-E. Selective inhibition of inducible nitric oxide synthase by agmatine. Jpn J Pharmacol 69: 285-287, 1995[Medline].

6.   Boyle, SM, Markham GD, Hafner EW, Wright JM, Tabor H, and Tabor CW. Expression of the cloned genes encoding the putrescine biosynthetic enzymes and methionine adenosyltransferase of Escherichia coli (speA, speB, speC and metK). Gene 30: 129-136, 1984[Web of Science][Medline].

7.   Cabella, C, Gardini G, Corpillo D, Testore G, Bedino S, Solinas SP, Cravanzola C, Vargiu C, Grillo MA, and Colombatto S. Transport and metabolism of agmatine in rat hepatocyte cultures. Eur J Biochem 268: 940-947, 2001[Web of Science][Medline].

8.   Carvajal, N, Lopez V, Salas M, Uribe E, Herrera P, and Cerpa J. Manganese is essential for catalytic activity of Escherichia coli agmatinase. Biochem Biophys Res Commun 258: 808-811, 1999[Web of Science][Medline].

9.   Carvajal, N, Olate J, Salas M, Lopez V, Cerpa J, Herrera P, and Uribe E. Evidence that histidine-163 is critical for catalytic activity, but not for substrate binding to Escherichia coli agmatinase. Biochem Biophys Res Commun 264: 196-200, 1999[Web of Science][Medline].

10.   Demady, DR, Jianmongkol S, Vuletich JL, Bender AT, and Osawa Y. Agmatine enhances the NADPH oxidase activity of neuronal NO synthase and leads to oxidative inactivation of the enzyme. Mol Pharmacol 59: 24-29, 2001[Abstract/Free Full Text].

11.   Florea, L, Hartzell G, Zhang Z, Rubin G, and Miller W. A computer program for aligning a cDNA sequence with a genomic DNA sequence. Genome Res 8: 967-974, 1998[Abstract/Free Full Text].

12.   Galea, E, Regunathan S, Eliopoulos V, Feinstein DL, and Reis DJ. Inhibition of mammalian nitric oxide synthases by agmatine, an endogenous polyamine formed by decarboxylation of arginine. Biochem J 316: 247-249, 1996.

13.   Gibson, W, van Breemen R, Fields A, LaFemina R, and Irmiere A. D,L-alpha -Difluoromethylornithine inhibits human cytomegalovirus replication. J Virol 50: 145-154, 1984[Abstract/Free Full Text].

14.   Gietz, D, St Jean A, Woods RA, and Schiestl RH. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res 20: 1425, 1992[Free Full Text].

15.   Klein, RD, Geary TG, Gibson AS, Favreau MA, Winterrowd CA, Upton SJ, Keithly JS, Zhu G, Malmberg RL, Martinez MP, and Yarlett N. Reconstitution of a bacterial/plant polyamine biosynthesis pathway in Saccharomyces cerevisiae. Microbiology 145: 301-307, 1999[Abstract/Free Full Text].

16.   Li, G, Regunathan S, Barrow J, Eshraghi J, Cooper R, and Reis DJ. Agmatine: an endogenous clonidine-displacing substance in the brain. Science 263: 966-969, 1994[Abstract/Free Full Text].

17.   Li, G, Regunathan S, and Reis DJ. Agmatine is synthesized by a mitochondrial arginine decarboxylase in rat brain. Ann NY Acad Sci 763: 325-329, 1995[Medline].

18.   Lortie, MJ, Novotny WF, Peterson OW, Vallon V, Malvey K, Mendonca M, Satriano J, Insel P, Thomson SC, and Blantz RC. Agmatine, a bioactive metabolite of arginine. Production, degradation, and functional effects in the kidney of the rat. J Clin Invest 97: 413-420, 1996[Web of Science][Medline].

19.   Majano, PL, Garcia-Monzon C, Lopez-Cabrera M, Lara-Pezzi E, Fernandez-Ruiz E, Garcia-Iglesias C, Borque MJ, and Moreno-Otero R. Inducible nitric oxide synthase expression in chronic viral hepatitis. Evidence for a virus-induced gene upregulation. J Clin Invest 101: 1343-1352, 1998[Web of Science][Medline].

20.   Morris, SM, Jr, Bhamidipati D, and Kepka-Lenhart D. Human type II arginase: sequence analysis and tissue-specific expression. Gene 193: 157-161, 1997[Web of Science][Medline].

21.   Morris, SM, Jr, Kepka-Lenhart D, and Chen LC. Differential regulation of arginases and inducible nitric oxide synthase in murine macrophage cells. Am J Physiol Endocrinol Metab 275: E740-E747, 1998[Abstract/Free Full Text].

22.   Morris, SM, Jr, Moncman CL, Rand KD, Dizikes GJ, Cederbaum SD, and O'Brien WE. Regulation of mRNA levels for five urea cycle enzymes in rat liver by diet, cyclic AMP, and glucocorticoids. Arch Biochem Biophys 256: 343-353, 1987[Web of Science][Medline].

23.   Morrissey, JJ, and Klahr S. Agmatine activation of nitric oxide synthase in endothelial cells. Proc Assn Am Phys 109: 51-57, 1997[Web of Science][Medline].

24.   Nebes, VL, and Morris SM, Jr. Regulation of messenger ribonucleic acid levels for five urea cycle enzymes in cultured rat hepatocytes. Requirements for cyclic adenosine monophosphate, glucocorticoids, and ongoing protein synthesis. Mol Endocrinol 2: 444-451, 1988[Abstract/Free Full Text].

25.  Nicholas KB and Nicholas HB Jr. GeneDoc: analysis and visualization of genetic variation, 1997 [Online]. Pittsburgh Supercomputing Center http://www.psc.edu/biomed/genedoc/ [2001, June 1].

26.   Perozich, J, Hempel J, and Morris SM, Jr. Roles of conserved residues in the arginase family. Biochim Biophys Acta 1382: 23-37, 1998[Medline].

27.   Raasch, W, Muhle H, and Dominak P. Modulation of MAO activity by imidazoline and guanidine derivatives. Ann NY Acad Sci 881: 313-331, 1999[Web of Science][Medline].

28.   Raina, A, Tuomi K, and Mantyjarvi R. Roles of polyamines in replication of animal viruses. Med Biol 59: 428-432, 1981[Web of Science][Medline].

29.   Regunathan, S, Feinstein DL, and Reis DJ. Anti-proliferative and anti-inflammatory actions of imidazoline agents. Are imidazoline receptors involved? Ann NY Acad Sci 881: 410-419, 1999[Web of Science][Medline].

30.   Regunathan, S, and Reis DJ. Characterization of arginine decarboxylase in rat brain and liver: distinction from ornithine decarboxylase. J Neurochem 74: 2201-2208, 2000[Web of Science][Medline].

31.   Regunathan, S, Youngson C, Raasch W, Wang H, and Reis DJ. Imidazoline receptors and agmatine in blood vessels: a novel system inhibiting vascular smooth muscle proliferation. J Pharmacol Exp Ther 276: 1272-1282, 1996[Abstract/Free Full Text].

32.   Reis, DJ, and Reganathan S. Agmatine: a novel neurotransmitter? Adv Pharmacol 42: 645-649, 1998.

33.   Reis, DJ, and Regunathan S. Is agmatine a novel neurotransmitter in brain? Trends Pharmacol Sci 21: 187-193, 2000[Medline].

34.   Sastre, M, Galea E, Feinstein D, Reis DJ, and Regunathan S. Metabolism of agmatine in macrophages: modulation by lipopolysaccharide and inhibitory cytokines. Biochem J 330: 1405-1409, 1998.

35.   Sastre, M, Regunathan S, Galea E, and Reis DJ. Agmatinase activity in rat brain: a metabolic pathway for the degradation of agmatine. J Neurochem 67: 1761-1765, 1996[Web of Science][Medline].

36.   Satriano, J, Matsufuji S, Murakami Y, Lortie MJ, Schwartz D, Kelly CJ, Hayashi S, and Blantz RC. Agmatine suppresses proliferation by frameshift induction of antizyme and attenuation of cellular polyamine levels. J Biol Chem 273: 15313-15316, 1998[Abstract/Free Full Text].

37.   Schwartz, D, Peterson OW, Mendonca M, Satriano J, Lortie M, and Blantz RC. Agmatine affects glomerular filtration via a nitric oxide synthase-dependent mechanism. Am J Physiol Renal Physiol 272: F597-F601, 1997[Abstract/Free Full Text].

38.   Sekowska, A, Danchin A, and Risler JL. Phylogeny of related functions: the case of polyamine biosynthetic enzymes. Microbiology 146: 1815-1828, 2000[Abstract/Free Full Text].

39.   Sells, MA, Chen ML, and Acs G. Production of hepatitis B virus particles in Hep G2 cells transfected with cloned hepatitis B virus DNA. Proc Natl Acad Sci USA 84: 1005-1009, 1987[Abstract/Free Full Text].

40.   Tabor, CW, and Tabor H. Polyamines. Annu Rev Biochem 53: 749-790, 1984[Web of Science][Medline].

41.   Thompson, JD, Higgins DG, and Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673-4680, 1994[Abstract/Free Full Text].

42.   Zhan, WL, and Guan KL. A specific protein-protein interaction accounts for the in vivo substrate selectivity of Ptp3 toward the Fus3 MAP kinase. Genes Dev 13: 2811-2827, 1999[Abstract/Free Full Text].


Am J Physiol Gastrointest Liver Physiol 282(2):G375-G381
0193-1857/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
B. Haenisch, I. von Kugelgen, H. Bonisch, M. Gothert, T. Sauerbruch, M. Schepke, G. Marklein, K. Hofling, D. Schroder, and G. J. Molderings
Regulatory mechanisms underlying agmatine homeostasis in humans
Am J Physiol Gastrointest Liver Physiol, November 1, 2008; 295(5): G1104 - G1110.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. L. Deignan, J. C. Livesay, L. M. Shantz, A. E. Pegg, W. E. O'Brien, R. K. Iyer, S. D. Cederbaum, and W. W. Grody
Polyamine homeostasis in arginase knockout mice
Am J Physiol Cell Physiol, October 1, 2007; 293(4): C1296 - C1301.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
S. M. Morris Jr.
Arginine Metabolism: Boundaries of Our Knowledge
J. Nutr., June 1, 2007; 137(6): 1602S - 1609S.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (27)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mistry, S. K.
Right arrow Articles by Morris, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mistry, S. K.
Right arrow Articles by Morris, S. M., Jr


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online