|
|
||||||||
Department of Medicine, Section of Digestive and Liver Diseases, University of Illinois at Chicago and Chicago Veterans Affairs Westside Division, Chicago, Illinois 60612
| |
ABSTRACT |
|---|
|
|
|---|
Na+/H+ exchanger
(NHE) isoforms NHE2 and NHE3, colocalized to the brush border membrane
of the epithelial cells, exhibit differences in their pattern of tissue
expression and regulation by various molecular signals. To investigate
the mechanisms involved in regulation of NHE3 gene expression, the
human NHE3 promoter region was cloned and characterized. Primer
extension experiments located the transcription start site to a
position 116 nucleotides upstream from the translation start codon. The
5'-flanking region lacked a CCAAT box but contained a TATA-like
sequence. Nucleotide sequencing of the 5'-flanking region revealed the
presence of a number of cis elements including Sp1, AP-2,
MZF-1, CdxA, Cdx-2, steroid and nonsteroid hormone receptor half sites,
and a phorbol 12-myristate 13-acetate-response element. Transient
transfection experiments using C2/bbe cell line defined a maximal
promoter activity in
95/+5 region. The regulatory response elements
clustered within this region include a potential transcription factor
IID (TF IID), a CACCC, two Sp1, and two AP-2 motifs. Deletion
of a fragment containing the AP-2 and Sp1 motifs resulted in a drastic
decrease in promoter activity. In gel mobility shift assays, an
oligonucleotide spanning from
78 to
56 bp bound a recombinant AP-2,
and the corresponding binding activity in nuclear extracts was
supershifted with anti-AP2
antibody. Our studies suggest that the
NHE3 expression is regulated by a combination of cis
elements and their cognate transcription factors that include the AP-2
and Sp1 family members.
nucleotide sequence; transcription factor binding sites; deletion analysis; c2/bbe; transfection
| |
INTRODUCTION |
|---|
|
|
|---|
THE NA+/H+ EXCHANGERS (NHE) catalyze the electroneutral exchange of one extracellular Na+ for one intracellular H+ across the plasma membrane and play a role in various important cellular functions that include sodium absorption, maintenance of intracellular pH and cell volume, and regulation of cell proliferation (for a review, see Refs. 1, 12, 31, 41, and 42). To date, at least six members of the NHE gene family have been identified and characterized with regard to their localization to specific sites in the cell and function of the corresponding protein products (4, 8, 21, 30, 32, 38, 40, 44). For example, the NHE1 isoform was shown to be ubiquitous in its expression and localized to the basolateral membrane of polarized epithelial cells, whereas the NHE2 and NHE3 isoforms are localized to the apical membrane. The NHE4 and NHE5 isoforms are expressed in the kidney and neural tissues, respectively, whereas the recently cloned NHE6 isoform is mitochondrial. Although extensive studies have recently been carried out investigating the regulation of the NHE1 and NHE3 protein products by phosphorylation and interaction with cytoplasmic regulatory proteins (37, 43, 45), only limited studies have been reported on the transcriptional regulation of the NHE isoforms. Studies focused on the NHE1 isoform have demonstrated the regulation of NHE1 gene at the transcriptional level by external acid, growth factors, serum, and retinoic acid (35, 48, 49). The involvement of AP-1, AP-2, and other cis elements in the 5'-flanking region of the NHE1 isoform has been reported (13, 14, 26). Among the other NHE isoforms, the promoter sequences for the human and rat NHE2 (22, 28) and the rat NHE3 isoform (9, 19) have been identified, and transcriptional regulation of the rat NHE3 by glucocorticoids and thyroxin has been reported (9, 10, 19). However, transcriptional regulation of the human NHE2 and NHE3 isoforms has not been studied.
We have recently reported the genomic organization and cloning of the human NHE2 gene and its promoter (22, 23). Our studies described here report, for the first time, the molecular cloning of the human NHE3 promoter, and they demonstrate the presence of a number of cis-acting elements that may be involved in regulation of the human NHE3 isoform. We defined a minimal promoter region that contains the maximal promoter activity in C2/bbe cell line and showed that deletion of a DNA fragment containing the binding sites for the transcription factors AP-2 and Sp1 results in a drastic loss of promoter activity. By footprinting experiments, we have shown that AP-2 binds to two regions in the NHE3 promoter. The AP-2 interaction with the proximal AP-2 binding site was confirmed with gel mobility shift assay and supershift analysis. This work provides the initial framework for further studies and understanding the molecular mechanisms responsible for regulation of NHE3 gene expression.
| |
METHODS |
|---|
|
|
|---|
Materials.
All chemicals were purchased from Fisher Scientific (Pittsburgh, PA) or
Sigma (St. Louis, MO); restriction endonucleases and other modifying
enzymes were from either New England Biolabs (Beverly, MA), Gibco-BRL
(Gaithersburg, MD), or Promega (Madison, WI); polyclonal anti-human
AP-2
, monoclonal anti-human Sp1, Sp2, and Sp3 antibodies were from
Santa Cruz Biotechnology (Santa Cruz, CA); plasmid PCR-II, a TA cloning
vector, was from Invitrogen (San Diego, CA); JM109 competent cells and
luciferase assay system were from Promega.
Molecular techniques. DNA manipulations, including restriction enzyme digestion, ligation, plasmid isolation, and transformation were carried out by standard methods (2).
RNA extraction and PCR analysis. Total RNA was extracted by the RNAzol method (Tel-Test, Friendswood, TX) according to the manufacturer's directions. PCR was performed in a Perkin-Elmer/Cetus DNA cycler, with thermostable DNA polymerase rTth (Boehringer Mannheim, Indianapolis, IN) according to the manufacturer's directions.
Cloning of the 5'-flanking region. The 5'-regulatory region of the NHE3 gene was cloned using the Genome Walker kit (Clontech Laboratories, Palo Alto, CA). PCR amplifications were performed with genomic DNA fragment pools as template, anchor primers AP1 or AP2 that hybridize to the 5'-end of the genomic fragments, and gene-specific primers GI-318 (5'-AGAGCGCGATGACGTAGGGATCC-3') or GI- 358 (CCCGAGTCCCCACATTGCCGCCTGC) (8). This resulted in amplification of a 1.6-kb DNA fragment. This fragment was cloned in pCR-II cloning vector (Invitrogen) after gel purification and designated pJM1.6N3. Subsequently, with the use of primers synthesized based on the nucleotide sequences of the insert in pJM1.6-N3, a larger fragment (3.0 kb) of the 5'-flanking region was amplified and cloned in pCR-II (pJM3.0 N3). DNA nucleotide sequences at the 3'-end of the 3.0-kb fragment were determined using the dideoxy chain termination method (36) and compared with the hNHE3 cDNA. This confirmed that the 3.0-kb fragment represented the 5'-flanking region of the NHE3 gene.
Reporter plasmid construction.
Plasmids used for functional analysis of the NHE3 promoter activity
were generated using pGL2-basic (Promega), that contains a promoterless
luciferase reporter gene. To clone the 1.6-kb NHE3 promoter DNA
fragment, the insert in pJM1.6N3 was released with restriction enzyme
EcoR I, and the ends were filled in with Klenow. Following
gel purification, this DNA fragment was cloned upstream from the
luciferase structural gene in pGL2-basic that was blunt-ended at the
Hind III site. The clone that carries the promoter in
forward direction was named p1.6 N3P. The plasmid carrying the promoter in reverse direction, p1.6N3P-Rev, was constructed by digesting the
pJM1.6 N3 with restriction enzymes Xho I plus
Hind III and ligating with pGL2-basic digested with the same
enzymes. With the use of restriction enzyme recognition sites from the
NHE3 promoter sequence, chimeric plasmids containing progressive
deletions of the NHE3 gene 5'-flanking region were generated. The
plasmid containing the
1004/+131 insert was constructed by subcloning a Sac I-Xho I fragment from p1.6 N3P-Rev into
pGL2-basic digested with the same enzymes. Plasmids harboring the
319/+131 and
95/+131 sequences were generated by digestion of p1.6
N3P-Rev with Pvu II plus Xho I and Nru
I plus Xho I, respectively, and cloning in pGL2-basic
that was digested with Sma I plus Xho I. Plasmid containing the sequences from +2/+131 was constructed by deletion of a
Kpn I fragment from p-1004/+131. Plasmid p-95/+5 was
generated by digestion of p-95/+131 with restriction enzymes
Acc65 I plus Hind III, blunting the ends and
religation. Plasmids p-43/+131 and p(
187/
43) were
constructed by deletion of Sac I-Sac II and
Sac II fragments from p-1004/+131, respectively.
Primer extension analysis.
The transcription initiation site of the human NHE3 gene was determined
by primer extension using SuperScript II RT (Gibco-BRL). An antisense
oligonucleotide complementary to nucleotides +40 to +67 (see Fig. 3)
was synthesized and end-labeled with [
-32P]ATP and T4
polynucleotide kinase. Free [
-32P]ATP was removed by
using mini Quick Spin Oligo Columns (Boehringer Mannheim). For primer
extension reaction, 105 counts/min (cpm) of the
end-labeled oligonucleotides and 15 µg of total RNA from C2/bbe cells
were coprecipitated and dissolved in diethyl
pyrocarbonate-treated water, heated at 75°C for 5 min, and
brought to 42°C. The reaction was complemented with 200 µM dNTPs
and reaction buffer to a final concentration of 100 mM
Tris · HCl (pH 8.3), 150 mM KCl, 6 mM MgCl2, 10 mM
1,4-dithiothreitol (DTT), and 200 units of SuperScript II in a reaction
volume of 20 µl. The primer extension was carried out for 60 min at
42°C. The extension products were phenol-chloroform extracted,
ethanol precipitated, and pelleted nucleic acids were dissolved in stop solution (US Biochemicals). The samples were heated at 90°C for 3 min
and analyzed on a 6% polyacrylamide, 7 M urea denaturing gel. The gel
was dried and exposed to X-Omat AR film. A sequencing ladder was used
as a size marker to determine the size of the extended primer.
Cell culture and transfections.
C2/bbe cell line, a subclone of the Caco-2 cells, was cultured and
maintained as described (22). For transfection studies, cells (1.8 × 105) were seeded into 12-well plates and
cotransfected 24 h later (80-90% confluent) with one of the
NHE3-luc constructs and pRSV-
gal using Lipofectamine Plus reagent
(Gibco-BRL). The latter plasmid served as an internal control for
transfection efficiency. A total of 2.0 µg DNA/well, at a ratio of
4:1 for experimental vs. pRSV-
gal, was used for each transfection.
After 48 h, cells were washed with phosphate-buffered saline and
lysed using a kit from Promega. Luciferase activity was assayed using a
luminometer (Promega) and normalized to
-galactosidase activity.
DNase I footprinting analysis.
To prepare probes for footprinting experiments, the plasmid p1.0N3P was
digested with Kpn I restriction enzyme. DNA fragments were
end-labeled after dephosphorylation with calf alkaline phosphatase using polynucleotide kinase and [
-32P]ATP and then
digested with NruI or Pvu II in two separte
reactions. The labeled probes were purified on a 6% native
polyacrylamide gel. DNase I footprinting analysis was
performed using a kit from Promega, as per instructions. Briefly,
20,000 cpm of end-labeled probe were incubated in 25 µl of binding
buffer (10 mM Tris · HCl, pH 7.5, 50 mM NaCl, 0.05% Nonidet
P-40, 1 mM EDTA, 1 mM DTT, and 10% glycerol) for 10 min on ice in
presence or absence of 2 µl AP-2 extract. Fifty microliters of a
solution of Ca+2 and Mg+2 were added, and
incubation was continued for 1 min at room temperature. The reaction
mixtures were treated with 3 µl of diluted QRI (RNase-free DNase from
Promega) for 1 min at room temperature, and further digestion
was stopped by addition of 90 µl stop solution. The pellet was
suspended in loading buffer after phenol/chloroform (1:1) extraction
and ethanol precipitation, denatured by heating at 95 °C for 3 min,
and analyzed on a 6% sequencing gel. The gel was dried and autoradiographed.
Gel mobility shift assay.
All oligonucleotides for gel mobility shift assay (GMSA) were
synthesized by Gibco-BRL. Complementary oligonucleotides were made
double-stranded by heating to 95°C for 5 min and slow cooling to
25°C in TE buffer (10 mM Tris · HCl, pH 7.5, 1 mM
EDTA). The single-stranded sequence of the AP-2 probe was
5'-GGCTCCGCCCCGGGGCGGGAGGG-3', where homology to consensus
sequence is shown in bold letters. Nuclear proteins were prepared
essentially as previously described (2). Protein/DNA
binding reactions were performed in binding buffer [50 mM
Tris · HCl (pH 7.5), 1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, 1 µg/sample poly(dI.dC)-poly(dI.dC), 4%
glycerol] and 30,000 cpm of the probe. Reactions were initiated by
addition of the nuclear proteins (3-5 µg) and incubation for 20 min at room temperature before electrophoresis on a native 4%
polyacrylamide gel in 0.5× TBE running buffer (45 mM Tris
borate, 1 mM EDTA, pH 8.3). Gels were dried and visualized by
autoradiography. In competition assays, the unlabeled competitor
oligonucleotide was added to the reaction 10 min before the addition of
the labeled probe. Supershift assays were performed by addition of 1 µl of the AP-2
antibody (Santa Cruz Biotechnology) after the
initial 20-min incubation with the labeled probe and then further
incubation for 30 min at room temperature.
| |
RESULTS |
|---|
|
|
|---|
Cloning of the human NHE3 promoter. With the use of the genome walking technique, we cloned a 3.0-kb DNA fragment upstream of the human NHE3 translation initiation codon. Nucleotide sequence analysis of the 3'-end of this clone confirmed that the cloned DNA fragment overlaps with the 5'-end of the hNHE3 cDNA reported previously (8).
The NHE3 promoter fragment directs luciferase activity in the C2/bbe cell line. We have chosen to use the human intestinal epithelial cell line C2/bbe as a model to study the functional and molecular characteristics of the human NHE3 promoter. The C2/bbe cell line is a subclone derived from a heterogeneous population of the Caco-2 cells and has been shown to undergo spontaneous differentiation, as determined by exhibiting characteristics of the microvilli and the presence of the markers of differentiation (33). In a previous study (22), by using RT-PCR analysis, we have established that C2/bbe cells express NHE1, NHE2, and NHE3 mRNA. However, the endogenous level of NHE3 protein expression as assessed by Western blots seems to be very low in these cells, becuase NHE2 is readily detected but not NHE3 (25). Recent studies (29) from the same group indicated that treatment with short-chain fatty acids resulted in augmentation of the NHE3 activity and protein expression in C2/bbe cell line.
A 1.6-kb fragment of the promoter/enhancer region was cloned in both orientations upstream from the luciferase reporter gene, and the luciferase activity of the chimeric constructs, which is a direct measure of the promoter activity, was measured in transiently transfected C2/bbe cells. As shown in Fig. 1, the forward orientation, pJM1.6N3P, reproducibly showed a marked increase in luciferase gene expression compared with the pGL2-basic vector. No luciferase activity over the background level was obtained for reverse construct, pJM1.6 N3P-Rev, indicating that the promoter activity was orientation dependent.
|
Identification of the transcription initiation site.
To map the transcription initiation site of the NHE3 gene, we employed
primer extension analysis. A 29-mer oligonucleotide complementary to
the sense strand at position +40 to +67 (Fig. 3) was used as an
extension primer. Total RNA from the C2/bbe cells was hybridized with
this end-labeled primer and subjected to reverse transcription.
Extension products were analyzed on sequencing gel. A 67-nucleotide
primer extension product was identified where C2/bbe RNA was used in
the reaction (Fig. 2, lane 1),
whereas no signal was found in control yeast transfer RNA (Fig. 2,
lane 2). On the basis of this observation, the transcription
initiation site of the human NHE3 gene was assigned to a deoxyguanosine
residue, 116 nucleotides upstream from the translation initiation site. This site was designated +1, the start of transcription initiation.
|
DNA Sequence and characterization of the 5'-flanking region of
NHE3.
The nucleotide sequence of the 1.6-kb NHE3 promoter fragment was
determined and is shown in Fig. 3
(GenBank accession no. AF282824). Between the ATG translation in start
codon and the transcription initiation site lie the NHE3 minicistron
(8) and the 5'-untranslated region of 83 nucleotides. Two
sets of directly repeated sequences composed of penta- and decamer were observed downstream from the transcription initiation site (Fig. 3).
|
319 to the ATG translation start site at +117 has an overall G+C content of 80%. The
nucleotide sequence of the 1.6-kb promoter fragment was screened for
potentially important cis elements. The putative response elements found within this region are indicated in Fig. 3. A TATA boxlike sequence, GATTAAA, is located at position
40, whereas no
CCAAT box were found in close vicinity of the transcription initiation
site. However, a cluster of binding sites for a number of transcription
factors is present immediately upstream of the transcription start
site. These include binding sites for Sp1 (
25 to
12,
69 to
72,
84 to
72, and
142 to
130); AP-2 (
17 to
28 and
56 to
67); CACCC (
32 to
27); MZF-1 (
22 to
14); TF IID (
41 to
35). Further upstream, several other potentially important sites were
identified such as AP-4/E47/MyoD, PEA3, CCAAT, Cdx-2, and cAMP-response
element binding site. Moreover, putative cis elements for
TRE and 1/2 sites for GRE were also identified in this region.
The rat NHE3 promoter has been cloned and sequenced by two different
groups (9, 19). Some of the cis elements
identified in the human NHE3 promoter region are also present in the
rat gene. Given these similarities, we compared the DNA nucleotide sequences of the 5'-nontranscribed regions of these promoters (Fig.
4). The sequence of the human NHE3
proximal promoter region (
100 to +1) was 79% identical to that of
the rat sequence. The consensus sequences for Sp1, TF IID, and CACCC
were present in similar positions in the two species in this region.
However, there were other cis elements for different
transcription factor binding sites that are unique in each promoter
(Fig. 4), suggesting that different mechanisms may be involved in the
expression of NHE3 in these species. The overall sequence homology was
38%, and no obvious regional sequence identities were found with this homology search in the upstream region.
|
5'-Deletion analysis of the NHE3 promoter in C2/bbe cells.
To identify the promoter regions that were involved in directing NHE3
gene expression, luciferase reporter constructs carrying serially
truncated segments of the 5'-flanking region were generated in
pGL2-basic vector. Figure 5 shows a
comparison of the luciferase activity between deletion constructs. The
full-length promoter construct, p3.0N3P (
2900 to +131), exhibited a
20-fold activation of the luciferase activity compared with the
promoterless vector. The deletion of sequences from
2900 to
1507 bp
led to a 40-fold increase in promoter activity compared with
promoterless vector, suggesting that an inhibitory element may be
located at this region. Further deletion from
1507 to
1004 did not
show a significant difference in the luciferase activity. However, more
extensive deletions to positions at
319 and
95 bp resulted in
~50- and 65-fold increases in promoter activity compared with the
vector or 2.6- and 3.2-fold over the full-length promoter construct, respectively. The moderate increase in luciferase activity in plasmid
containing
319/+131 bp compared with the previous truncated construct
may also be attributed to the loss of a suppressor cis element contained within the deleted DNA region. A number of
putative response elements are located within this region (Fig. 3), and whether any of these regulatory factor(s) is involved in
transcriptional repression of the NHE3 promoter is not clear at this
point. As shown in Fig. 5, the construct containing sequences
95 to
+5 bp contained the highest luciferase activity.
|
Transcriptional activity of the
1004/+131 construct after
deletion of AP-2 and Sp1.
We examined the importance of the sequences in the proximal promoter
region by introducing an internal deletion that removed a 144-bp
Sac II fragment immediately upstream from the putative TF
IID-like binding site. A schematic drawing of the cis
elements contained within the deleted region is shown in Fig.
6, top, and includes an
overlapping Sp1/Egr-1, Sp1, and an overlapping Sp1/AP-2 motif.
Expression of this deletion construct (
187 to
43) in C2/bbe
cells resulted in a 75% decrease in the basal level of NHE3
transcription compared with the parental construct (
1004/+131; Fig.
6), indicating a critical role for this region in NHE3 promoter expression. When the sequences upstream from nucleotides
43 (Fig. 6,
43/+131) or +2 (+2/+131; Fig. 6) were removed, the level of luciferase activity dropped to the background level, suggesting that
sequences downstream from the
43 position alone do not contribute to
transcription activity of the NHE3 gene. However, deletion of sequences
between +5 to +131 had a positive effect on the reporter gene
expression, as shown by a 25% increase in luciferase activity of the
95/+5 construct compared with
95/+131 construct (Fig. 6). Thus
these observations indicate that the smallest promoter fragment
containing sequences between
95 to +5 promotes the maximal luciferase
activity and that all of the cis elements required for
optimal NHE3 promoter activity are present in the first 95 nucleotides
of the 5'-flanking region.
|
51 to
71 and another
site at
176 to
198. The role of the proximal AP-2 binding site in
the NHE3 gene expression was explored further by GMSA.
|
The transcription factor AP-2 Binds to the NHE3 proximal promoter.
A perfect match to the consensus AP-2 binding site (5'-GCCCNNNGGC-3')
(47) is located in the proximal footprint shown in Fig. 7.
Labeled oligonucleotides spanning this AP-2 element at
67 to
56 bp,
N3-Ap2, were coupled with AP-2 extract (Promega) and analyzed by GMSA.
As illustrated in Fig.
8A,
lane 2, a single DNA/protein complex was detected (shown by
an arrow). To determine the specificity of this DNA/protein complex, an
excess of 100- and 200-fold unlabeled N3-AP2 oligonucleotide was used
as a competitor. This resulted in the elimination of the DNA/protein
complex (Fig. 8A, lanes 3 and 4),
whereas inclusion of an unlabeled nonspecific oligonucleotide as a
competitor did not affect the complex formation (lanes 5 and
6). With the use of a labeled oligonucleotide containing the
consensus sequence for AP-2 transcription factor binding site as a
probe (Promega), a complex was formed (lane 7) that migrated at the same position as that of the N3-AP2 probe. This DNA/protein complex was competed away with unlabeled N3-AP2 oligonucleotide (lanes 7 and 8). Gel mobility shift assays were
also performed with nuclear extracts from three human intestinal cell
lines: Caco-2, T84, and C2/bbe. The nuclear extracts of all
three cell lines contained the same binding activity with N3-Ap2 probe,
which migrated at the same positions. The result of GMSA with the
C2/bbe nuclear extract is shown in Fig. 8B, lanes
5-8. To confirm the identity of the protein in this complex,
we performed supershift experiments using antibody against AP-2
. As
shown in Fig. 8B, lane 3, the DNA/protein complex
formed by AP-2 extract was shifted completely, whereas the complex
formed by C2/bbe nuclear proteins (lane 6) was shifted only
partially. The identity of the remaining unshifted protein in not clear
at this time, but it may be another protein interacting with this
probe, or it could be the residual AP-2 that is not coupled with the
antibody. These data confirm that Ap-2
is one of the transcription
factors from C2/bbe nuclear proteins that interact with the NHE3
promoter.
|
| |
DISCUSSION |
|---|
|
|
|---|
Members of NHE gene family exhibit highly restricted temporal and
spatial expression patterns. NHE2 and NHE3 isoforms are expressed at
the apical membranes of the epithelial cells, where they play a major
role in transepithelial Na+ absorption. To better
understand the mechanisms underlying the regulation of the apical
membrane NHE isoforms, we have focused our studies on the
transcriptional regulation of the human NHE2 and NHE3. Previously we
(22) have reported the cloning and preliminary characterization of the human NHE2 promoter. In the current study, we
have cloned and identified the human NHE3 promoter region. Primer
extension analysis identified a transcription initiation site 116 nucleotides upstream from the translation start codon. Nucleotide
sequence analysis of the 1.6-kb promoter region revealed multiple
potential cis-acting elements upstream from the
transcription initiation site. These included Sp1, AP-2, Cdx-2, Mzf-1,
MyoD, Egr-1, glucocorticoid, and thyroid hormone receptor binding
sites. A CCAAT box sequence was not present in the immediate vicinity of the transcription initiation site, but a TATA-like sequence was
found at approximately the
40 position. These features and also the
presence of a highly GC-rich region surrounding the
transcription initiation site in conjunction with multiple Sp1
cis elements in this region may suggest a housekeeping role
for the NHE3 gene. However, NHE3 promoter also contains features common
in regulated genes. This is evident by the presence of the potential
transcription factor binding sites that mediate tissue-specific and
developmental regulation of the regulated genes. For example, the
presence of Cdx-2, which is involved in gene expression and
differentiation in the intestine (39), MyoD, which is
implicated in myocyte differentiation (7), and Mzf-1,
which is involved in erythrocyte-specific gene expression and
regulation (27) would suggest developmental expression and
tissue-specific regulation of this isoform.
Deletion of a 1.5-kb fragment from the 5'-flanking region of the NHE3
promoter showed that the deleted region had a marked inhibitory effect
on the expression of the luciferase gene. Moreover, further deletions
toward the transcription initiation site also resulted in augmentation
of the luciferase activity of the corresponding reporter constructs
(Fig. 4). Although the elements responsible for the inhibitory effect
have not been defined, the increase in the luciferase activity of the
5'-deletion reporter constructs argues that the upstream region
contains repressive functions. The physiological role of the negative
regulatory elements in the NHE3 promoter remains to be determined. One
possibility is that it could mediate the divergent levels of the NHE3
gene expression seen in various tissues (8). Further
deletions revealed that the region between
95 and +131 contained the
highest luciferase activity. This region contained three potential Sp1,
two AP-2, and also an atypical TATA cis element. When the +5
to +131 DNA region was eliminated, the luciferase activity of the new
construct was increased ~25% (Fig. 5), suggesting that the
nucleotide sequence between transcription initiation site and the
translation start codon may be involved in the repression of NHE3
promoter activity. The exon-1 sequence in this region harbors the NHE3
minicistron (8), two sets of direct repeat elements (Fig.
3), and a number of potential transcription factor binding sites (data
not shown). Whether these motifs are responsible for the inhibitory
effect residing in the +5/+131 region is not known at the present. A deletion from
95 to
43, which includes the Sp1 and AP-2 cis elements resulted in a total loss of reporter plasmid activity, suggesting the importance of the Sp1 and AP-2 transcription factors for
the hNHE3 gene expression in C2/bbe cells.
A comparison of the human and the rat (19) NHE3 promoter
sequences in the nontranscribed region exhibited that the sequence identity of the two promoters was confined to the vicinity of the
transcription initiation site (Fig. 4). This region coincides with the
human NHE3 promoter region (
95/+1) that drives the maximal luciferase
activity in promoter-reporter transfection assays (Fig. 6). The
consensus is that Sp1, AP-2, and TATA-like sequences appeared at the
same positions in both species in this region. However, there were
other potential cis elements for different transcription factor binding sites that are unique in each promoter (Fig. 4), suggesting that different mechanisms may be involved in the expression of NHE3 in these species and may offer a clue to the mechanisms by
which the NHE3 gene is regulated.
Transcriptional regulation of the NHE3 gene by various agents is likely
to be mediated by trans-acting factors that bind to the
promoter region. Glucocorticoids have been shown to increase NHE3 mRNA
levels (9, 19, 50). Thyroid hormone has also been reported
to activate NHE3 transcription (10). Phorbol 12-myristate 13-acetate on the other hand showed inhibitory effects on expression of
NHE3 gene (3, 16, 20). Ontogenic increase in
Na+/H+ exchange activity that correlated with
the increasing levels of NHE3 mRNA and protein abundance has been
reported (5, 11). In addition, postnatal administration of
glucocotricoids and thyroid hormone was shown to increase NHE3 mRNA and
protein levels during maturation (5, 6). We have
identified a potential binding site for T3R at position
211 to
198 and many half sites for glucocorticoid
receptor binding on the NHE3 promoter region. These sites may be
responsible for mediating the stimulatory effects of thyroid hormone
and glucocorticoids shown in the studies mentioned above. Furthermore,
it appears that at least two Sp1 and AP-2 cis-acting
elements in the proximal promoter region control the basal
transcription activity. AP-2 transcription factor modulates the
expression of many genes as an activator (13, 18) or as a
repressor (17). The ability of the recombinant AP-2
transcription factor to physically interact with the NHE3 promoter
region was established by DNase I footprinting experiments
(Fig. 7) and GMSA (Fig. 8). AP-2 transcription factor binds to at least
two regions in the NHE3 promoter. The proximal binding site at the
51
to
71 position is contained within the
95/+1 promoter fragment. Interaction of AP-2 with this motif was shown by GMSA and confirmed by
supershift experiments where an antibody against AP-2
was utilized.
Deletion of this AP-2 cis element along with the upstream Sp1 binding sites resulted in the loss of promoter activity of the
corresponding reporter construct, alluding to the potential functional
importance of AP-2 and Sp1 in transcription activation of the NHE3
promoter. The second AP-2 binding motif at
179 to
199 was not
readily identified by homology search due to its lower sequence
identity to the AP-2 consensus sequence; however, this region was
clearly protected from DNase I digestion by interactions with the AP-2 protein. Dyck et al. (13) have shown that
the AP-2 transcription factor is involved in the activation of the mouse NHE1 gene. The expression of AP-2 is increased on cell
differentiation and is regulated in a cell-type specific manner
(46). Our RT-PCR analysis of RNA isolated from C2/bbe
cells grown for 1, 3, 7, 14, and 21 days postplating exhibited
increasing levels of NHE3 mRNA expression on cell differentiation (J. Malakooti and K. Ramaswamy, unpublished data). In addition, Janecki and
co-workers (15) have reported that the NHE3 gene activity
increases during Caco-2 cell differentiation. Therefore, in light of
these observations, it is tempting to speculate that the increased
expression of NHE3 gene might be linked to increased AP-2 levels;
however, this theory remains to be proven experimentally.
In summary, to understand how the apical Na+/H+
exchanger isoforms are regulated, we have located and isolated the
human NHE3 gene promoter. Our studies showed that the NHE3 promoter has
potential binding sites for a number of nuclear proteins. According to
the transient transfection assays in a luciferase-reporter system, the
first 95 nucleotides upstream from the transcription initiation site of
the NHE3 promoter hold the majority of the transcriptional activity of
the NHE3 promoter. The
95/+1 fragment contains two overlapping Sp1
sites, one on the sense and the other on the antisense strands, of
which the latter also overlaps with the AP-2 site. Deletion of a
portion of the promoter that includes the binding sites for the Sp1 and
AP-2 motifs resulted in a drastic decrease in the promoter activity. We
showed by footprinting and GMSA assays that AP-2 interacted with this
promoter region. Additional studies are underway to better understand
how Sp1 family members interact with the NHE3 promoter region and how
the overlapping Sp1 and AP-2 binding sites contribute to the expression
of the NHE3 gene. The overlapping Sp1 and AP-2 binding sites have been
reported to be involved in gene regulation in other systems (24,
34). Therefore, this region might prove to be important for
expression of the NHE3 gene.
| |
ACKNOWLEDGEMENTS |
|---|
We thank R. Dahdal for technical help.
| |
FOOTNOTES |
|---|
This study was funded by the National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-33349 and by the Dept. of Veterans Affairs.
Address for reprint requests and other correspondence: J. Malakooti, Univ. of Illinois at Chicago, Dept. of Medicine, Section of Digestive and Liver Diseases, M/C 716, 840 S. Wood St., Chicago, IL 60612 (E-mail address: malakoot{at}uic.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajpgi.00273.2001
Received 20 June 2001; accepted in final form 5 November 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Aronson, PS.
Kinetic properties of the plasma membrane Na+-H+ exchanger.
Annu Rev Physiol
47:
545-560,
1985[Web of Science][Medline].
2.
Ausubel, FM,
Brent R,
Kingston RE,
Moore DD,
Seidman JG,
and
Struhl K
(Editors).
Current Protocols in Molecular Biology. New York: Wiley, 1995.
3.
Azarani, A,
Goltzman D,
and
Orlowski J.
Parathyroid hormone and parathyroid hormone-related peptide inhibit the apical Na+/H+ exchanger NHE3 isoform in renal cells (OK) via a dual signaling cascade involving protein kinase A and C.
J Biol Chem
270:
20004-20010,
1995
4.
Baird, NR,
Orlowski J,
Szabo EZ,
Zaun HC,
Schultheis PJ,
Menon AG,
and
Shull GE.
Molecular cloning, genomic organization, and functional expression of Na+/H+ exchanger isoform 5 (NHE5) from human brain.
J Biol Chem
274:
4377-4382,
1999
5.
Baum, M,
Biemesderfer D,
Gentry D,
and
Aronson PS.
Ontogeny of rabbit renal cortical NHE3 and NHE1: effect of glucocorticoids.
Am J Physiol Renal Fluid Electrolyte Physiol
268:
F815-F820,
1995
6.
Baum, M,
Dwarakanath V,
Alpern RJ,
and
Moe OW.
Effects of thyroid hormone on the neonatal renal cortical Na+/H+ antiporter.
Kidney Int
53:
1254-1258,
1998[Web of Science][Medline].
7.
Blackwell, TK,
and
Weintraub H.
Differences and similarities in DNA-binding preferences of MyoD and E2A protein complexes revealed by binding site selection.
Science
250:
1104-1110,
1990
8.
Brant, SR,
Yun CH,
Donowitz M,
and
Tse CM.
Cloning, tissue distribution, and functional analysis of the human Na+/H+ exchanger isoform, NHE3.
Am J Physiol Cell Physiol
269:
C198-C206,
1995
9.
Cano, A.
Characterization of the rat NHE3 promoter.
Am J Physiol Renal Fluid Electrolyte Physiol
271:
F629-F636,
1996
10.
Cano, A,
Baum M,
and
Moe OW.
Thyroid hormone stimulates the renal Na/H exchanger NHE3 by transcriptional activation.
Am J Physiol Cell Physiol
276:
C102-C108,
1999
11.
Collins, JF,
Xu H,
Kiela PR,
Zeng J,
and
Ghishan FK.
Functional and molecular characterization of NHE3 expression during ontogeny in rat jejunal epithelium.
Am J Physiol Cell Physiol
273:
C1937-C1946,
1997
12.
Counillon, L,
and
Pouyssegur J.
The expanding family of eucaryotic Na+/H+ exchangers.
J Biol Chem
275:
1-4,
2000
13.
Dyck, JR,
Silva NL,
and
Fliegel L.
Activation of the Na+/H+ exchanger gene by the transcription factor AP- 2.
J Biol Chem
270:
1375-1381,
1995
14.
Horie, S,
Moe O,
Yamaji Y,
Cano A,
Miller RT,
and
Alpern RJ.
Role of protein kinase C and transcription factor AP-1 in the acid-induced increase in Na+/H+ antiporter activity.
Proc Natl Acad Sci USA
89:
5236-5240,
1992
15.
Janecki, AJ,
Montrose MH,
Tse CM,
de Medina FS,
Zweibaum A,
and
Donowitz M.
Development of an endogenous epithelial Na+/H+ exchanger (NHE3) in three clones of caco-2 cells.
Am J Physiol Gastrointest Liver Physiol
277:
G292-G305,
1999
16.
Janecki, AJ,
Montrose MH,
Zimniak P,
Zweibaum A,
Tse CM,
Khurana S,
and
Donowitz M.
Subcellular redistribution is involved in acute regulation of the brush border Na+/H+ exchanger isoform 3 in human colon adenocarcinoma cell line Caco-2. Protein kinase C-mediated inhibition of the exchanger.
J Biol Chem
273:
8790-8798,
1998
17.
Jiang, JG,
DeFrances MC,
Machen J,
Johnson C,
and
Zarnegar R.
The repressive function of AP2 transcription factor on the hepatocyte growth factor gene promoter.
Biochem Biophys Res Commun
272:
882-886,
2000[Web of Science][Medline].
18.
Johnson, AC.
Activation of epidermal growth factor receptor gene transcription by phorbol 12-myristate 13-acetate is mediated by activator protein 2.
J Biol Chem
271:
3033-3038,
1996
19.
Kandasamy, RA,
and
Orlowski J.
Genomic organization and glucocorticoid transcriptional activation of the rat Na+/H+ exchanger Nhe3 gene.
J Biol Chem
271:
10551-10559,
1996
20.
Kandasamy, RA,
Yu FH,
Harris R,
Boucher A,
Hanrahan JW,
and
Orlowski J.
Plasma membrane Na+/H+ exchanger isoforms (NHE1, -2, and -3) are differentially responsive to second messenger agonists of the protein kinase A and C pathways.
J Biol Chem
270:
29209-29216,
1995
21.
Klanke, CA,
Su YR,
Callen DF,
Wang Z,
Meneton P,
Baird N,
Kandasamy RA,
Orlowski J,
Otterud BE,
Leppert M,
Shull GE,
and
Menon AG.
Molecular cloning and physical and genetic mapping of a novel human Na+/H+ exchanger (NHE5/SLC9A5) to chromosome 16q221.
Genomics
25:
615-622,
1995[Web of Science][Medline].
22.
Malakooti, J,
Dahdal RY,
Dudeja PK,
Layden TJ,
and
Ramaswamy K.
The human Na+/H+ exchanger NHE2 gene: genomic organization and promoter characterization.
Am J Physiol Gastrointest Liver Physiol
280:
G763-G773,
2001
23.
Malakooti, J,
Dahdal RY,
Schmidt L,
Layden TJ,
Dudeja PK,
and
Ramaswamy K.
Molecular cloning, tissue distribution, and functional expression of the human Na+/H+ exchanger NHE2.
Am J Physiol Gastrointest Liver Physiol
277:
G383-G390,
1999
24.
Mayfield, C,
Ebbinghaus S,
Gee J,
Jones D,
Rodu B,
Squibb M,
and
Miller D.
Triplex formation by the human Ha-ras promoter inhibits Sp1 binding and in vitro transcription.
J Biol Chem
269:
18232-18238,
1994
25.
McSwine, RL,
Musch MW,
Bookstein C,
Xie Y,
Rao M,
and
Chang EB.
Regulation of apical membrane Na+/H+ exchangers NHE2 and NHE3 in intestinal epithelial cell line C2/bbe.
Am J Physiol Cell Physiol
275:
C693-C701,
1998
26.
Miller, RT,
Counillon L,
Pages G,
Lifton RP,
Sardet C,
and
Pouyssegur J.
Structure of the 5'-flanking regulatory region and gene for the human growth factor-activatable Na/H exchanger NHE1.
J Biol Chem
266:
10813-10819,
1991
27.
Morris, JF,
Hromas R,
and
Rauscher FJ, III.
Characterization of the DNA-binding properties of the myeloid zinc finger protein MZF1: two independent DNA-binding domains recognize two DNA consensus sequences with a common G-rich core.
Mol Cell Biol
14:
1786-1795,
1994
28.
Muller, YL,
Collins JF,
Bai L,
Xu H,
and
Ghishan FK.
Molecular cloning and characterization of the rat NHE2 gene promoter.
Biochim Biophys Acta
1442:
314-319,
1998[Medline].
29.
Musch, MW,
Bookstein C,
Xie Y,
Sellin JH,
and
Chang EB.
SCFA increase intestinal Na absorption by induction of NHE3 in rat colon and human intestinal C2/bbe cells.
Am J Physiol Gastrointest Liver Physiol
280:
G687-G693,
2001
30.
Numata, M,
Petrecca K,
Lake N,
and
Orlowski J.
Identification of a mitochondrial Na+/H+ exchanger.
J Biol Chem
273:
6951-6959,
1998
31.
Orlowski, J,
and
Grinstein S.
Na+/H+ exchangers of mammalian cells.
J Biol Chem
272:
22373-22376,
1997
32.
Orlowski, J,
Kandasamy RA,
and
Shull GE.
Molecular cloning of putative members of the Na/H exchanger gene family. cDNA cloning, deduced amino acid sequence, and mRNA tissue expression of the rat Na+/H+ exchanger NHE1 and two structurally related proteins.
J Biol Chem
267:
9331-9339,
1992
33.
Peterson, MD,
and
Mooseker MS.
Characterization of the enterocyte-like brush border cytoskeleton of the C2BBe clones of the human intestinal cell line, Caco-2.
J Cell Sci
102:
581-600,
1992
34.
Quinn, JP,
McAllister J,
and
Mendelson S.
Multiple protein complexes, including AP2 and Sp1, interact with a specific site within the rat preprotachykinin-A promoter.
Biochim Biophys Acta
1263:
25-34,
1995[Medline].
35.
Rao, GN,
Sardet C,
Pouyssegur J,
and
Berk BC.
Na+/H+ antiporter gene expression increases during retinoic acid-induced granulocytic differentiation of HL60 cells.
J Cell Physiol
151:
361-366,
1992[Web of Science][Medline].
36.
Sanger, F,
Nicklen S,
and
Coulson AR.
DNA sequencing with chain-terminating inhibitors.
Proc Natl Acad Sci USA
74:
5463-5467,
1977
37.
Sardet, C,
Counillon L,
Franchi A,
and
Pouyssegur J.
Growth factors induce phosphorylation of the Na+/H+ antiporter, glycoprotein of 110 kD.
Science
247:
723-726,
1990
38.
Sardet, C,
Franchi A,
and
Pouyssegur J.
Molecular cloning, primary structure, and expression of the human growth factor-activatable Na+/H+ antiporter.
Cell
56:
271-280,
1989[Web of Science][Medline].
39.
Suh, E,
Chen L,
Taylor J,
and
Traber PG.
A homeodomain protein related to caudal regulates intestine-specific gene transcription.
Mol Cell Biol
14:
7340-7351,
1994
40.
Tse, CM,
Brant SR,
Walker MS,
Pouyssegur J,
and
Donowitz M.
Cloning and sequencing of a rabbit cDNA encoding an intestinal and kidney-specific Na+/H+ exchanger isoform (NHE3).
J Biol Chem
267:
9340-9346,
1992
41.
Tse, M,
Levine S,
Yun C,
Brant S,
Counillon LT,
Pouyssegur J,
and
Donowitz M.
Structure/function studies of the epithelial isoforms of the mammalian Na+/H+ exchanger gene family.
J Membr Biol
135:
93-108,
1993[Web of Science][Medline].
42.
Wakabayashi, S,
Shigekawa M,
and
Pouyssegur J.
Molecular physiology of vertebrate Na+/H+ exchangers.
Physiol Rev
77:
51-74,
1997
43.
Wang, H,
Silva NL,
Lucchesi PA,
Haworth R,
Wang K,
Michalak M,
Pelech S,
and
Fliegel L.
Phosphorylation and regulation of the Na+/H+ exchanger through mitogen-activated protein kinase.
Biochemistry
36:
9151-9158,
1997[Medline].
44.
Wang, Z,
Orlowski J,
and
Shull GE.
Primary structure and functional expression of a novel gastrointestinal isoform of the rat Na/H exchanger.
J Biol Chem
268:
11925-11928,
1993
45.
Weinman, EJ,
and
Shenolikar S.
The Na-H exchanger regulatory factor.
Exp Nephrol
5:
449-52,
1997[Web of Science][Medline].
46.
Williams, T,
Admon A,
Luscher B,
and
Tjian R.
Cloning and expression of AP-2, a cell-type-specific transcription factor that activates inducible enhancer elements.
Genes Dev
2:
1557-1569,
1988
47.
Williams, T,
and
Tjian R.
Analysis of the DNA-binding and activation properties of the human transcription factor AP-2.
Genes Dev
5:
670-682,
1991
48.
Yang, W,
Dyck JR,
Wang H,
and
Fliegel L.
Regulation of NHE1 promoter in mammalian myocardium.
Am J Physiol Heart Circ Physiol
270:
H259-H266,
1996
49.
Yang, W,
Wang H,
and
Fliegel L.
Regulation of Na+/H+ exchanger gene expression. Role of a novel poly(dA dT) element in regulation of the NHE1 promoter.
J Biol Chem
271:
20444-20449,
1996
50.
Yun, CH,
Gurubhagavatula S,
Levine SA,
Montgomery JL,
Brant SR,
Cohen ME,
Cragoe EJ, Jr,
Pouyssegur J,
Tse CM,
and
Donowitz M.
Glucocorticoid stimulation of ileal Na+ absorptive cell brush border Na+/H+ exchange and association with an increase in message for NHE3, an epithelial Na+/H+ exchanger isoform.
J Biol Chem
268:
206-211,
1993
This article has been cited by other articles:
![]() |
S. Saksena, A. Dwivedi, R. K. Gill, A. Singla, W. A. Alrefai, J. Malakooti, K. Ramaswamy, and P. K. Dudeja PKC-dependent stimulation of the human MCT1 promoter involves transcription factor AP2 Am J Physiol Gastrointest Liver Physiol, February 1, 2009; 296(2): G275 - G283. [Abstract] [Full Text] [PDF] |
||||
![]() |
Md. R. Amin, P. K. Dudeja, K. Ramaswamy, and J. Malakooti Involvement of Sp1 and Sp3 in differential regulation of human NHE3 promoter activity by sodium butyrate and IFN-{gamma}/TNF-{alpha} Am J Physiol Gastrointest Liver Physiol, July 1, 2007; 293(1): G374 - G382. [Abstract] [Full Text] [PDF] |
||||
![]() |
Md. R. Amin, J. Malakooti, R. Sandoval, P. K. Dudeja, and K. Ramaswamy IFN-{gamma} and TNF-{alpha} regulate human NHE3 gene expression by modulating the Sp family transcription factors in human intestinal epithelial cell line C2BBe1 Am J Physiol Cell Physiol, November 1, 2006; 291(5): C887 - C896. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Oweis, L. Wu, P. R. Kiela, H. Zhao, D. Malhotra, F. K. Ghishan, Z. Xie, J. I. Shapiro, and J. Liu Cardiac glycoside downregulates NHE3 activity and expression in LLC-PK1 cells Am J Physiol Renal Physiol, May 1, 2006; 290(5): F997 - F1008. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Malakooti, R. Sandoval, V. C. Memark, P. K. Dudeja, and K. Ramaswamy Zinc finger transcription factor Egr-1 is involved in stimulation of NHE2 gene expression by phorbol 12-myristate 13-acetate Am J Physiol Gastrointest Liver Physiol, October 1, 2005; 289(4): G653 - G663. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |