|
|
||||||||
1 Membrane Biology Program and Renal Division, Brigham and Women's Hospital, Harvard Medical School, Boston, 02115; and 2 Department of Medicine, Medical School, University of Massachusetts, Worcester, Massachusetts 01651
| |
ABSTRACT |
|---|
|
|
|---|
Hereditary hemochromatosis (HHC) is one of the most frequent genetic disorders in humans. In healthy individuals, absorption of iron in the intestine is tightly regulated by cells with the highest iron demand, in particular erythroid precursors. Cloning of intestinal iron transporter proteins provided new insight into mechanisms and regulation of intestinal iron absorption. The aim of this study was to assess whether, in humans, the two transporters are regulated in an iron-dependent manner and whether this regulation is disturbed in HHC. Using quantitative PCR, we measured mRNA expression of divalent cation transporter 1 (DCT1), iron-regulated gene 1 (IREG1), and hephaestin in duodenal biopsy samples of individuals with normal iron levels, iron-deficiency anemia, or iron overload. In controls, we found inverse relationships between the DCT1 splice form containing an iron-responsive element (IRE) and blood hemoglobin, serum transferrin saturation, or ferritin. Subjects with iron-deficiency anemia showed a significant increase in expression of the spliced form, DCT1(IRE) mRNA. Similarly, in subjects homozygous for the C282Y HFE mutation, DCT1(IRE) expression levels remained high despite high serum iron saturation. Furthermore, a significantly increased IREG1 expression was observed. Hephaestin did not exhibit a similar iron-dependent regulation. Our data show that expression levels of human DCT1 mRNA, and to a lesser extent IREG1 mRNA, are regulated in an iron-dependent manner, whereas mRNA of hephaestin is not affected. The lack of appropriate downregulation of apical and basolateral iron transporters in duodenum likely leads to excessive iron absorption in persons with HHC.
hemochromatosis; iron transporter; iron metabolism; regulation; divalent cation transporter; divalent metal transporter; iron regulated gene 1; ferroportin
| |
INTRODUCTION |
|---|
|
|
|---|
HEREDITARY HEMOCHROMATOSIS (HHC) is one of the most prevalent inherited disorders in humans. It is associated with excessive intestinal iron absorption that may lead to damage of various organs, especially liver, pancreas, heart, and pituitary gland. As reported by Feder et al. (13), it is primarily the result of a missense mutation within the HFE gene (mostly cysteine 282 to tyrosine). In HHC, this mutation leads to iron accumulation in the body and may lead to liver cirrhosis or heart disease, and eventually death, if not treated by phlebotomy (4, 12). The HFE protein neither binds nor transports iron but, rather, physically interacts with the transferrin receptor (TfR) (14, 21, 30, 45). Some investigators have proposed (22) that the HFE protein competes with diferric transferrin for the TfR and thereby reduces the overall uptake of iron into cells, maintaining low but sufficient intracellular levels of iron (35, 38). However, it has also been reported that HFE protein can facilitate the uptake of transferrin-bound iron into certain cells (26).
In the mammalian body, iron absorption is tightly regulated by the iron demand for erythropoiesis and occurs only in the small intestine, in particular in the duodenum (18). Iron uptake is a two-step process, as revealed by studies of naturally occurring mutations in animals (3) and the characterization of recently cloned transporter genes (19, 24). At the apices of intestinal villi, enterocytes express divalent cation transporter 1 [DCT1, also known as divalent metal transporter 1 (DMT1) or Nramp2], which is essential for cellular uptake of iron from the intestinal lumen (15, 19). The transport from enterocytes into the serum, at the basolateral side of enterocytes, is accomplished by the coordinated action of the transporter iron-regulated gene 1 [IREG1, also known as metal transporter protein 1 (MTP1) or ferroportin1 (1, 11, 24)] and the multicopper ferroxidase hephaestin (44). The mRNAs of DCT1 and IREG1 contain sequences resembling iron-responsive elements (IREs), previously found in the mRNAs of ferritin and TfR, that presumably regulate their expression by intracellular iron in a cell-specific manner (for review, see Refs. 34 and 42). DCT1, IREG1 mRNA, and IREG1 protein have been reported to be upregulated in response to chronic iron deficiency in the intestine (1, 19, 24, 43). Abboud and Haile (1) isolated IREG1 (which they call MTP1) by the ability of its RNA to bind the IRE binding protein-1 (IRP1) immobilized on a column. Likewise, binding of IRP1 to the mRNA of DCT1 has been reported recently (46).
Interestingly, intestinal iron absorption, which is mediated by DCT1
and IREG1, occurs in duodenal villi (1, 8, 24), whereas
the "modulator of iron homeostasis," HFE, is normally expressed in
crypt cells (7, 31). How HFE, which is presumed to act as
a modulator of the affinity of TfR for transferrin, can regulate iron
absorption in villus cells is still not completely understood.
Recently, it was shown (28, 33) that the lack of
expression of hepcidin, a peptide synthesized in liver, leads to iron
overload in mice, similar to HFE or
2-microglobulin
knockout mice. Whether this peptide acts as a regulator of genes
involved in iron absorption, and how this regulation occurs, remains to be determined.
A model proposed by Conrad et al. in 1964 (10) describes a possible mechanism for regulation of iron absorption mediated by the amount of iron absorbed by crypt cells in the intestine. This body iron "sensing mechanism" in crypt cells might be disturbed in HHC, leading to imbalance in intestinal iron absorption in villus cells (37). The observed iron-dependent regulation of the two iron transporters, DCT1 and IREG/MTP1, raises the question of a possible dysregulation of these transporters in HHC. In two previous studies, carefully selected HHC patients homozygous for C282Y were compared with control subjects, subjects with secondary iron overload, and iron-deficient subjects for their expression level of total DCT1 and IREG1. DCT1 and IREG1 were found to be increased in HHC. However, this study did not differentiate between the two DCT1 splice forms (with and without an IRE) (47, 48), and the expression of hephaestin was not examined.
Recently, two rare forms of HHC not related to mutations in the HFE gene have been described. One of them is caused by a missense mutation in the IREG1 gene (29) and the other one by a defect in the recently identified second TfR isoform, called TfR2 (36). These findings highlight the importance of iron transport in controlling body iron homeostasis.
In the present study, we investigated the expression of the mRNAs of both the apical and basolateral iron transporters in human upper intestinal biopsies in subjects with iron-deficiency anemia, normal iron, and iron overload. We compared the data from patients with homozygous HHC, subjects with and without the major (C282Y) and minor (H63D) mutations of HFE associated with HHC at different levels of serum ferritin, and transferrin saturation (TfS). We found that, in HHC patients without liver disease, DCT1(IRE) and IREG1 are significantly upregulated compared with control individuals, whereas no changes were detected for hephaestin. We also assessed the portion of DCT1 upregulation that is attributable to HHC by studying the regulation of DCT1 in normal individuals as a function of blood hemoglobin, serum iron, and ferritin levels. The "normal" regulation of DCT1 in human intestine by differentiating the two splice forms has not been reported heretofore.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Proximal duodenal biopsy samples (from the second portion within
5 cm of the duodenal bulb) were obtained from nine patients with
classic HHC (C282Y +/+, H63D
/
) and 27 patients with wild-type genotype (C282Y
/
, H63D
/
). Patients were recruited from the clinic or the endoscopy suite of University of Massachusetts Memorial Healthcare. One patient with phenotypic hemochromatosis volunteered to
undergo endoscopy for study purposes. All other patients volunteered for duodenal biopsies during medically indicated upper gastrointestinal endoscopies. In all cases, upper gastrointestinal endoscopies were
performed in subjects who were ingesting diets that were not limited or
supplemented with iron and after an overnight fast of at least 12 h. The study protocol and consent form were approved by the Human
Subjects Committee of the University of Massachusetts. All patients
were older than 18 years and gave their written, informed consents.
At the time of endoscopy, blood was obtained for hematocrit,
hemoglobin, serum ferritin, serum iron binding capacity, transferrin, and HFE mutational analysis. The duodenal biopsies were
obtained with standard mucosal biopsy forceps inserted through standard gastrofiberscopes (GIF140; Olympus, Tokyo, Japan). They were
immediately placed into 300 µl of Ultraspec Total RNA isolation
reagent (Biotecx, Houston, TX). Typically, a total of six biopsies,
each ~5 mg wet weight, were placed into three 1.5-ml microcentrifuge
tubes, two specimens per tube. A seventh biopsy was also collected,
immediately placed into a cryovial, and snap frozen in liquid
N2 for histochemical studies. Tissue in Ultraspec was
treated following the manufacturer's instructions, RNAs were stored at
20°C under isopropanol, and before first strand synthesis they were
centrifuged, washed in ethanol, and dissolved in 20 µl water.
Random primed first strand cDNA was synthesized from each biopsy sample
with an AMV-RT kit, following the manufacturer's instructions (Roche,
Indianapolis, IN) and using 1 µg total RNA as a template (OD260). Genomic sequences for IREG1 and hephaestin were
obtained from the high throughput genome sequence library of GenBank
(IREG1 accession no. AC012488; hephaestin accession no. AC020739). For
-actin and DCT1, the earlier published genomic sequences (23,
27) were used to design oligonucleotide primers.
The PCR primers synthesized were as follows:
-actin (GenBank
accession no. M10277)
2282GGGAAATCGTGCGTGACATT2301 and
2583CACGAAACTACCTTCAACTCC2603, exons 3-4;
IREG1 (GenBank accession no. AC012488)
224TGCTATCTCCAGTTCCTTGC205 and
160203TGTCTTCTCCTGCAACAACA160184, exons
1-5; hephaestin (GenBank accession no. AC020739)
79303TATACCATCCACCCTCATGG79284 and
63319GCATCCTATTGCTCTCCTGA63338, exons
2-4; DCT1(non-IRE) (GenBank accession nos. AF064481 and AF064483)
1535CCCATCCTCACATTTACGAG1554 and
953ATCCCAGAGTCCAAGACACA934, exons14-17;
and DCT1(IRE) (GenBank accession nos. AF064481 and AF064482)
1535CCCATCCTCACATTTACGAG1554 and
921CCCTAATCCAGTTCTAAG904 exons 14-16a
(IRE 3' end), respectively.
Quantitative PCR amplification was performed with the Lightcycler
device/software and the SYBRgreen DNA master kit (Roche) following the
manufacturer's instructions. After initial denaturation at 95°C for
30 s, each gene was independently amplified and detected using the
following cycles (usually 40 cycles):
-actin: 95°C, 0 s;
62°C, 4 s; 72°C, 5 s; 82°C, 2 s (fluorescent
detection; gain: 20); IREG1: 95°C, 0 s; 58°C, 8 s;
72°C, 18 s; 82°C, 3 s (fluorescent detection; gain: 15);
hephaestin: 95°C, 0 s; 53°C, 10 s; 72°C, 15 s;
82°C, 2 s (fluorescent detection; gain: 30); DCT1(IRE): 95°C,
0 s; 57°C, 5 s; 72°C, 12 s; 82°C, 1 s
(fluorescent detection; gain: 20); and DCT1(non-IRE): 95°C, 0 s;
53°C, 10 s; 72°C, 15 s; 82°C, 2 s (fluorescent
detection; gain: 30). Each PCR amplification was followed by a melting
curve analysis (97°C, 5 s; 65°C, 15 s; followed by
0.1°C ramping by continuous fluorescent measurement to 99°C) to
control for specific amplification products. Each sample was analyzed
at least twice; in some cases, additional analysis of a second set of
specimens was performed to examine intraindividual variations. Data
obtained for DCT1, IREG1, and hephaestin were normalized by comparison
with
-actin expression; therefore, the results might be called semiquantitative.
Nonradioactive in situ hybridization was performed as described previously (19), using a digoxigenin-labeled cRNA probe that contained 800 bases of DCT1(IRE) 3' untranslated sequence (nucleotides 1719-2423, GenBank accession no. AB004857). Frozen sections (8 µm) were cut from the intestinal biopsies in a cryostat and captured onto Superfrost Plus microscope slides (Fisher Scientific, Pittsburgh, PA). The sections were fixed and acetylated and then hybridized at 68°C for 36 h to the DCT1(IRE) probe (approximate concentration, 100 ng/ml). Hybridized probe was visualized using alkaline phosphatase-conjugated antidigoxigenin Fab fragments (Roche) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Kierkegard and Perry Laboratories, Gaithersburg, MD). Sections were rinsed several times in 100 mM Tris, 150 mM NaCl, and 20 mM EDTA, pH 9.5, and coverslipped with glycerol gelatin (Sigma, St. Louis, MO). Control sections were incubated in an identical concentration of the sense probe transcript.
Statistical and regression analyses were performed using the computer software Prism (GraphPad Software, San Diego, CA). Linear regression was calculated by the least squares method, and r2 and P values are shown in the graphs to indicate the significance of the linear regression analyses. Significance was determined using the unpaired t-test method.
| |
RESULTS |
|---|
|
|
|---|
We studied a total of 36 subjects (see Table
1 for details), of whom 27 were
HFE normal [having neither the C282Y nor the H63D mutation;
individuals with prefix WT (wild-type) and in the following called
"controls"] and 9 of whom were homozygous for C282Y (i.e., have
classic HHC; individuals with prefix HHC). We divided the two groups
further into five different categories: controls without liver disease
(WT
LD), controls with iron-deficiency anemia without liver
disease (WT
Fe), controls with liver disease (WT + LD),
and HHC patients with or without liver disease (HHC ± LD). The
reason for subdividing individuals with liver disease is the
observation that liver disease can result in extensive iron
accumulation. This division avoids mixing of two different effects
influencing body iron homeostasis.
|
The genomic organizations of the human hephaestin and IREG1 genes were
assembled from sequences published by the human genome project. The
primers for quantitative PCR of DCT1, IREG1, and hephaestin were
designed to amplify mRNA sequences spanning over at least one intron,
to rule out amplification of genomic DNA (Fig.
1), which was excluded by melting curve
analysis using the Lightcycler software and by agarose gel
electrophoresis (not shown).
|
As expected, WT
Fe subjects exhibited significantly lower mean
serum TfS values (P < 0.0001) than controls
(Fig. 2A). Furthermore, they
had significantly higher mean values for DCT1(IRE) mRNA expression (P = 0.0078) than WT
LD controls, with a mean
value ~10 times higher for anemic subjects than for subjects without
anemia (Fig. 2B). This increase was also detectable by in
situ hybridization analysis on sections of frozen intestinal biopsies
(Fig. 3). Between these two groups,
no significant difference for DCT1(non-IRE) expression (Fig.
2C) or hephaestin (not shown) was observed. With respect to
IREG1 mRNA expression, a modest, though statistically not significant,
increase of expression in WT
Fe subjects was observed, in
contrast with an earlier publication (47). We failed to
detect an effect of age or gender on DCT1 mRNA expression in this study
(data not shown). Control subjects with normal iron status exhibited a
scattering for both DCT1(IRE) and DCT1(non-IRE) expression within
roughly one order of magnitude [after normalization to
-actin (Fig.
2A)], in agreement with an earlier publication that
measured the total DCT1 content (46). Normalized mean
values for DCT1(IRE) were ~10-fold higher than DCT1(non-IRE), a
difference also observed for intestinal DCT1 expression in other
mammals (A. Rolfs and M. A. Hediger, unpublished observations).
|
|
When we compared the WT
LD control group with the HHC
LD group (n = 5, subjects HHC35-HHC39 in Table 1),
we not only observed significant differences in TfS
(P = 0.0001, Fig. 2A), with HHC
LD
having about three times higher values, but we also saw a significantly
higher DCT1(IRE) expression in the HHC
LD group
(P = 0.013, Fig. 2B). In addition,
expression of IREG1 in the HHC
LD group was increased compared
with controls (P = 0.04, Fig. 2D). No
differences in DCT1(non-IRE) (Fig. 2C) or hephaestin (not
shown) mRNA expression could be detected between these groups. The
expression level of DCT1(IRE) (Fig. 2B) in the HHC
LD group was the same as for the WT
Fe group, despite markedly
different serum iron data (Table 1, Fig. 2A). This suggests
that, in contrast to iron-deficiency anemia, in HFE C282Y+/+
patients, expression of IREG1 and DCT1(IRE) are not correlated with or
dependent on serum iron values. This lack of correlation may be due to
the disturbance of iron homeostatic signaling in homozygous C282Y HFE subjects, analogous to the recently described
alterations of hepcidin in mice (28, 33).
We failed to observe statistically significant differences for
DCT1(with or without IRE), IREG1, or hephaestin mRNA expression between
WT
LD and WT + LD subjects. The number of liver disease patients, or their diversity, might make it difficult to derive any
conclusive data, since the etiology and stage of liver disease may
influence expression of these genes. Indeed, in controls, expression
levels of hephaestin mRNA were within one order of magnitude,
regardless of serum TfS or ferritin. In contrast, patient WT09,
who has chronic hepatitis C (Table 1), had modestly elevated hephaestin
mRNA levels (not shown). The liver disease in this patient may have
influenced the expression of the hephaestin gene in an iron-independent manner.
Among controls, we found inverse relationships of DCT1(IRE) mRNA
expression and serum TfS (Fig.
4A;
r2=0.49, P = 0.016), serum
ferritin (Fig. 4B; r2=0.65,
P = 0.005), and blood hemoglobin (Fig. 4C;
r2=0.46, P = 0.015). Our data
indicate that, in humans, the IRE-containing form of DCT1 mRNA is
regulated in the same way in response to iron deprivation as in rat and
mouse (8, 19). We did not observe significant correlations
among duodenal IREG1 (see Fig. 6A), DCT1(non-IRE), or
hephaestin mRNA expression and any of the blood data studied in the
WT
LD group.
|
With respect to HHC
LD patients who, as already described,
exhibited high DCT1(IRE) mRNA expression despite elevated TfS values (Fig. 2, A and B), no inverse relationship
between DCT1(IRE) and serum ferritin or TfS was detectable
(Fig. 5A,
r2=0.26, P = 0.4; and Fig.
5B, r2=0.67, P = 0.08, respectively). For comparison, linear regression lines of
controls from Fig. 4 are shown in Fig. 5. When correlating with blood
hemoglobin, we found an inverse linear relationship that did not differ
significantly from that of the WT
LD group (Fig.
5C), presumably because hemoglobin synthesis is not affected in HHC. In contrast to this, IREG1 mRNA expression and serum
TfS exhibited a linear relationship for the HHC
LD
group (Fig. 6B; r2=0.878, P = 0.02, n = 5), which was not paralleled by a similar relationship in WT
LD subjects (Fig. 6A). These
findings demonstrate that the correlation between serum iron levels and
intestinal iron absorption is disturbed in HFE C282Y +/+
patients.
|
|
| |
DISCUSSION |
|---|
|
|
|---|
Numerous advances in iron metabolism have been made in the last 5 years, ushered in by cloning and characterization of the HFE gene and its mutations in HHC. In addition, several proteins responsible for intestinal iron absorption have been identified, including DCT1, IREG1, and hephaestin. Iron-dependent regulation of these transporters has not yet been the subject of in depth analysis in humans. The data described here, revealing an inverse correlation between DCT1(IRE) mRNA expression and serum TfS, serum ferritin, and blood hemoglobin (Figs. 4, A-C), emphasize the relationship of iron absorption and body iron homeostasis. The upregulation of DCT1 mRNA in iron deficiency is consistent with studies in rats (19) and mice (17) kept on diets low in iron, although in our patients, blood loss rather than iron-deficient diets was the cause of iron deficiency. The increase in DCT1 mRNA levels is most probably due to increased stability of the splice form of DCT1, which contains an IRE in its 3' untranslated region, since the other splice form without the IRE did not exhibit a similar regulation.
In contrast, in HFE C282Y +/+ patients, an inverse
relationship for DCT1(IRE) and TfS was not observed and
expression of DCT1(IRE) mRNA was higher than anticipated by the serum
TfS. HHC
LD patients, despite high serum TfS,
exhibit elevations of DCT1(IRE) mRNA expression to the same
degree as controls with iron-deficient anemia. Moreover, duodenal
DCT1(IRE) mRNA expression in these individuals seems less closely
correlated to serum ferritin levels, since untreated patients having
similar serum ferritin levels (HHC32 and HHC33) had different serum
TfS (Table 1) and DCT1(IRE) expressions.
Our observations on HFE C282Y +/+ patients are in agreement
with studies of DCT1(IRE) regulation in homozygous mice with a gene
disruption of HFE (17). More recent studies
(9, 16, 40) suggest that HFE-regulated iron absorption
involves additional, yet-to-be-determined factors. In one study
comparing normal and
2-microglobulin knockout mice
(9), no significant difference in duodenal DCT1 protein
amount was observed. In another recent report of HFE
knockout mice (16), a strong influence of the genetic
background on the level of iron accumulation was observed in three
different inbred mouse strains, suggesting that additional heritable
factors influence the phenotype and might account for the differences
in expression and regulation of DCT1 reported from different
laboratories (9, 17, 40). It has also been reported that,
in the duodena of HHC patients and in HFE knockout mice, IRP
binding affinity is increased, leading to increased TfR expression
(2, 32). These findings support the model of a defect in
iron sensing in crypt cells of the small intestine of HHC subjects,
leading to inappropriately high levels of expression of genes involved
in iron metabolism and transport in differentiating villus cells
(37), as if these iron-replete subjects had
iron-deficiency anemia. However, how mutation or disruption of the
HFE gene results in altered signaling that makes maturing
villus cells behave as if the body had iron-deficiency anemia remains
unknown. Recent results in mice suggest that the oligopeptide hepcidin
(also referred to as LEAP-1) may be a molecule that reports the status
of tissue (especially liver) iron stores to duodenal crypt cells
(28, 33). In normal subjects, such signaling aids in
appropriate regulation of mucosal uptake and transport of iron by
modulation of expression of DCT1(IRE) and IREG1. It is possible that
patients with HHC or mice with HFE gene disruption lack the
ability to transduce the hepcidin signal to their duodenal enterocytes.
However, it is currently unknown whether the HFE-TfR complex interacts with hepcidin and whether such an interaction triggers a specific response in enterocytes and macrophages.
With respect to the expression of IREG1 mRNA, our HHC
LD
patients exhibited a significant upregulation compared with controls, in agreement with recent findings (47, 48). IREG1 mRNA,
which contains in its 5'-untranslated region an IRE, might be regulated at the transcriptional level (Figs. 2D and 6A),
as described for ferritin or the erythroid form of 5-aminolevulinate
synthase (20, 25, 34, 39, 41, 42). It should be noted that
the observed linear correlation for IREG1 with serum TfS in
HHC
LD occurs at a level of iron loading not normally seen in
healthy individuals. Further studies with a larger number of patients
are required to investigate the observed upregulation in
hemochromatosis. In contrast, no iron-dependent regulation of the
hephaestin gene expression was observed.
It has been known for many years that iron overload occurs in liver cirrhosis, and recent results indicate that the great majority of patients with end-stage chronic liver disease and iron overload do not have HHC (i.e., are not C282Y +/+) (5, 6). Although we found no evidence for upregulation of intestinal iron transport in cirrhosis, this possibility cannot be ruled out, since none of our liver disease patients had iron overload (Table 1), as shown by liver biopsies (data not shown). Therefore, how and why patients with end-stage liver disease develop iron overload remains to be elucidated.
| |
ACKNOWLEDGEMENTS |
|---|
We thank the nursing and clinical staff of the University of Massachusetts Memorial Gastrointestinal Endoscopy Unit for their help in performing duodenal mucosal biopsies and care of patients studied.
| |
FOOTNOTES |
|---|
Current address for J. G. Kohlroser: Division of Gastroenterology, Albany Medical College, Albany, NY
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants RO1-DK-57782 to M. A. Hediger and RO1-DK-38825 and DK-92326 to H. L. Bonkovsky and by a grant from the American College of Gastroenterology to J. G. Kohlroser and H. L. Bonkovsky.
Addresses for reprint requests and other correspondence: M. A. Hediger, Harvard Institutes of Medicine, Room 570, 77 Avenue Louis Pasteur, Boston, MA 02115 (E-mail: mhediger{at}rics.bwh.harvard.edu) or H. L. Bonkovsky, University of Massachusetts Medical School, Rm. S6-737, 55 Lake Ave. North, Worcester, MA 01651 (E-mail: bonkovsh{at}ummhc.org).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
10.1152/ajpgi.00371.2001
Received 20 August 2001; accepted in final form 29 October 2001.
| |
REFERENCES |
|---|
|
|
|---|
1.
Abboud, S,
and
Haile DJ.
A novel mammalian iron-regulated protein involved in intracellular iron metabolism.
J Biol Chem
275:
19906-19912,
2000
2.
Bahram, S,
Gilfillan S,
Kuhn LC,
Moret R,
Schulze JB,
Lebeau A,
and
Schumann K.
Experimental hemochromatosis due to MHC class I HFE deficiency: immune status and iron metabolism.
Proc Natl Acad Sci USA
96:
13312-13317,
1999
3.
Bannerman, RM.
Genetic defects of iron transport.
Fed Proc
35:
2281-2285,
1976[Web of Science][Medline].
4.
Bonkovsky, HL.
Iron and the liver.
Am J Med Sci
301:
32-43,
1991[Web of Science][Medline].
5.
Bonkovsky, HL,
and
Lambrecht RW.
Iron-induced liver injury.
Clin Liver Dis
4:
409-429,
2000[Medline].
6.
Bonkovsky, HL,
and
Obando JV.
Role of HFE gene mutations in liver diseases other than hereditary hemochromatosis.
Curr Gastroenterol Rep
1:
30-37,
1999[Medline].
7.
Byrnes, V,
Ryan E,
O'Keane C,
and
Crowe J.
Immunohistochemistry of the Hfe protein in patients with hereditary hemochromatosis, iron deficiency anemia, and normal controls.
Blood Cells Mol Dis
26:
2-8,
2000[Web of Science][Medline].
8.
Canonne-Hergaux, F,
Gruenheid S,
Ponka P,
and
Gros P.
Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron.
Blood
93:
4406-4417,
1999
9.
Canonne-Hergaux, F,
Levy JE,
Fleming MD,
Montross LK,
Andrews NC,
and
Gros P.
Expression of the DMT1 (NRAMP2/DCT1) iron transporter in mice with genetic iron overload disorders.
Blood
97:
1138-1140,
2001
10.
Conrad, ME,
Weintraub LR,
and
Crosby WH.
The role of the intestine in iron kinetics.
J Clin Invest
43:
963-974,
1964.
11.
Donovan, A,
Brownlie A,
Zhou Y,
Shepard J,
Pratt SJ,
Moynihan J,
Paw BH,
Drejer A,
Barut B,
Zapata A,
Law TC,
Brugnara C,
Lux SE,
Pinkus GS,
Pinkus JL,
Kingsley PD,
Palis J,
Fleming MD,
Andrews NC,
and
Zon LI.
Positional cloning of zebrafish ferroportin 1 identifies a conserved vertebrate iron exporter.
Nature
403:
776-781,
2000[Medline].
12.
Feder, JN.
The hereditary hemochromatosis gene (HFE): a MHC class I-like gene that functions in the regulation of iron homeostasis.
Immunol Res
20:
175-185,
1999[Web of Science][Medline].
13.
Feder, JN,
Gnirke A,
Thomas W,
Tsuchihashi Z,
Ruddy DA,
Basava A,
Dormishian F,
Domingo R, Jr,
Ellis MC,
Fullan A,
Hinton LM,
Jones NL,
Kimmel BE,
Kronmal GS,
Lauer P,
Lee VK,
Loeb DB,
Mapa FA,
McClelland E,
Meyer NC,
Mintier GA,
Moeller N,
Moore T,
Morikang E,
Prass E,
Quintana L,
Starnes S,
Schatzman R,
Brunke K,
Drayna D,
Risch N,
Bacon B,
and
Wolff RK.
A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis.
Nat Genet
13:
399-408,
1996[Web of Science][Medline].
14.
Feder, JN,
Penny DM,
Irrinki A,
Lee VK,
Lebron JA,
Watson N,
Tsuchihashi Z,
Sigal E,
Bjorkman PJ,
and
Schatzman RC.
The hemochromatosis gene product complexes with the transferrin receptor and lowers its affinity for ligand binding.
Proc Natl Acad Sci USA
95:
1472-1477,
1998
15.
Fleming, MD,
Trenor CC,
Su MA,
Foernzler D,
Beier DR,
Dietrich WF,
and
Andrews NC.
Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene.
Nat Genet
16:
383-386,
1997[Web of Science][Medline].
16.
Fleming, RE,
Holden CC,
Tomatsu S,
Waheed A,
Brunt EM,
Britton RS,
Bacon BR,
Roopenian DC,
and
Sly WS.
Mouse strain differences determine severity of iron accumulation in Hfe knockout model of hereditary hemochromatosis.
Proc Natl Acad Sci USA
98:
2707-2711,
2001
17.
Fleming, RE,
Migas MC,
Zhou X,
Jiang J,
Britton RS,
Brunt EM,
Tomatsu S,
Waheed A,
Bacon BR,
and
Sly WS.
Mechanism of increased iron absorption in murine model of hereditary hemochromatosis: increased duodenal expression of the iron transporter DMT1.
Proc Natl Acad Sci USA
96:
3143-3148,
1999
18.
Green, R,
Charlton R,
Seftel H,
Bothwell T,
Mayet F,
Adams B,
Finch C,
and
Layrisse M.
Body iron excretion in man: a collaborative study.
Am J Med
45:
336-353,
1968[Web of Science][Medline].
19.
Gunshin, H,
Mackenzie B,
Berger UV,
Gunshin Y,
Romero MF,
Boron WF,
Nussberger S,
Gollan JL,
and
Hediger MA.
Cloning and characterization of a mammalian proton-coupled metal-ion transporter.
Nature
388:
482-488,
1997[Medline].
20.
Hentze, MW,
and
Kuhn LC.
Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide, and oxidative stress.
Proc Natl Acad Sci USA
93:
8175-8182,
1996
21.
Lebron, JA,
Bennett MJ,
Vaughn DE,
Chirino AJ,
Snow PM,
Mintier GA,
Feder JN,
and
Bjorkman PJ.
Crystal structure of the hemochromatosis protein HFE and characterization of its interaction with transferrin receptor.
Cell
93:
111-123,
1998[Web of Science][Medline].
22.
Lebron, JA,
West AP, Jr,
and
Bjorkman PJ.
The hemochromatosis protein HFE competes with transferrin for binding to the transferrin receptor.
J Mol Biol
294:
239-245,
1999[Web of Science][Medline].
23.
Lee, PL,
Gelbart T,
West C,
Halloran C,
and
Beutler E.
The human Nramp2 gene
characterization of the gene structure, alternative splicing, promoter region and polymorphisms.
Blood Cells Mol Dis
24:
199-215,
1998[Web of Science][Medline].
24.
McKie, AT,
Marciani P,
Rolfs A,
Brennan K,
Wehr K,
Barrow D,
Miret S,
Bomford A,
Peters TJ,
Farzaneh F,
Hediger MA,
Hentze MW,
and
Simpson RJ.
A novel duodenal iron-regulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation.
Mol Cell
5:
299-309,
2000[Web of Science][Medline].
25.
Menotti, E,
Henderson BR,
and
Kuhn LC.
Translational regulation of mRNAs with distinct IRE sequences by iron regulatory proteins 1 and 2.
J Biol Chem
273:
1821-1824,
1998
26.
Montosi, G,
Paglia P,
Garuti C,
Guzman CA,
Bastin JM,
Colombo MP,
and
Pietrangelo A.
Wild-type HFE protein normalizes transferrin iron accumulation in macrophages from subjects with hereditary hemochromatosis.
Blood
96:
1125-1129,
2000
27.
Nakajima-Iijima, S,
Hamada H,
Reddy P,
and
Kakunaga T.
Molecular structure of the human cytoplasmic beta-actin gene: interspecies homology of sequences in the introns.
Proc Natl Acad Sci USA
82:
6133-6137,
1985
28.
Nicolas, G,
Bennoun M,
Devaux I,
Beaumont C,
Grandchamp B,
Kahn A,
and
Vaulont S.
Lack of hepcidin gene expression and severe tissue iron overload in upstream stimulatory factor 2 (USF2) knockout mice.
Proc Natl Acad Sci USA
98:
8780-8785,
2001
29.
Njajou, OT,
Vaessen N,
Joosse M,
Berghuis B,
van Dongen JW,
Breuning MH,
Snijders PJ,
Rutten WP,
Sandkuijl LA,
Oostra BA,
van Duijn CM,
and
Heutink P.
A mutation in SLC11A3 is associated with autosomal dominant hemochromatosis.
Nat Genet
28:
213-214,
2001[Web of Science][Medline].
30.
Parkkila, S,
Waheed A,
Britton RS,
Bacon BR,
Zhou XY,
Tomatsu S,
Fleming RE,
and
Sly WS.
Association of the transferrin receptor in human placenta with HFE, the protein defective in hereditary hemochromatosis.
Proc Natl Acad Sci USA
94:
13198-13202,
1997
31.
Parkkila, S,
Waheed A,
Britton RS,
Feder JN,
Tsuchihashi Z,
Schatzman RC,
Bacon BR,
and
Sly WS.
Immunohistochemistry of HLA-H, the protein defective in patients with hereditary hemochromatosis, reveals unique pattern of expression in gastrointestinal tract.
Proc Natl Acad Sci USA
94:
2534-2539,
1997
32.
Pietrangelo, A,
Casalgrandi G,
Quaglino D,
Gualdi R,
Conte D,
Milani S,
Montosi G,
Cesarini L,
Ventura E,
and
Cairo G.
Duodenal ferritin synthesis in genetic hemochromatosis.
Gastroenterology
108:
208-217,
1995[Web of Science][Medline].
33.
Pigeon, C,
Ilyin G,
Courselaud B,
Leroyer P,
Turlin B,
Brissot P,
and
Loreal O.
A new mouse liver-specific gene, encoding a protein homologous to human antimicrobial peptide hepcidin, is overexpressed during iron overload.
J Biol Chem
276:
7811-7819,
2001
34.
Richardson, DR,
and
Ponka P.
The molecular mechanisms of the metabolism and transport of iron in normal and neoplastic cells.
Biochim Biophys Acta
1331:
1-40,
1997[Medline].
35.
Riedel, HD,
Muckenthaler MU,
Gehrke SG,
Mohr I,
Brennan K,
Herrmann T,
Fitscher BA,
Hentze MW,
and
Stremmel W.
HFE downregulates iron uptake from transferrin and induces iron-regulatory protein activity in stably transfected cells.
Blood
94:
3915-3921,
1999
36.
Roetto, A,
Totaro A,
Piperno A,
Piga A,
Longo F,
Garozzo G,
Cali A,
De Gobbi M,
Gasparini P,
and
Camaschella C.
New mutations inactivating transferrin receptor 2 in hemochromatosis type 3.
Blood
97:
2555-2560,
2001
37.
Rolfs, A,
and
Hediger MA.
Metal ion transporters in mammals: structure, function and pathological implications.
J Physiol (Lond)
518:
1-12,
1999
38.
Roy, CN,
Penny DM,
Feder JN,
and
Enns CA.
The hereditary hemochromatosis protein, HFE, specifically regulates transferrin-mediated iron uptake in HeLa cells.
J Biol Chem
274:
9022-9028,
1999
39.
Schumann, K,
Moret R,
Kunzle H,
and
Kuhn LC.
Iron regulatory protein as an endogenous sensor of iron in rat intestinal mucosa. Possible implications for the regulation of iron absorption.
Eur J Biochem
260:
362-372,
1999[Web of Science][Medline].
40.
Sproule, TJ,
Jazwinska EC,
Britton RS,
Bacon BR,
Fleming RE,
Sly WS,
and
Roopenian DC.
Naturally variant autosomal and sex-linked loci determine the severity of iron overload in beta 2-microglobulin-deficient mice.
Proc Natl Acad Sci USA
98:
5170-5174,
2001
41.
Theil, EC.
The iron responsive element (IRE) family of mRNA regulators. Regulation of iron transport and uptake compared in animals, plants, and microorganisms.
Met Ions Biol Syst
35:
403-434,
1998[Web of Science][Medline].
42.
Theil, EC,
McKenzie RA,
and
Sierzputowska-Gracz H.
Structure and function of IREs, the noncoding mRNA sequences regulating synthesis of ferritin, transferrin receptor and (erythroid) 5-aminolevulinate synthase.
Adv Exp Med Biol
356:
111-118,
1994[Medline].
43.
Trinder, D,
Oates PS,
Thomas C,
Sadleir J,
and
Morgan EH.
Localisation of divalent metal transporter 1 (DMT1) to the microvillus membrane of rat duodenal enterocytes in iron deficiency, but to hepatocytes in iron overload.
Gut
46:
270-276,
2000
44.
Vulpe, CD,
Kuo YM,
Murphy TL,
Cowley L,
Askwith C,
Libina N,
Gitschier J,
and
Anderson GJ.
Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse.
Nat Genet
21:
195-199,
1999[Web of Science][Medline].
45.
Waheed, A,
Parkkila S,
Saarnio J,
Fleming RE,
Zhou XY,
Tomatsu S,
Britton RS,
Bacon BR,
and
Sly WS.
Association of HFE protein with transferrin receptor in crypt enterocytes of human duodenum.
Proc Natl Acad Sci USA
96:
1579-1584,
1999
46.
Wardrop, SL,
and
Richardson DR.
The effect of intracellular iron concentration and nitrogen monoxide on Nramp2 expression and non-transferrin-bound iron uptake.
Eur J Biochem
263:
41-49,
1999[Web of Science][Medline].
47.
Zoller, H,
Koch RO,
Theurl I,
Obrist P,
Pietrangelo A,
Montosi G,
Haile DJ,
Vogel W,
and
Weiss G.
Expression of the duodenal iron transporters divalent-metal transporter 1 and ferroportin 1 in iron deficiency and iron overload.
Gastroenterology
120:
1412-1419,
2001[Web of Science][Medline].
48.
Zoller, H,
Pietrangelo A,
Vogel W,
and
Weiss G.
Duodenal metal-transporter (DMT-1, NRAMP-2) expression in patients with hereditary haemochromatosis.
Lancet
353:
2120-2123,
1999[Web of Science][Medline].
This article has been cited by other articles:
![]() |
B. Wang, S. N. Schneider, N. Dragin, K. Girijashanker, T. P. Dalton, L. He, M. L. Miller, K. F. Stringer, M. Soleimani, D. D. Richardson, et al. Enhanced cadmium-induced testicular necrosis and renal proximal tubule damage caused by gene-dose increase in a Slc39a8-transgenic mouse line Am J Physiol Cell Physiol, April 1, 2007; 292(4): C1523 - C1535. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. P. Griffin, D. T. Ward, W. Liu, G. Stewart, I. D. Morris, and C. P. Smith Differential expression of divalent metal transporter DMT1 (Slc11a2) in the spermatogenic epithelium of the developing and adult rat testis Am J Physiol Cell Physiol, January 1, 2005; 288(1): C176 - C184. [Abstract] [Full Text] [PDF] |
||||
![]() |
T Kelleher, E Ryan, S Barrett, M Sweeney, V Byrnes, C O'Keane, and J Crowe Increased DMT1 but not IREG1 or HFE mRNA following iron depletion therapy in hereditary haemochromatosis Gut, August 1, 2004; 53(8): 1174 - 1179. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pietrangelo Hereditary Hemochromatosis -- A New Look at an Old Disease N. Engl. J. Med., June 3, 2004; 350(23): 2383 - 2397. [Full Text] [PDF] |
||||
![]() |
D. Barisani, A. Parafioriti, M. T. Bardella, H. Zoller, D. Conte, E. Armiraglio, C. Trovato, R. O. Koch, and G. Weiss Adaptive changes of duodenal iron transport proteins in celiac disease Physiol Genomics, May 19, 2004; 17(3): 316 - 325. [Abstract] [Full Text] [PDF] |
||||
![]() |
K A Stuart, G J Anderson, D M Frazer, L W Powell, M McCullen, L M Fletcher, and D H G Crawford Duodenal expression of iron transport molecules in untreated haemochromatosis subjects Gut, July 1, 2003; 52(7): 953 - 959. [Abstract] [Full Text] |
||||
![]() |
S. Ludwiczek, E. Aigner, I. Theurl, and G. Weiss Cytokine-mediated regulation of iron transport in human monocytic cells Blood, May 15, 2003; 101(10): 4148 - 4154. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Abdel-Rahman, F. K. Johnson, G. Gauthier-Dubois, I. E. Weston, and G. L. Kearns The Bioequivalence of Nizatidine (Axid(R)) in Two Extemporaneously and One Commercially Prepared Oral Liquid Formulations Compared with Capsule J. Clin. Pharmacol., February 1, 2003; 43(2): 148 - 153. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |