AJP - GI Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 282: G598-G607, 2002. First published October 31, 2001; doi:10.1152/ajpgi.00371.2001
0193-1857/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/4/G598    most recent
00371.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (38)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rolfs, A.
Right arrow Articles by Hediger, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rolfs, A.
Right arrow Articles by Hediger, M. A.
Vol. 282, Issue 4, G598-G607, April 2002

Intestinal expression of genes involved in iron absorption in humans

Andreas Rolfs1,2, Herbert L. Bonkovsky2, James G. Kohlroser2, Kristina McNeal2, Ashish Sharma2, Urs V. Berger1, and Matthias A. Hediger1

1 Membrane Biology Program and Renal Division, Brigham and Women's Hospital, Harvard Medical School, Boston, 02115; and 2 Department of Medicine, Medical School, University of Massachusetts, Worcester, Massachusetts 01651


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Hereditary hemochromatosis (HHC) is one of the most frequent genetic disorders in humans. In healthy individuals, absorption of iron in the intestine is tightly regulated by cells with the highest iron demand, in particular erythroid precursors. Cloning of intestinal iron transporter proteins provided new insight into mechanisms and regulation of intestinal iron absorption. The aim of this study was to assess whether, in humans, the two transporters are regulated in an iron-dependent manner and whether this regulation is disturbed in HHC. Using quantitative PCR, we measured mRNA expression of divalent cation transporter 1 (DCT1), iron-regulated gene 1 (IREG1), and hephaestin in duodenal biopsy samples of individuals with normal iron levels, iron-deficiency anemia, or iron overload. In controls, we found inverse relationships between the DCT1 splice form containing an iron-responsive element (IRE) and blood hemoglobin, serum transferrin saturation, or ferritin. Subjects with iron-deficiency anemia showed a significant increase in expression of the spliced form, DCT1(IRE) mRNA. Similarly, in subjects homozygous for the C282Y HFE mutation, DCT1(IRE) expression levels remained high despite high serum iron saturation. Furthermore, a significantly increased IREG1 expression was observed. Hephaestin did not exhibit a similar iron-dependent regulation. Our data show that expression levels of human DCT1 mRNA, and to a lesser extent IREG1 mRNA, are regulated in an iron-dependent manner, whereas mRNA of hephaestin is not affected. The lack of appropriate downregulation of apical and basolateral iron transporters in duodenum likely leads to excessive iron absorption in persons with HHC.

hemochromatosis; iron transporter; iron metabolism; regulation; divalent cation transporter; divalent metal transporter; iron regulated gene 1; ferroportin


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

HEREDITARY HEMOCHROMATOSIS (HHC) is one of the most prevalent inherited disorders in humans. It is associated with excessive intestinal iron absorption that may lead to damage of various organs, especially liver, pancreas, heart, and pituitary gland. As reported by Feder et al. (13), it is primarily the result of a missense mutation within the HFE gene (mostly cysteine 282 to tyrosine). In HHC, this mutation leads to iron accumulation in the body and may lead to liver cirrhosis or heart disease, and eventually death, if not treated by phlebotomy (4, 12). The HFE protein neither binds nor transports iron but, rather, physically interacts with the transferrin receptor (TfR) (14, 21, 30, 45). Some investigators have proposed (22) that the HFE protein competes with diferric transferrin for the TfR and thereby reduces the overall uptake of iron into cells, maintaining low but sufficient intracellular levels of iron (35, 38). However, it has also been reported that HFE protein can facilitate the uptake of transferrin-bound iron into certain cells (26).

In the mammalian body, iron absorption is tightly regulated by the iron demand for erythropoiesis and occurs only in the small intestine, in particular in the duodenum (18). Iron uptake is a two-step process, as revealed by studies of naturally occurring mutations in animals (3) and the characterization of recently cloned transporter genes (19, 24). At the apices of intestinal villi, enterocytes express divalent cation transporter 1 [DCT1, also known as divalent metal transporter 1 (DMT1) or Nramp2], which is essential for cellular uptake of iron from the intestinal lumen (15, 19). The transport from enterocytes into the serum, at the basolateral side of enterocytes, is accomplished by the coordinated action of the transporter iron-regulated gene 1 [IREG1, also known as metal transporter protein 1 (MTP1) or ferroportin1 (1, 11, 24)] and the multicopper ferroxidase hephaestin (44). The mRNAs of DCT1 and IREG1 contain sequences resembling iron-responsive elements (IREs), previously found in the mRNAs of ferritin and TfR, that presumably regulate their expression by intracellular iron in a cell-specific manner (for review, see Refs. 34 and 42). DCT1, IREG1 mRNA, and IREG1 protein have been reported to be upregulated in response to chronic iron deficiency in the intestine (1, 19, 24, 43). Abboud and Haile (1) isolated IREG1 (which they call MTP1) by the ability of its RNA to bind the IRE binding protein-1 (IRP1) immobilized on a column. Likewise, binding of IRP1 to the mRNA of DCT1 has been reported recently (46).

Interestingly, intestinal iron absorption, which is mediated by DCT1 and IREG1, occurs in duodenal villi (1, 8, 24), whereas the "modulator of iron homeostasis," HFE, is normally expressed in crypt cells (7, 31). How HFE, which is presumed to act as a modulator of the affinity of TfR for transferrin, can regulate iron absorption in villus cells is still not completely understood. Recently, it was shown (28, 33) that the lack of expression of hepcidin, a peptide synthesized in liver, leads to iron overload in mice, similar to HFE or beta 2-microglobulin knockout mice. Whether this peptide acts as a regulator of genes involved in iron absorption, and how this regulation occurs, remains to be determined.

A model proposed by Conrad et al. in 1964 (10) describes a possible mechanism for regulation of iron absorption mediated by the amount of iron absorbed by crypt cells in the intestine. This body iron "sensing mechanism" in crypt cells might be disturbed in HHC, leading to imbalance in intestinal iron absorption in villus cells (37). The observed iron-dependent regulation of the two iron transporters, DCT1 and IREG/MTP1, raises the question of a possible dysregulation of these transporters in HHC. In two previous studies, carefully selected HHC patients homozygous for C282Y were compared with control subjects, subjects with secondary iron overload, and iron-deficient subjects for their expression level of total DCT1 and IREG1. DCT1 and IREG1 were found to be increased in HHC. However, this study did not differentiate between the two DCT1 splice forms (with and without an IRE) (47, 48), and the expression of hephaestin was not examined.

Recently, two rare forms of HHC not related to mutations in the HFE gene have been described. One of them is caused by a missense mutation in the IREG1 gene (29) and the other one by a defect in the recently identified second TfR isoform, called TfR2 (36). These findings highlight the importance of iron transport in controlling body iron homeostasis.

In the present study, we investigated the expression of the mRNAs of both the apical and basolateral iron transporters in human upper intestinal biopsies in subjects with iron-deficiency anemia, normal iron, and iron overload. We compared the data from patients with homozygous HHC, subjects with and without the major (C282Y) and minor (H63D) mutations of HFE associated with HHC at different levels of serum ferritin, and transferrin saturation (TfS). We found that, in HHC patients without liver disease, DCT1(IRE) and IREG1 are significantly upregulated compared with control individuals, whereas no changes were detected for hephaestin. We also assessed the portion of DCT1 upregulation that is attributable to HHC by studying the regulation of DCT1 in normal individuals as a function of blood hemoglobin, serum iron, and ferritin levels. The "normal" regulation of DCT1 in human intestine by differentiating the two splice forms has not been reported heretofore.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Proximal duodenal biopsy samples (from the second portion within 5 cm of the duodenal bulb) were obtained from nine patients with classic HHC (C282Y +/+, H63D -/-) and 27 patients with wild-type genotype (C282Y -/-, H63D -/-). Patients were recruited from the clinic or the endoscopy suite of University of Massachusetts Memorial Healthcare. One patient with phenotypic hemochromatosis volunteered to undergo endoscopy for study purposes. All other patients volunteered for duodenal biopsies during medically indicated upper gastrointestinal endoscopies. In all cases, upper gastrointestinal endoscopies were performed in subjects who were ingesting diets that were not limited or supplemented with iron and after an overnight fast of at least 12 h. The study protocol and consent form were approved by the Human Subjects Committee of the University of Massachusetts. All patients were older than 18 years and gave their written, informed consents.

At the time of endoscopy, blood was obtained for hematocrit, hemoglobin, serum ferritin, serum iron binding capacity, transferrin, and HFE mutational analysis. The duodenal biopsies were obtained with standard mucosal biopsy forceps inserted through standard gastrofiberscopes (GIF140; Olympus, Tokyo, Japan). They were immediately placed into 300 µl of Ultraspec Total RNA isolation reagent (Biotecx, Houston, TX). Typically, a total of six biopsies, each ~5 mg wet weight, were placed into three 1.5-ml microcentrifuge tubes, two specimens per tube. A seventh biopsy was also collected, immediately placed into a cryovial, and snap frozen in liquid N2 for histochemical studies. Tissue in Ultraspec was treated following the manufacturer's instructions, RNAs were stored at -20°C under isopropanol, and before first strand synthesis they were centrifuged, washed in ethanol, and dissolved in 20 µl water.

Random primed first strand cDNA was synthesized from each biopsy sample with an AMV-RT kit, following the manufacturer's instructions (Roche, Indianapolis, IN) and using 1 µg total RNA as a template (OD260). Genomic sequences for IREG1 and hephaestin were obtained from the high throughput genome sequence library of GenBank (IREG1 accession no. AC012488; hephaestin accession no. AC020739). For beta -actin and DCT1, the earlier published genomic sequences (23, 27) were used to design oligonucleotide primers.

The PCR primers synthesized were as follows: beta -actin (GenBank accession no. M10277) 2282GGGAAATCGTGCGTGACATT2301 and 2583CACGAAACTACCTTCAACTCC2603, exons 3-4; IREG1 (GenBank accession no. AC012488) 224TGCTATCTCCAGTTCCTTGC205 and 160203TGTCTTCTCCTGCAACAACA160184, exons 1-5; hephaestin (GenBank accession no. AC020739) 79303TATACCATCCACCCTCATGG79284 and 63319GCATCCTATTGCTCTCCTGA63338, exons 2-4; DCT1(non-IRE) (GenBank accession nos. AF064481 and AF064483) 1535CCCATCCTCACATTTACGAG1554 and 953ATCCCAGAGTCCAAGACACA934, exons14-17; and DCT1(IRE) (GenBank accession nos. AF064481 and AF064482) 1535CCCATCCTCACATTTACGAG1554 and 921CCCTAATCCAGTTCTAAG904 exons 14-16a (IRE 3' end), respectively.

Quantitative PCR amplification was performed with the Lightcycler device/software and the SYBRgreen DNA master kit (Roche) following the manufacturer's instructions. After initial denaturation at 95°C for 30 s, each gene was independently amplified and detected using the following cycles (usually 40 cycles): beta -actin: 95°C, 0 s; 62°C, 4 s; 72°C, 5 s; 82°C, 2 s (fluorescent detection; gain: 20); IREG1: 95°C, 0 s; 58°C, 8 s; 72°C, 18 s; 82°C, 3 s (fluorescent detection; gain: 15); hephaestin: 95°C, 0 s; 53°C, 10 s; 72°C, 15 s; 82°C, 2 s (fluorescent detection; gain: 30); DCT1(IRE): 95°C, 0 s; 57°C, 5 s; 72°C, 12 s; 82°C, 1 s (fluorescent detection; gain: 20); and DCT1(non-IRE): 95°C, 0 s; 53°C, 10 s; 72°C, 15 s; 82°C, 2 s (fluorescent detection; gain: 30). Each PCR amplification was followed by a melting curve analysis (97°C, 5 s; 65°C, 15 s; followed by 0.1°C ramping by continuous fluorescent measurement to 99°C) to control for specific amplification products. Each sample was analyzed at least twice; in some cases, additional analysis of a second set of specimens was performed to examine intraindividual variations. Data obtained for DCT1, IREG1, and hephaestin were normalized by comparison with beta -actin expression; therefore, the results might be called semiquantitative.

Nonradioactive in situ hybridization was performed as described previously (19), using a digoxigenin-labeled cRNA probe that contained 800 bases of DCT1(IRE) 3' untranslated sequence (nucleotides 1719-2423, GenBank accession no. AB004857). Frozen sections (8 µm) were cut from the intestinal biopsies in a cryostat and captured onto Superfrost Plus microscope slides (Fisher Scientific, Pittsburgh, PA). The sections were fixed and acetylated and then hybridized at 68°C for 36 h to the DCT1(IRE) probe (approximate concentration, 100 ng/ml). Hybridized probe was visualized using alkaline phosphatase-conjugated antidigoxigenin Fab fragments (Roche) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Kierkegard and Perry Laboratories, Gaithersburg, MD). Sections were rinsed several times in 100 mM Tris, 150 mM NaCl, and 20 mM EDTA, pH 9.5, and coverslipped with glycerol gelatin (Sigma, St. Louis, MO). Control sections were incubated in an identical concentration of the sense probe transcript.

Statistical and regression analyses were performed using the computer software Prism (GraphPad Software, San Diego, CA). Linear regression was calculated by the least squares method, and r2 and P values are shown in the graphs to indicate the significance of the linear regression analyses. Significance was determined using the unpaired t-test method.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

We studied a total of 36 subjects (see Table 1 for details), of whom 27 were HFE normal [having neither the C282Y nor the H63D mutation; individuals with prefix WT (wild-type) and in the following called "controls"] and 9 of whom were homozygous for C282Y (i.e., have classic HHC; individuals with prefix HHC). We divided the two groups further into five different categories: controls without liver disease (WT - LD), controls with iron-deficiency anemia without liver disease (WT - Fe), controls with liver disease (WT + LD), and HHC patients with or without liver disease (HHC ± LD). The reason for subdividing individuals with liver disease is the observation that liver disease can result in extensive iron accumulation. This division avoids mixing of two different effects influencing body iron homeostasis.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Selected demographic, laboratory, and clinical data on subjects studied

The genomic organizations of the human hephaestin and IREG1 genes were assembled from sequences published by the human genome project. The primers for quantitative PCR of DCT1, IREG1, and hephaestin were designed to amplify mRNA sequences spanning over at least one intron, to rule out amplification of genomic DNA (Fig. 1), which was excluded by melting curve analysis using the Lightcycler software and by agarose gel electrophoresis (not shown).


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 1.   Positions of PCR primers and regions amplified within genes studied. For hephaestin (A) and iron-regulated gene 1 (IREG1) (B), the exon-intron structures are based on sequences derived from the high throughput genome sequence part of GenBank, and for divalent cation transporter 1 (DCT1; C), the exon-intron structures are based on the published sequences (see MATERIALS AND METHODS for details). The exons are shown as black rectangles, except for the 2 different exons (16 and 16a) of DCT1, which are shown as gray. Double arrows indicate relative position of primes used for analysis. IRE, iron-responsive element.

As expected, WT - Fe subjects exhibited significantly lower mean serum TfS values (P < 0.0001) than controls (Fig. 2A). Furthermore, they had significantly higher mean values for DCT1(IRE) mRNA expression (P = 0.0078) than WT - LD controls, with a mean value ~10 times higher for anemic subjects than for subjects without anemia (Fig. 2B). This increase was also detectable by in situ hybridization analysis on sections of frozen intestinal biopsies (Fig. 3). Between these two groups, no significant difference for DCT1(non-IRE) expression (Fig. 2C) or hephaestin (not shown) was observed. With respect to IREG1 mRNA expression, a modest, though statistically not significant, increase of expression in WT - Fe subjects was observed, in contrast with an earlier publication (47). We failed to detect an effect of age or gender on DCT1 mRNA expression in this study (data not shown). Control subjects with normal iron status exhibited a scattering for both DCT1(IRE) and DCT1(non-IRE) expression within roughly one order of magnitude [after normalization to beta -actin (Fig. 2A)], in agreement with an earlier publication that measured the total DCT1 content (46). Normalized mean values for DCT1(IRE) were ~10-fold higher than DCT1(non-IRE), a difference also observed for intestinal DCT1 expression in other mammals (A. Rolfs and M. A. Hediger, unpublished observations).


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 2.   Levels of serum transferrin saturation (TfS; A) and mRNA levels of DCT1(IRE) (B), DCT1(non-IRE) (C), and IREG1 (D) mRNA in subjects studied. Values are means ± SD. Values that differ significantly from control values are marked with symbols. A: serum TfS; star  less than control, P < 0.0001; # greater than control, P = 0.0001. B: DCT1(IRE) mRNA expression; star star greater than control, P = 0.0078; ## greater than control, P = 0.013. C: DCT1(non-IRE) mRNA expression; all groups had similar values, which did not differ statistically from each other. D: IREG1 expression; star star star significantly greater than control, P = 0.04.



View larger version (176K):
[in this window]
[in a new window]
 
Fig. 3.   In situ expression analysis of mRNA of DCT1(IRE) in duodenal biopsies from controls (no HFE mutations) without (A) and with (B) iron-deficiency anemia.

When we compared the WT - LD control group with the HHC - LD group (n = 5, subjects HHC35-HHC39 in Table 1), we not only observed significant differences in TfS (P = 0.0001, Fig. 2A), with HHC - LD having about three times higher values, but we also saw a significantly higher DCT1(IRE) expression in the HHC - LD group (P = 0.013, Fig. 2B). In addition, expression of IREG1 in the HHC - LD group was increased compared with controls (P = 0.04, Fig. 2D). No differences in DCT1(non-IRE) (Fig. 2C) or hephaestin (not shown) mRNA expression could be detected between these groups. The expression level of DCT1(IRE) (Fig. 2B) in the HHC - LD group was the same as for the WT - Fe group, despite markedly different serum iron data (Table 1, Fig. 2A). This suggests that, in contrast to iron-deficiency anemia, in HFE C282Y+/+ patients, expression of IREG1 and DCT1(IRE) are not correlated with or dependent on serum iron values. This lack of correlation may be due to the disturbance of iron homeostatic signaling in homozygous C282Y HFE subjects, analogous to the recently described alterations of hepcidin in mice (28, 33).

We failed to observe statistically significant differences for DCT1(with or without IRE), IREG1, or hephaestin mRNA expression between WT - LD and WT + LD subjects. The number of liver disease patients, or their diversity, might make it difficult to derive any conclusive data, since the etiology and stage of liver disease may influence expression of these genes. Indeed, in controls, expression levels of hephaestin mRNA were within one order of magnitude, regardless of serum TfS or ferritin. In contrast, patient WT09, who has chronic hepatitis C (Table 1), had modestly elevated hephaestin mRNA levels (not shown). The liver disease in this patient may have influenced the expression of the hephaestin gene in an iron-independent manner.

Among controls, we found inverse relationships of DCT1(IRE) mRNA expression and serum TfS (Fig. 4A; r2=0.49, P = 0.016), serum ferritin (Fig. 4B; r2=0.65, P = 0.005), and blood hemoglobin (Fig. 4C; r2=0.46, P = 0.015). Our data indicate that, in humans, the IRE-containing form of DCT1 mRNA is regulated in the same way in response to iron deprivation as in rat and mouse (8, 19). We did not observe significant correlations among duodenal IREG1 (see Fig. 6A), DCT1(non-IRE), or hephaestin mRNA expression and any of the blood data studied in the WT - LD group.


View larger version (14K):
[in this window]
[in a new window]
 
Fig. 4.   Inverse relationships of DCT1(IRE) mRNA expression in control subjects without liver disease (WT - LD; no HFE mutations) both with and without anemia, to serum TfS (A), serum ferritin levels (B), and blood hemoglobin (C). Values for expression of DCT1(IRE) mRNA were normalized to beta -actin mRNA expression level, which is not regulated by iron. The dotted lines indicate the 95% confidence interval for the linear regressions.

With respect to HHC - LD patients who, as already described, exhibited high DCT1(IRE) mRNA expression despite elevated TfS values (Fig. 2, A and B), no inverse relationship between DCT1(IRE) and serum ferritin or TfS was detectable (Fig. 5A, r2=0.26, P = 0.4; and Fig. 5B, r2=0.67, P = 0.08, respectively). For comparison, linear regression lines of controls from Fig. 4 are shown in Fig. 5. When correlating with blood hemoglobin, we found an inverse linear relationship that did not differ significantly from that of the WT - LD group (Fig. 5C), presumably because hemoglobin synthesis is not affected in HHC. In contrast to this, IREG1 mRNA expression and serum TfS exhibited a linear relationship for the HHC - LD group (Fig. 6B; r2=0.878, P = 0.02, n = 5), which was not paralleled by a similar relationship in WT - LD subjects (Fig. 6A). These findings demonstrate that the correlation between serum iron levels and intestinal iron absorption is disturbed in HFE C282Y +/+ patients.


View larger version (12K):
[in this window]
[in a new window]
 
Fig. 5.   DCT1(IRE) mRNA expression in patients with hereditary hemochromatosis without liver disease (HHC - LD) as a function of serum TfS (A), serum ferritin levels (B), and blood hemoglobin (C). Values for expression of DCT1(IRE) mRNA were normalized to beta -actin mRNA expression level. Note that 5 data points were used for each analysis; 2 points at ~75% saturation and ~log DCT1 3.0 are overlapping in A. For comparison, linear regression lines for controls from Fig. 4, A and B are included. The dotted lines in C indicate the 95% confidence interval for the linear regression.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 6.   Relationship of IREG1 mRNA expression in duodenal mucosa as a function of serum TfS in WT - LD (A) and HHC - LD (B) subjects. Values for expression of IREG1 mRNA were normalized to beta -actin mRNA expression levels. In controls, IREG1 mRNA expression did not correlate with TfS. Note that 5 data points were used for linear regression analysis of the HHC - LD group and that 2 points at ~75% saturation and ~log IREG 1.8 are overlapping. The dotted lines indicate the 95% confidence interval for the linear regression.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Numerous advances in iron metabolism have been made in the last 5 years, ushered in by cloning and characterization of the HFE gene and its mutations in HHC. In addition, several proteins responsible for intestinal iron absorption have been identified, including DCT1, IREG1, and hephaestin. Iron-dependent regulation of these transporters has not yet been the subject of in depth analysis in humans. The data described here, revealing an inverse correlation between DCT1(IRE) mRNA expression and serum TfS, serum ferritin, and blood hemoglobin (Figs. 4, A-C), emphasize the relationship of iron absorption and body iron homeostasis. The upregulation of DCT1 mRNA in iron deficiency is consistent with studies in rats (19) and mice (17) kept on diets low in iron, although in our patients, blood loss rather than iron-deficient diets was the cause of iron deficiency. The increase in DCT1 mRNA levels is most probably due to increased stability of the splice form of DCT1, which contains an IRE in its 3' untranslated region, since the other splice form without the IRE did not exhibit a similar regulation.

In contrast, in HFE C282Y +/+ patients, an inverse relationship for DCT1(IRE) and TfS was not observed and expression of DCT1(IRE) mRNA was higher than anticipated by the serum TfS. HHC - LD patients, despite high serum TfS, exhibit elevations of DCT1(IRE) mRNA expression to the same degree as controls with iron-deficient anemia. Moreover, duodenal DCT1(IRE) mRNA expression in these individuals seems less closely correlated to serum ferritin levels, since untreated patients having similar serum ferritin levels (HHC32 and HHC33) had different serum TfS (Table 1) and DCT1(IRE) expressions.

Our observations on HFE C282Y +/+ patients are in agreement with studies of DCT1(IRE) regulation in homozygous mice with a gene disruption of HFE (17). More recent studies (9, 16, 40) suggest that HFE-regulated iron absorption involves additional, yet-to-be-determined factors. In one study comparing normal and beta 2-microglobulin knockout mice (9), no significant difference in duodenal DCT1 protein amount was observed. In another recent report of HFE knockout mice (16), a strong influence of the genetic background on the level of iron accumulation was observed in three different inbred mouse strains, suggesting that additional heritable factors influence the phenotype and might account for the differences in expression and regulation of DCT1 reported from different laboratories (9, 17, 40). It has also been reported that, in the duodena of HHC patients and in HFE knockout mice, IRP binding affinity is increased, leading to increased TfR expression (2, 32). These findings support the model of a defect in iron sensing in crypt cells of the small intestine of HHC subjects, leading to inappropriately high levels of expression of genes involved in iron metabolism and transport in differentiating villus cells (37), as if these iron-replete subjects had iron-deficiency anemia. However, how mutation or disruption of the HFE gene results in altered signaling that makes maturing villus cells behave as if the body had iron-deficiency anemia remains unknown. Recent results in mice suggest that the oligopeptide hepcidin (also referred to as LEAP-1) may be a molecule that reports the status of tissue (especially liver) iron stores to duodenal crypt cells (28, 33). In normal subjects, such signaling aids in appropriate regulation of mucosal uptake and transport of iron by modulation of expression of DCT1(IRE) and IREG1. It is possible that patients with HHC or mice with HFE gene disruption lack the ability to transduce the hepcidin signal to their duodenal enterocytes. However, it is currently unknown whether the HFE-TfR complex interacts with hepcidin and whether such an interaction triggers a specific response in enterocytes and macrophages.

With respect to the expression of IREG1 mRNA, our HHC - LD patients exhibited a significant upregulation compared with controls, in agreement with recent findings (47, 48). IREG1 mRNA, which contains in its 5'-untranslated region an IRE, might be regulated at the transcriptional level (Figs. 2D and 6A), as described for ferritin or the erythroid form of 5-aminolevulinate synthase (20, 25, 34, 39, 41, 42). It should be noted that the observed linear correlation for IREG1 with serum TfS in HHC - LD occurs at a level of iron loading not normally seen in healthy individuals. Further studies with a larger number of patients are required to investigate the observed upregulation in hemochromatosis. In contrast, no iron-dependent regulation of the hephaestin gene expression was observed.

It has been known for many years that iron overload occurs in liver cirrhosis, and recent results indicate that the great majority of patients with end-stage chronic liver disease and iron overload do not have HHC (i.e., are not C282Y +/+) (5, 6). Although we found no evidence for upregulation of intestinal iron transport in cirrhosis, this possibility cannot be ruled out, since none of our liver disease patients had iron overload (Table 1), as shown by liver biopsies (data not shown). Therefore, how and why patients with end-stage liver disease develop iron overload remains to be elucidated.


    ACKNOWLEDGEMENTS

We thank the nursing and clinical staff of the University of Massachusetts Memorial Gastrointestinal Endoscopy Unit for their help in performing duodenal mucosal biopsies and care of patients studied.


    FOOTNOTES

Current address for J. G. Kohlroser: Division of Gastroenterology, Albany Medical College, Albany, NY

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants RO1-DK-57782 to M. A. Hediger and RO1-DK-38825 and DK-92326 to H. L. Bonkovsky and by a grant from the American College of Gastroenterology to J. G. Kohlroser and H. L. Bonkovsky.

Addresses for reprint requests and other correspondence: M. A. Hediger, Harvard Institutes of Medicine, Room 570, 77 Avenue Louis Pasteur, Boston, MA 02115 (E-mail: mhediger{at}rics.bwh.harvard.edu) or H. L. Bonkovsky, University of Massachusetts Medical School, Rm. S6-737, 55 Lake Ave. North, Worcester, MA 01651 (E-mail: bonkovsh{at}ummhc.org).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

10.1152/ajpgi.00371.2001

Received 20 August 2001; accepted in final form 29 October 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Abboud, S, and Haile DJ. A novel mammalian iron-regulated protein involved in intracellular iron metabolism. J Biol Chem 275: 19906-19912, 2000[Abstract/Free Full Text].

2.   Bahram, S, Gilfillan S, Kuhn LC, Moret R, Schulze JB, Lebeau A, and Schumann K. Experimental hemochromatosis due to MHC class I HFE deficiency: immune status and iron metabolism. Proc Natl Acad Sci USA 96: 13312-13317, 1999[Abstract/Free Full Text].

3.   Bannerman, RM. Genetic defects of iron transport. Fed Proc 35: 2281-2285, 1976[Web of Science][Medline].

4.   Bonkovsky, HL. Iron and the liver. Am J Med Sci 301: 32-43, 1991[Web of Science][Medline].

5.   Bonkovsky, HL, and Lambrecht RW. Iron-induced liver injury. Clin Liver Dis 4: 409-429, 2000[Medline].

6.   Bonkovsky, HL, and Obando JV. Role of HFE gene mutations in liver diseases other than hereditary hemochromatosis. Curr Gastroenterol Rep 1: 30-37, 1999[Medline].

7.   Byrnes, V, Ryan E, O'Keane C, and Crowe J. Immunohistochemistry of the Hfe protein in patients with hereditary hemochromatosis, iron deficiency anemia, and normal controls. Blood Cells Mol Dis 26: 2-8, 2000[Web of Science][Medline].

8.   Canonne-Hergaux, F, Gruenheid S, Ponka P, and Gros P. Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood 93: 4406-4417, 1999[Abstract/Free Full Text].

9.   Canonne-Hergaux, F, Levy JE, Fleming MD, Montross LK, Andrews NC, and Gros P. Expression of the DMT1 (NRAMP2/DCT1) iron transporter in mice with genetic iron overload disorders. Blood 97: 1138-1140, 2001[Abstract/Free Full Text].

10.   Conrad, ME, Weintraub LR, and Crosby WH. The role of the intestine in iron kinetics. J Clin Invest 43: 963-974, 1964.

11.   Donovan, A, Brownlie A, Zhou Y, Shepard J, Pratt SJ, Moynihan J, Paw BH, Drejer A, Barut B, Zapata A, Law TC, Brugnara C, Lux SE, Pinkus GS, Pinkus JL, Kingsley PD, Palis J, Fleming MD, Andrews NC, and Zon LI. Positional cloning of zebrafish ferroportin 1 identifies a conserved vertebrate iron exporter. Nature 403: 776-781, 2000[Medline].

12.   Feder, JN. The hereditary hemochromatosis gene (HFE): a MHC class I-like gene that functions in the regulation of iron homeostasis. Immunol Res 20: 175-185, 1999[Web of Science][Medline].

13.   Feder, JN, Gnirke A, Thomas W, Tsuchihashi Z, Ruddy DA, Basava A, Dormishian F, Domingo R, Jr, Ellis MC, Fullan A, Hinton LM, Jones NL, Kimmel BE, Kronmal GS, Lauer P, Lee VK, Loeb DB, Mapa FA, McClelland E, Meyer NC, Mintier GA, Moeller N, Moore T, Morikang E, Prass E, Quintana L, Starnes S, Schatzman R, Brunke K, Drayna D, Risch N, Bacon B, and Wolff RK. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat Genet 13: 399-408, 1996[Web of Science][Medline].

14.   Feder, JN, Penny DM, Irrinki A, Lee VK, Lebron JA, Watson N, Tsuchihashi Z, Sigal E, Bjorkman PJ, and Schatzman RC. The hemochromatosis gene product complexes with the transferrin receptor and lowers its affinity for ligand binding. Proc Natl Acad Sci USA 95: 1472-1477, 1998[Abstract/Free Full Text].

15.   Fleming, MD, Trenor CC, Su MA, Foernzler D, Beier DR, Dietrich WF, and Andrews NC. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 16: 383-386, 1997[Web of Science][Medline].

16.   Fleming, RE, Holden CC, Tomatsu S, Waheed A, Brunt EM, Britton RS, Bacon BR, Roopenian DC, and Sly WS. Mouse strain differences determine severity of iron accumulation in Hfe knockout model of hereditary hemochromatosis. Proc Natl Acad Sci USA 98: 2707-2711, 2001[Abstract/Free Full Text].

17.   Fleming, RE, Migas MC, Zhou X, Jiang J, Britton RS, Brunt EM, Tomatsu S, Waheed A, Bacon BR, and Sly WS. Mechanism of increased iron absorption in murine model of hereditary hemochromatosis: increased duodenal expression of the iron transporter DMT1. Proc Natl Acad Sci USA 96: 3143-3148, 1999[Abstract/Free Full Text].

18.   Green, R, Charlton R, Seftel H, Bothwell T, Mayet F, Adams B, Finch C, and Layrisse M. Body iron excretion in man: a collaborative study. Am J Med 45: 336-353, 1968[Web of Science][Medline].

19.   Gunshin, H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Gollan JL, and Hediger MA. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 388: 482-488, 1997[Medline].

20.   Hentze, MW, and Kuhn LC. Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide, and oxidative stress. Proc Natl Acad Sci USA 93: 8175-8182, 1996[Abstract/Free Full Text].

21.   Lebron, JA, Bennett MJ, Vaughn DE, Chirino AJ, Snow PM, Mintier GA, Feder JN, and Bjorkman PJ. Crystal structure of the hemochromatosis protein HFE and characterization of its interaction with transferrin receptor. Cell 93: 111-123, 1998[Web of Science][Medline].

22.   Lebron, JA, West AP, Jr, and Bjorkman PJ. The hemochromatosis protein HFE competes with transferrin for binding to the transferrin receptor. J Mol Biol 294: 239-245, 1999[Web of Science][Medline].

23.   Lee, PL, Gelbart T, West C, Halloran C, and Beutler E. The human Nramp2 gene---characterization of the gene structure, alternative splicing, promoter region and polymorphisms. Blood Cells Mol Dis 24: 199-215, 1998[Web of Science][Medline].

24.   McKie, AT, Marciani P, Rolfs A, Brennan K, Wehr K, Barrow D, Miret S, Bomford A, Peters TJ, Farzaneh F, Hediger MA, Hentze MW, and Simpson RJ. A novel duodenal iron-regulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation. Mol Cell 5: 299-309, 2000[Web of Science][Medline].

25.   Menotti, E, Henderson BR, and Kuhn LC. Translational regulation of mRNAs with distinct IRE sequences by iron regulatory proteins 1 and 2. J Biol Chem 273: 1821-1824, 1998[Abstract/Free Full Text].

26.   Montosi, G, Paglia P, Garuti C, Guzman CA, Bastin JM, Colombo MP, and Pietrangelo A. Wild-type HFE protein normalizes transferrin iron accumulation in macrophages from subjects with hereditary hemochromatosis. Blood 96: 1125-1129, 2000[Abstract/Free Full Text].

27.   Nakajima-Iijima, S, Hamada H, Reddy P, and Kakunaga T. Molecular structure of the human cytoplasmic beta-actin gene: interspecies homology of sequences in the introns. Proc Natl Acad Sci USA 82: 6133-6137, 1985[Abstract/Free Full Text].

28.   Nicolas, G, Bennoun M, Devaux I, Beaumont C, Grandchamp B, Kahn A, and Vaulont S. Lack of hepcidin gene expression and severe tissue iron overload in upstream stimulatory factor 2 (USF2) knockout mice. Proc Natl Acad Sci USA 98: 8780-8785, 2001[Abstract/Free Full Text].

29.   Njajou, OT, Vaessen N, Joosse M, Berghuis B, van Dongen JW, Breuning MH, Snijders PJ, Rutten WP, Sandkuijl LA, Oostra BA, van Duijn CM, and Heutink P. A mutation in SLC11A3 is associated with autosomal dominant hemochromatosis. Nat Genet 28: 213-214, 2001[Web of Science][Medline].

30.   Parkkila, S, Waheed A, Britton RS, Bacon BR, Zhou XY, Tomatsu S, Fleming RE, and Sly WS. Association of the transferrin receptor in human placenta with HFE, the protein defective in hereditary hemochromatosis. Proc Natl Acad Sci USA 94: 13198-13202, 1997[Abstract/Free Full Text].

31.   Parkkila, S, Waheed A, Britton RS, Feder JN, Tsuchihashi Z, Schatzman RC, Bacon BR, and Sly WS. Immunohistochemistry of HLA-H, the protein defective in patients with hereditary hemochromatosis, reveals unique pattern of expression in gastrointestinal tract. Proc Natl Acad Sci USA 94: 2534-2539, 1997[Abstract/Free Full Text].

32.   Pietrangelo, A, Casalgrandi G, Quaglino D, Gualdi R, Conte D, Milani S, Montosi G, Cesarini L, Ventura E, and Cairo G. Duodenal ferritin synthesis in genetic hemochromatosis. Gastroenterology 108: 208-217, 1995[Web of Science][Medline].

33.   Pigeon, C, Ilyin G, Courselaud B, Leroyer P, Turlin B, Brissot P, and Loreal O. A new mouse liver-specific gene, encoding a protein homologous to human antimicrobial peptide hepcidin, is overexpressed during iron overload. J Biol Chem 276: 7811-7819, 2001[Abstract/Free Full Text].

34.   Richardson, DR, and Ponka P. The molecular mechanisms of the metabolism and transport of iron in normal and neoplastic cells. Biochim Biophys Acta 1331: 1-40, 1997[Medline].

35.   Riedel, HD, Muckenthaler MU, Gehrke SG, Mohr I, Brennan K, Herrmann T, Fitscher BA, Hentze MW, and Stremmel W. HFE downregulates iron uptake from transferrin and induces iron-regulatory protein activity in stably transfected cells. Blood 94: 3915-3921, 1999[Abstract/Free Full Text].

36.   Roetto, A, Totaro A, Piperno A, Piga A, Longo F, Garozzo G, Cali A, De Gobbi M, Gasparini P, and Camaschella C. New mutations inactivating transferrin receptor 2 in hemochromatosis type 3. Blood 97: 2555-2560, 2001[Abstract/Free Full Text].

37.   Rolfs, A, and Hediger MA. Metal ion transporters in mammals: structure, function and pathological implications. J Physiol (Lond) 518: 1-12, 1999[Abstract/Free Full Text].

38.   Roy, CN, Penny DM, Feder JN, and Enns CA. The hereditary hemochromatosis protein, HFE, specifically regulates transferrin-mediated iron uptake in HeLa cells. J Biol Chem 274: 9022-9028, 1999[Abstract/Free Full Text].

39.   Schumann, K, Moret R, Kunzle H, and Kuhn LC. Iron regulatory protein as an endogenous sensor of iron in rat intestinal mucosa. Possible implications for the regulation of iron absorption. Eur J Biochem 260: 362-372, 1999[Web of Science][Medline].

40.   Sproule, TJ, Jazwinska EC, Britton RS, Bacon BR, Fleming RE, Sly WS, and Roopenian DC. Naturally variant autosomal and sex-linked loci determine the severity of iron overload in beta 2-microglobulin-deficient mice. Proc Natl Acad Sci USA 98: 5170-5174, 2001[Abstract/Free Full Text].

41.   Theil, EC. The iron responsive element (IRE) family of mRNA regulators. Regulation of iron transport and uptake compared in animals, plants, and microorganisms. Met Ions Biol Syst 35: 403-434, 1998[Web of Science][Medline].

42.   Theil, EC, McKenzie RA, and Sierzputowska-Gracz H. Structure and function of IREs, the noncoding mRNA sequences regulating synthesis of ferritin, transferrin receptor and (erythroid) 5-aminolevulinate synthase. Adv Exp Med Biol 356: 111-118, 1994[Medline].

43.   Trinder, D, Oates PS, Thomas C, Sadleir J, and Morgan EH. Localisation of divalent metal transporter 1 (DMT1) to the microvillus membrane of rat duodenal enterocytes in iron deficiency, but to hepatocytes in iron overload. Gut 46: 270-276, 2000[Abstract/Free Full Text].

44.   Vulpe, CD, Kuo YM, Murphy TL, Cowley L, Askwith C, Libina N, Gitschier J, and Anderson GJ. Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse. Nat Genet 21: 195-199, 1999[Web of Science][Medline].

45.   Waheed, A, Parkkila S, Saarnio J, Fleming RE, Zhou XY, Tomatsu S, Britton RS, Bacon BR, and Sly WS. Association of HFE protein with transferrin receptor in crypt enterocytes of human duodenum. Proc Natl Acad Sci USA 96: 1579-1584, 1999[Abstract/Free Full Text].

46.   Wardrop, SL, and Richardson DR. The effect of intracellular iron concentration and nitrogen monoxide on Nramp2 expression and non-transferrin-bound iron uptake. Eur J Biochem 263: 41-49, 1999[Web of Science][Medline].

47.   Zoller, H, Koch RO, Theurl I, Obrist P, Pietrangelo A, Montosi G, Haile DJ, Vogel W, and Weiss G. Expression of the duodenal iron transporters divalent-metal transporter 1 and ferroportin 1 in iron deficiency and iron overload. Gastroenterology 120: 1412-1419, 2001[Web of Science][Medline].

48.   Zoller, H, Pietrangelo A, Vogel W, and Weiss G. Duodenal metal-transporter (DMT-1, NRAMP-2) expression in patients with hereditary haemochromatosis. Lancet 353: 2120-2123, 1999[Web of Science][Medline].


Am J Physiol Gastrointest Liver Physiol 282(4):G598-G607
0193-1857/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Cell Physiol.Home page
B. Wang, S. N. Schneider, N. Dragin, K. Girijashanker, T. P. Dalton, L. He, M. L. Miller, K. F. Stringer, M. Soleimani, D. D. Richardson, et al.
Enhanced cadmium-induced testicular necrosis and renal proximal tubule damage caused by gene-dose increase in a Slc39a8-transgenic mouse line
Am J Physiol Cell Physiol, April 1, 2007; 292(4): C1523 - C1535.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
K. P. Griffin, D. T. Ward, W. Liu, G. Stewart, I. D. Morris, and C. P. Smith
Differential expression of divalent metal transporter DMT1 (Slc11a2) in the spermatogenic epithelium of the developing and adult rat testis
Am J Physiol Cell Physiol, January 1, 2005; 288(1): C176 - C184.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
T Kelleher, E Ryan, S Barrett, M Sweeney, V Byrnes, C O'Keane, and J Crowe
Increased DMT1 but not IREG1 or HFE mRNA following iron depletion therapy in hereditary haemochromatosis
Gut, August 1, 2004; 53(8): 1174 - 1179.
[Abstract] [Full Text] [PDF]


Home page
NEJMHome page
A. Pietrangelo
Hereditary Hemochromatosis -- A New Look at an Old Disease
N. Engl. J. Med., June 3, 2004; 350(23): 2383 - 2397.
[Full Text] [PDF]


Home page
Physiol. GenomicsHome page
D. Barisani, A. Parafioriti, M. T. Bardella, H. Zoller, D. Conte, E. Armiraglio, C. Trovato, R. O. Koch, and G. Weiss
Adaptive changes of duodenal iron transport proteins in celiac disease
Physiol Genomics, May 19, 2004; 17(3): 316 - 325.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
K A Stuart, G J Anderson, D M Frazer, L W Powell, M McCullen, L M Fletcher, and D H G Crawford
Duodenal expression of iron transport molecules in untreated haemochromatosis subjects
Gut, July 1, 2003; 52(7): 953 - 959.
[Abstract] [Full Text]


Home page
BloodHome page
S. Ludwiczek, E. Aigner, I. Theurl, and G. Weiss
Cytokine-mediated regulation of iron transport in human monocytic cells
Blood, May 15, 2003; 101(10): 4148 - 4154.
[Abstract] [Full Text] [PDF]


Home page
J Clin PharmacolHome page
S. M. Abdel-Rahman, F. K. Johnson, G. Gauthier-Dubois, I. E. Weston, and G. L. Kearns
The Bioequivalence of Nizatidine (Axid(R)) in Two Extemporaneously and One Commercially Prepared Oral Liquid Formulations Compared with Capsule
J. Clin. Pharmacol., February 1, 2003; 43(2): 148 - 153.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/4/G598    most recent
00371.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (38)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rolfs, A.
Right arrow Articles by Hediger, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rolfs, A.
Right arrow Articles by Hediger, M. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online