|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
B and MAP
kinase pathways in human colonic myofibroblasts
Department of Internal Medicine, Shiga University of Medical Science, Otsu 520-2192, Japan
| |
ABSTRACT |
|---|
|
|
|---|
Colonic
subepithelial myofibroblasts (SEMFs) may play a role in the modulation
of mucosal inflammatory responses. We investigated the effects of
interleukin (IL)-17 on IL-6 and chemokine [IL-8 and monocyte
chemoattractant protein (MCP)-1] secretion in colonic SEMFs. Cytokine
expression was determined by ELISA and Northern blotting. Nuclear
factor kappa B (NF-
B) DNA-binding activity was evaluated by
electrophortetic gel mobility shift assay (EMSA). The activation of
mitogen-activated protein kinase (MAPK) was assessed by immunoblotting.
IL-6, IL-8, and MCP-1 secretions were rapidly induced by IL-17. IL-17
induced NF-
B activation within 45 min after stimulation. A blockade
of NF-
B activation markedly reduced these responses. MAPK inhibitors
(SB-203580, PD-98059, and U-0126) significantly reduced the
IL-17-induced IL-6 and chemokine secretion. The combination of either
IL-17 + IL-1
or IL-17 + tumor necrosis factor (TNF)-
enhanced cytokine secretion; in particular, the effects of IL-17 + TNF-
on IL-6 secretion were much stronger than the other responses.
This was dependent on the enhancement of IL-6 mRNA stability. In
conclusion, human SEMFs secreted IL-6, IL-8, and MCP-1 in response to
IL-17. These responses might play an important role in the pathogenesis
of gut inflammation.
inflammation; chemokine; inflammatory bowel disease
| |
INTRODUCTION |
|---|
|
|
|---|
INFLAMMATORY BOWEL DISEASES (IBDs), such as ulcerative colitis and Crohn's disease, are characterized by recurrent flare of inflammation on a background of chronic enterocolitis. The activation of T cells has been regarded as an important factor in the pathogenesis of IBD (8, 17, 25, 44).
Interleukin (IL)-17 is a newly identified T cell-specific cytokine (19, 51). Human IL-17 is a ~20-kDa glycoprotein of 155 amino acids, the sequence of which exhibits close homology to both cytotoxic T lymphocyte-associated antigen-8 and the open reading frame 13 of T-lymphotropic Herpesvirus saimiri. IL-17 secretion is strictly limited in activated CD4+ and CD8+ T lymphocytes, predominantly in the memory CD45RO+ cells (2, 26, 46). In particular, both the Th1 and Th2 subsets of CD4+ cells release IL-17. On the other hand, the IL-17 receptor is widely distributed on various cell types (50, 52), and there is increasing evidence that IL-17 is a potent mediator of the inflammatory responses in various tissues. For example, IL-17 induces several genes associated with inflammation, including IL-6, granulocyte colony stimulating factor, leukemia inhibitory factor, and intercellular adhesion molecule-1 (1, 6, 9, 10, 20, 26).
Subepithelial myofibroblasts (SEMFs) are present immediately subjacent
to the basement membrane in the normal intestinal mucosa, juxtaposed
against the bottom of the epithelial cells (30, 37, 38).
These cells are specialized mesenchymal cells that exhibit the
ultrastructural features of both fibroblasts and smooth muscle cells
and can be characterized by positive immunoreactivity for both
-smooth muscle actin and vimentin (30, 37, 38, 43, 49).
Previous studies have suggested that intestinal SEMFs may be classified
as members of a family of functionally related cells, including hepatic
Ito cells, glomerular mesangial cells, and orbital and synovial
fibroblasts (49). The location of SEMFs below the basement
membrane suggests that these cells may play a role in regulation of a
number of epithelial cell functions, such as epithelial proliferation
and differentiation, and/or extracellular matrix metabolism affecting
the growth of the basement membrane. Recently, Mahida et al.
(30) reported a method to isolate pure populations of
SEMFs from the human colonic mucosa. These cells retain their representative and differentiated phenotypes, such as the positive expression of
-smooth muscle actin, vimentin, fibronectin, type IV
collagen, and laminin (30). Recent studies using these
cells have demonstrated that SEMFs can modulate the migration
(restitution) of epithelial cells (33) and that they
express cyclooxygenases (30). Another study
(23) demonstrated that the proliferation of these cells is
controlled by various growth factors. However, there is little
information available on the immunologic functions of SEMFs, which may
play an important role in the pathogenesis of IBD.
In this study, we investigated the potential role of IL-17 in the induction of inflammatory responses in SEMFs. In particular, we focused on the role of IL-17 in the induction of IL-6, IL-8, and monocyte chemoattractant protein (MCP)-1 secretion. The observations in this study indicate that T cells play an important role in the inflammatory responses of the intestine through the secretion of IL-17.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Reagents.
Recombinant human IL-1
, IL-17, and tumor necrosis factor (TNF)-
were obtained from R&D Systems (Minneapolis, MN). The inhibitor of
p42/44 mitogen-activated protein kinases (MAPKs; PD-98059 and U-0126)
(3, 18) and the inhibitor of p38 MAPK (SB-203580) (14) were purchased from Cell Signaling Technology
(Beverly, MA). All other reagents used in this study were purchased
from Sigma (St Louis, MO).
Culture of human colonic myofibroblasts. Primary cultures of SEMFs were generated according to the methods described by Mahida et al. (30). In brief, samples of the human adult colonic mucosa were obtained (with informed patient consent) from surgical specimens (>5 cm from the tumor margin) from patients undergoing a partial colectomy for carcinoma. The mucosa samples were completely denuded of epithelial cells by three 30-min incubations at 37°C in 1 mM EDTA (Sigma). The deepithelialized mucosal samples were subsequently cultured at 37°C in a 5% CO2 atmosphere in DMEM (GIBCO, Grand Island, NY) containing 10% fetal bovine serum (GIBCO). The denuded tissues were maintained in culture for up to 6 wk, and established colonies of myofibroblasts were cultured in DMEM containing 10% fetal bovine serum. All culture media were supplemented with 50 U/ml penicillin and 50 µg/ml streptomycin. The studies were performed on passages 2-6 of myofibroblasts isolated from six resection specimens.
Immunohistochemistry.
Mouse monoclonal antibodies against
-smooth muscle actin and
vimentin were obtained from Sigma. SEMF cells were grown on coverslips
and then fixed with 3% paraformaldehyde and 0.05% glutaraldehyde in
phosphate buffer before immunoperoxidase staining using a Vectastatin ABC peroxidase kit (Vector Laboratories, Burlingame, CA). After the
incubation with the primary antibodies, biotinylated goat anti-mouse
IgG was applied, followed by an avidin-biotinylated horseradish
peroxidase complex. Color development was performed with
diaminobenzidine with ammonium nickel sulfate.
Quantification of human IL-6, IL-8, and MCP-1. Amounts of antigenic IL-6, IL-8, and MCP-1 in the samples were determined by sandwich ELISA kits purchased from Bio-Source (Camarillo, CA).
Northern blot analysis. Total cellular RNA was isolated by the acid guanidinium thiocyanate-phenol-chloroform method (11). Northern blotting was performed according to the method previously described (4). Hybridization was performed with a 32P-labeled human IL-6 probe, generated by a random primed DNA labeling kit (Amersham, Arlington Heights, IL) and evaluated by autoradiography. The human IL-6 cDNA probe was prepared from a monolayer of human umbilical vein endothelial cells by the RT-PCR method using the following primers: 5', TGAGAAAGGAGACATGTAAC corresponding to nucleotides 262-282 isolated by May et al. (32): and 3', AGTGTCCTAACGCTCATACT corresponding to nucleotides 824-803. The PCR products were ligated into a TA cloning vector (Promega, Madison, WI) and sequenced by the dideoxynucleotide chain termination method (42). Hybridization for human IL-8 and MCP-1 was also performed according to the method described previously (4).
Nuclear extracts and electrophoretic gel mobility shift assays.
Nuclear extracts were prepared from cells exposed to IL-1
(10 ng/ml), IL-17 (500 ng/ml), and TNF-
(100 ng/ml) for 1.5 h according to the method of Dignam et al. (16). Consensus
oligonucleotides of nuclear factor (NF)-
B (5': AGT TGA GGG GAC
TTT CCC AGC C) (28) were used. The consensus
sequence for binding NF-
B is underlined. The oligonucleotides were
5' end-labeled with T4 polynucleotide kinase (Promega) and
[
-32P]ATP (Amersham). The binding reactions were
performed according to methods previously described (4).
Supershift experiments were performed as described above, except that 1 µl of antibody against each transcription factor was added to the
binding mixture in the absence of any labeled probe. Antisera
specifically recognizing each transcriptional factor were purchased
from Santa Cruz Biotechnology (Santa Cruz, CA). Experiments with
unlabeled oligonucleotides used a 100-fold molar excess relative to the
radiolabeled oligonucleotide.
Western blot analysis. Cells were exposed to cytokines in the presence or absence of inhibitors for the indicated periods of time. Cells were then washed with PBS and lysed in SDS sample buffer containing 100 µM orthovanadate. Lysates were homogenized, and protein content was determined using the Bradford method. For Western blotting, 10 µg of protein from each sample was subjected to SDS-PAGE on a 4-20% gradient gel under reducing conditions. Proteins were then electrophoretically transferred onto a nitrocellulose membrane. Antibodies against phosphorylated and total MAPKs were purchased from Cell Signaling Technology, and peroxidase-conjugated second antibodies were purchased from Amersham. Subsequently, the detection was performed using an enhanced chemiluminescence Western blotting system (Amersham).
Measurement of radioactivity. Radioactivity of each band of Northern blotting was determined by the Instant Imager electronic autoradiography system (model 2024/417257; Packard, Meriden, CT). For comparison, each radioactivity was converted to relative radioactivity to the value of medium alone.
Statistical analysis. Data are expressed as means ± SD. Statistical significance of changes was determined by the Mann-Whitney U-test. Differences resulting in P values <0.05 were considered to be statistically significant.
| |
RESULTS |
|---|
|
|
|---|
SEMF cells.
Morphological features of SEMF cells were compatible with the
characteristic features of myofibroblasts reported in the colon and
other tissues (30, 37, 38, 43, 49) (Fig.
1A). Immunohistochemical studies of SEMFs at passages 3-6
showed that the cells expressed
-smooth muscle actin (Fig.
1B) and vimentin (Fig. 1C). Cells were also
positive for laminin, fibronectin, and type IV collagen (data not
shown). Filamentous immunostaining was clearly observed for
-smooth
muscle actin and vimentin. These findings are consistent with these
cells being myofibroblasts, with phenotypic features similar to
myofibroblasts derived from other tissues.
|
Induction of IL-6, IL-8, and MCP-1 secretion by IL-17.
Human SEMFs were incubated for 24 h with increasing concentrations
of IL-17. The amount of IL-6, IL-8, and MCP-1 secreted into the
supernatants was determined by ELISA. As shown in Figs. 2A
and 2B, the addition of IL-17
induced a dose-dependent and time-dependent increase in IL-6, IL-8, and
MCP-1 secretion.
|
Induction of IL-6, IL-8, and MCP-1 mRNA expression by IL-17.
Kinetics of the effects of IL-17 on IL-6, IL-8, and MCP-1 mRNA
expression were evaluated in human SEMFs (Fig.
3, A and B). Cells
were stimulated with IL-17 (500 ng/ml), and the abundance of IL-6,
IL-8, and MCP-1 mRNA was determined by Northern blotting. IL-17 induced
a rapid increase in the accumulation of IL-6 mRNA and reached a maximum
at 1-3 h after stimulation. Thereafter, the induced IL-6 mRNA
levels decreased gradually. Similarly, IL-17 induced an increase in the
accumulation of IL-8 and MCP-1 mRNA, and these reached a maximum at
3 h. These levels also decreased gradually thereafter.
|
Modulation of transcription factor activation.
It has been reported that activation of transcriptional factor NF-
B
plays a central role in the induction of the IL-6, IL-8, and MCP-1
genes (29, 48). To elucidate the mechanisms underlying the
response to IL-17, we evaluated the activation of the transcription factor NF-
B in human SEMFs. As demonstrated in Fig.
4A, stimulation with IL-17
(500 ng/ml) for 1.5 h induced an increase in NF-
B DNA-binding
activity. Effects of IL-17 were rather weak compared with those induced
by IL-1
and TNF-
. The specificity of this reaction was confirmed
by the addition of cold oligo-DNA, which abolished the reactive band.
The addition of antibodies directed against the 50,000 mol wt (p50) and
a 65,000 mol wt (p65) subunits of NF-
B induced supershifts of the
binding complexes, indicating that this binding complex was a
heterodimer consisting of p50 and p65 subunits.
|
B DNA-binding activity induced by IL-17 was
determined (Fig. 4B). IL-17 induced a rapid increase in
NF-
B DNA-binding activity within 45 min (0.75 h), and then this was gradually decreased to basal level.
Effects of NF-
B inhibitors.
To confirm the role of NF-
B activation, we assessed the actions of
NF-
B inhibitors, such as the pyrrolidine derivative of dithiocarbamate (PDTC) (46) and
N-tosyl-L-phenylalanine chloromethyl ketone
(TPCK) (41) on IL-6, IL-8, and MCP-1 mRNA expression. A
role for oxygen radicals in mediating NF-
B activation has been postulated, and antioxidants such as PDTC have been shown to block NF-
B activation in several cell lines (46). TPCK blocks
NF-
B activation by preventing the degradation of the predominant
inhibitory molecule I
B
and inhibits the translocation of NF-
B
into the nucleus (41). As shown in Fig.
5A, PDTC and TPCK completely blocked IL-17-induced NF-
B DNA-binding activity. The addition of
PDTC blocked IL-17-induced IL-6, IL-8, and MCP-1 gene expression (Fig.
5B). TPCK potently attenuated IL-17-induced IL-6, IL-8, and
MCP-1 mRNA expression in human SEMFs (Fig. 5B). These
findings indicate that the activation of NF-
B may play a major role
in the induction of IL-6, IL-8, and MCP-1 mRNA expression in these cells.
|
IL-17 induces the activation of MAPKs.
In various cells, the MAPK family has been shown to play an important
role in regulating gene expression in response to inflammatory mediators (12, 21, 22). However, it has not been fully
studied whether MAPKs participate in IL-17 signaling. To assess whether similar responses are involved in our system, we evaluated the effects
of IL-17 on MAPK phosphorylation in human SEMFs. As shown in Fig.
6A, IL-17 induced the
phosphorylation of p42/44 [extracellular signal-regulated kinases
(ERK)] and p38 MAPKs as early as 15 min after stimulation. These
results indicate that MAPK pathways are rapidly activated by IL-17 in
human SEMFs. Phosphorylation of the MAPKs was actually blocked by MAPK
inhibitors in these cells (Fig. 6A). The cells were
pretreated for 15 min with the inhibitors of p42/44 MAPKs (PD-98059 and
U-0126) and the inhibitor of p38 MAPK (SB-203580) and were then
stimulated with cytokines for 15 min. PD-98059 and U-0126 inhibited
p42/44 MAPK phosphorylation but did not affect p38 MAPK
phosphorylation. SB-203580 blocked p38 MAPK phosphorylation but did not
affect p42/44 MAPK phosphorylation.
|
Suppression of the IL-6, IL-8, and MCP-1 induction by MAPK inhibitors. To evaluate the effects of MAPKs on the induction of IL-6, IL-8, and MCP-1 secretion by IL-17 in human SEMFs, the effects of SB-203580, PD-98059, and U-0126 were examined. As shown in Fig. 6B, each inhibitor significantly reduced the IL-17-induced IL-6, IL-8, and MCP-1 secretion. These results indicate that p42/44 and p38 MAPKs play an important role in IL-17-induced IL-6, IL-8, and MCP-1 secretion.
Combination effects of IL-17 + TNF-
and/or IL-17 + IL-1
.
Combined effects of IL-17 + TNF-
or IL-17 + IL-1
were
evaluated. Cells were incubated with stimulators for 24 h, and
IL-6, IL-8, and MCP-1 levels were then determined. As shown in Fig. 7A, IL-17 dose dependently
enhanced both TNF-
- and IL-1
-induced IL-6 secretion. Enhancing
effects of IL-17 on TNF-
-induced IL-6 secretion were much stronger
than those on IL-1
-induced IL-6 secretion. IL-17 dose dependently
enhanced both TNF-
- and IL-1
-induced IL-8 and MCP-1 secretion
(Fig. 7B), but these were modest compared with the effect of
IL-17 on TNF-
-induced IL-6 secretion.
|
or IL-17 + TNF-
on
IL-6, IL-8, and MCP-1 mRNA expression were investigated (Fig.
8, A and B). Cells
were stimulated for 3 h, and then the IL-6, IL-8, and MCP-1 mRNA
levels were determined by Northern blotting. These combinations
increased the IL-6, IL-8, and MCP-1 mRNA levels compared with the
effects of each individual cytokine. In particular, the combined effect
of IL-17 + TNF-
on IL-6 mRNA expression was strong.
|
, we investigated NF-
B activation. As shown
in Fig. 8C, electrophoretic gel mobility shift assays demonstrated that the effects of IL-17 on both IL-1
- and
TNF-
-induced NF-
B DNA-binding activities were modest, suggesting
that the transcriptional mechanism might not play a major role in the
strong induction of IL-6 by IL-17 + TNF-
.
IL-17 enhances TNF-
-induced IL-6 mRNA stabilities.
To evaluate the posttranscriptional regulation of IL-6 mRNA, we
looked at the effects of IL-17 on the TNF-
-induced IL-6 or IL-8 mRNA
stability. Cells were stimulated with cytokines for 3 h, and then
a chasing approach using the transcription inhibitor actinomycin D and Northern blot analysis were performed. As shown in
Fig. 9A, the levels of
TNF-
-induced IL-6 mRNA decreased rapidly, but IL-17 markedly
enhanced its stabilities. Furthermore, this effect was completely
attenuated by the addition of SB-203580, an inhibitor of p38 MAPK,
although the addition of PD-98059, the inhibitor of p42/44 MAPKs, had
no effect. These observations indicate that the potent enhancing
effects of IL-17 on TNF-
-induced IL-6 mRNA expression are mainly
mediated by the induction of IL-6 mRNA stabilization and that the
activation of p38 MAPK plays an important role in this process. On the
other hand, TNF-
-induced IL-8 mRNA was stable, and this was not
modulated by the addition of IL-17 (Fig. 9B).
|
| |
DISCUSSION |
|---|
|
|
|---|
Chronic mucosal inflammation is characterized by inflammatory cell infiltration with epithelial cell proliferation and migration, accompanied by an increased turnover of extracellular matrix components in the subepithelial region (40, 47). In this process, SEMFs may play an important role, although the precise functions of these cells remain unclear due to a lack of suitable experimental models. For this purpose, isolated cells are a useful tool for the study of the cellular responses associated with mucosal inflammation. In this study, we used normal human colonic SEMFs isolated by the method reported by Mahida et al. (30).
IL-6 plays an important role in the development of the acute phase response in various tissues via its broad proinflammatory actions (36, 39). Evidence obtained in studies of experimental animals and supported by data from humans suggests that the excessive production of IL-6 is involved in the pathogenesis of IBD (3, 15). However, the local biosynthetic site for IL-6 in the intestine remains unclear.
Chemokines also have a broad range of actions on the recruitment and function of specific populations of leukocytes at the site of inflammation. These factors also play an important role in the initiation and maintenance of the host inflammatory response (7, 34). Chemokines are structurally divided into several groups based on the presence of an intervening amino acid between the first two cysteine residues (e.g., CXC, and CC chemokines) (47, 48). The CXC chemokines act as chemoattractants and activators of neutrophils (e.g., IL-8), whereas the CC chemokines function mainly as chemoattractants for monocytes, eosinophils, T cells, and basophils (e.g., MCP-1).
T cell activation has been reported to play an important role in the
pathogenesis of IBD (8, 17, 25, 44). The infiltration of T
cells is a characteristic feature of the chronic inflammation in IBD,
and neutrophil infiltration becomes more prominent in accordance with
the progression of disease activity. The IL-6, IL-8, and MCP-1
secretion by human SEMFs in response to IL-17 emphasizes the importance
of T cell products in the induction of inflammation in the intestine.
Furthermore, in human SEMFs, the combination of IL-17 with either
IL-1
or TNF-
strongly enhances IL-6, IL-8, and MCP-1 secretion;
the effect of IL-17 + TNF-
on IL-6 secretion was particularly
strong. These responses were clearly observed, even at low
concentrations. These results indicate that the cytokines produced by
monocytes/macrophages (IL-1
and TNF-
) and T cells (IL-17) can
cooperate in the induction of IL-6, IL-8, and MCP-1 secretion in human
SEMFs at the low concentrations that are physiologically relevant.
Many cytokine-inducible responses are mediated by DNA-binding proteins
such as NF-
B (28). The promoter regions of the human IL-6, IL-8, and MCP-1 genes have been cloned and have been shown to
contain putative consensus binding motifs for NF-
B (29, 48). Our results demonstrated that the activation of NF-
B was necessary for IL-17-induced IL-6, IL-8, and MCP-1 gene expression in
human SEMFs. Evidence supporting this conclusion may be summarized. First, IL-17 rapidly induced nuclear proteins that exhibited binding to
an oligonucleotide containing an NF-
B consensus recognition motif.
Binding specificity was confirmed by experiments in which binding was
blocked by the addition of excess cold NF-
B oligonucleotide. Second,
inhibition of NF-
B activation by PDTC and TPCK induced a marked
decrease in IL-17-induced IL-6, IL-8, and MCP-1 mRNA expression. PDTC
and TPCK are potent inhibitors of NF-
B activation (41,
46).
MAPK activation has been regarded as another important signaling event
in response to proinflammatory stimuli. Three subgroups of the MAPK
family have been identified, and all are phosphorylated on their
tyrosine and threonine residues by upstream kinases, the MAPK kinases.
The p44 and p42 ERK1/2 mediate responses mainly to mitogenic stimuli,
whereas the c-Jun NH2-terminal kinases and p38
mediate responses to cellular stress (12, 21, 22). In this
study, we showed that IL-17 can activate two groups of MAPKs in human
SEMFs. The role of the MAPKs in IL-17-induced IL-6, IL-8, and MCP-1
secretion was also investigated by using specific inhibitors. Imidazole
compound SB-203580 is a specific inhibitor of p38 MAPK (14). SB-203580 caused a significant decrease in the
IL-17-induced IL-6, IL-8, and MCP-1 secretion, indicating that p38
activation was involved. This observation is compatible with the recent
report by Craig et al. (13) indicating that the
stimulation of p38 MAPK by the MAPK kinase MKK6 activates NF-
B
DNA-binding activity and induces IL-6 secretion. In addition, we
addressed the role of ERK1/2 in our system. PD-98059 is a specific
inhibitor of MAPK/ERK kinase (MEK1) (3), the kinase
directly upstream to ERK1/2, and U-0126 is a specific inhibitor of MEK1
and MEK2 (18). U-0126 blocked the phosphorylation of
ERK1/2 more potently than PD-98059. PD-98059 and U-0126 caused a
significant inhibition of the IL-17-induced IL-6, IL-8, and MCP-1
secretion. Thus we concluded that ERK1/2 MAPKs also participate in the
IL-6, IL-8, and MCP-1 secretion induced by IL-17 in human SEMFs.
Molecular mechanisms involved in the strong induction of IL-6 secretion
by the combination of IL-17 + TNF-
remains to be clarified. One
possible approach may be to evaluate the changes in the NF-
B binding
activity. However, IL-17 exerted modest effects on both IL-1
- and
TNF-
-induced NF-
B DNA-binding activity, suggesting that
transcriptional mechanisms did not play a role. We next evaluated the
changes in mRNA stabilities. As shown in Fig. 9, TNF-
-induced IL-6
mRNA decreased rapidly, whereas TNF-
-induced IL-8 mRNA was stable.
The addition of IL-17 markedly prolonged the half-life of
TNF-
-induced IL-6 mRNA, indicating that the strong induction of IL-6
mRNA by IL-17 + TNF-
was mainly mediated by the enhancement of
the stability of the IL-6 gene. As reported (27, 31, 35) in other genes, the activation of p38 MAPK was involved in the induction of IL-6 gene stabilization by IL-17 + TNF-
, because SB-203580 completely attenuated these responses. Because the effects of
PD-98059 on IL-6 gene stability were negligible, ERK1/2 MAPKs did not
play a role in the induction of IL-6 gene stabilization by IL-17 + TNF-
. It has been reported that MKK-6- or MKK-3-induced-p38 activation phosphorylates the kinase MAPK-activated protein kinase 2 (MAPKAPK2) (31). The mRNA stabilization by p38 activation is considered to be mediated by MAPKAPK2, although the relevant substrates of MAPKAPK2 have not fully been identified
(31). The precise mechanisms and molecules participating
in IL-17 + TNF-
-induced IL-6 gene stabilization should be
determined in the future.
In conclusion, this study demonstrated for the first time that IL-17 induces IL-6, IL-8, and MCP-1 secretion in human colonic SEMFs. Although the importance of proinflammatory cytokines in the pathogenesis of IBD is becoming increasingly apparent, the precise mechanisms responsible for the cellular responses have not been fully identified. It is likely that many inflammatory genes are induced in SEMFs in the colonic mucosa. Further investigations using SEMFs will clarify the regulatory mechanisms involved in the pathogenesis of IBD.
| |
ACKNOWLEDGEMENTS |
|---|
This study was supported, in part, by Grants-in-Aid 12470121 and 13470119 for Scientific Research (B) from the Ministry of Education, Culture, Sports, Science and Technology of Japan.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: A. Andoh, Dept. of Internal Medicine, Shiga University of Medical Science, Seta-Tsukinowa, Otsu 520-2192, Japan (E-mail: andoh{at}belle.shiga-med.ac.jp).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published February 6, 2002;10.1152/ajpgi.00494.2001
Received 19 November 2001; accepted in final form 24 January 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Albanesi, C,
Cavani A,
and
Girolomoni G.
IL-17 is produced by nickel-specific T lymphocytes and regulates ICAM-1 expression and chemokine production in human keratinocytes: synergistic or antagonist effects with IFN-
and TNF-
.
J Immunol
162:
494-502,
1999
2.
Albanesi, C,
Scarponi C,
Cavani A,
Federici M,
Nasorri F,
and
Girolomoni G.
Interleukin-17 is produced by both Th1 and Th2 lymphocytes, and modulates interferon-
- and interleukin-4-induced activation of human keratinocytes.
J Invest Dermatol
115:
81-87,
2000[Web of Science][Medline].
3.
Alessi, DR,
Cuenda A,
Cohen P,
Dudley DT,
and
Saltiel AR.
PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo.
J Biol Chem
270:
27489-27494,
1995
4.
Andoh, A,
Takaya H,
Saotome T,
Shimada M,
Hata K,
Araki Y,
Nakamura F,
Shintani Y,
Fujiyama Y,
and
Bamba T.
Cytokine regulation of chemokine (IL-8, MCP-1, and RANTES) gene expression in human pancreatic periacinar myofibroblasts.
Gastroenterology
119:
211-219,
2000[Web of Science][Medline].
5.
Atreya, R,
Mudter J,
Finotto S,
Mullberg J,
Jostock T,
Wirtz S,
Schutz M,
Bartsch B,
Holtmann M,
Becker C,
Strand D,
Czaja J,
Schlaak JF,
Lehr HA,
Autschbach F,
Schurmann G,
Nishimoto N,
Yoshizaki K,
Ito H,
Kishimoto T,
Galle PR,
Rose-John S,
and
Neurath MF.
Blockade of interleukin-6 trans signaling suppress T-cell resistance against apoptosis in chronic intestinal inflammation: evidence in Crohn's disease and experimental colitis in vivo.
Nat Med
6:
583-588,
2000[Web of Science][Medline].
6.
Awane, M,
Andres PG,
Li DJ,
and
Reinecker HC.
NF-
B-inducing kinase is a common mediator of IL-17-, TNF-
-, and IL-1
-induced chemokine promoter activation in intestinal epithelial cells.
J Immunol
162:
5337-5344,
1999
7.
Baggiolimi, M,
Dewald B,
and
Moser B.
Interleukin-8 and related chemotactic cytokines
CXC and CC chemokines.
Adv Immunol
55:
97-179,
1994[Web of Science][Medline].
8.
Boirivant, M,
Marini M,
DiFelice G,
Pronio AM,
Montesani C,
Tersigni R,
and
Strober W.
Lamina propria T cells in Crohn's disease and other gastrointestinal inflammation show defective CD2 pathway-induced apoptosis.
Gastroenterology
116:
557-565,
1999[Web of Science][Medline].
9.
Cai, XY,
Gommol J-CP,
Justice L,
Narula SK,
and
Fine JS.
Regulation of granulocyte colony-stimulating factor gene expression by interleukin-17.
Immunol Lett
62:
51-58,
1998[Web of Science][Medline].
10.
Chabaud, M,
Fossiez F,
Taupin JL,
and
Miossec P.
Enhancing effects of IL-17 on IL-1-induced IL-6 and leukemia inhibitory factor production by rheumatoid arthritis synoviocytes and its regulation by Th2 cytokines.
J Immunol
161:
409-414,
1998
11.
Chomczynski, P,
and
Sacchi N.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[Web of Science][Medline].
12.
Cobb, MH,
and
Goldsmith EJ.
How MAP kinases are regulated.
J Biol Chem
270:
14843-14846,
1995
13.
Craig, R,
Larkin A,
Mingo AM,
Thuerauf DJ,
Andrews C,
McDonough PM,
and
Glembotski CC.
p38 MAPK and NF-
B collaborate to induce interleukin-6 gene expression and release. Evidence for a cytoprotective autocrine signaling pathway in a cardiac myocyte model system.
J Biol Chem
275:
23814-23824,
2000
14.
Cuenda, A,
Rouse J,
Doza YN,
Meier R,
Cohen P,
Gallagher TF,
Young PR,
and
Lee JC.
SB-203580 is a specific inhibitor of a MAP kinase homologue which is stimulated by cellular stresses and interleukin-1.
FEBS Lett
364:
229-233,
1995[Web of Science][Medline].
15.
Desreumaux, P.
Specific targeting of IL-6 signaling pathway: a new way to treat IBD?
Gut
47:
465-466,
2000
16.
Dignam, JD,
Lebovitz RM,
and
Roeder RG.
Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.
Nucleic Acids Res
11:
1475-1489,
1983
17.
Dohi, T,
Fujihashi K,
Kiyono H,
Elson CO,
and
McGhee JR.
Mice deficient in Th1- and Th2-type cytokines develop distinct forms of hapten-induced colitis.
Gastroenterology
119:
724-733,
2000[Web of Science][Medline].
18.
Favata, MF,
Horiuchi KY,
Manos EJ,
Daulerio AJ,
Stradley DA,
Feeser WS,
Van Dyk DE,
Pitts WJ,
Earl RA,
Hobbs F,
Copeland RA,
Magolda RL,
Scherle PA,
and
Trzaskos JM.
Identification of a novel inhibitor of mitogen-activated protein kinase kinase.
J Biol Chem
273:
18623-18632,
1998
19.
Fossiez, F,
Banchereau J,
Murry R,
van Kooten C,
Garrone P,
and
Lebecque S.
Interleukin-17.
Intern Rev Immunol
16:
541-551,
1998[Medline].
20.
Fossiez, F,
Djossou O,
Chomarat P,
Flores RL,
Ait YS,
Maat C,
Pin JJ,
Garrone P,
Garcia E,
Saeland S,
Blanchard D,
Gaillard C,
Das Mahapatra B,
Rouvier E,
Golstein P,
Banchereau J,
and
Lebecque S.
T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines.
J Exp Med
183:
2593-2603,
1996
21.
Freshney, NW,
Rawlinson L,
Guesdon F,
Jones E,
Cowley S,
Hsuan J,
and
Saklatvala J.
Interleukin-1 activates a novel protein kinase cascade that results in the phosphorylation of Hsp27.
Cell
78:
1039-1049,
1994[Web of Science][Medline].
22.
Han, J,
Lee JD,
Bibbs L,
and
Ulevitch RJ.
A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells.
Science
265:
808-811,
1994
23.
Jobson, TM,
Billington CK,
and
Hall IP.
Regulation of proliferation of human colonic subepithelial myofibroblasts by mediators important in intestinal inflammation.
J Clin Invest
101:
2650-2657,
1998[Web of Science][Medline].
24.
Jovanovic, DV,
Di Battista JA,
Martel PJ,
Jolicoeur FC,
He Y,
Zhang M,
Mineau F,
and
Pelletier JP.
IL-17 stimulates the production and expression of proinflammatory cytokines, IL-1
and TNF-
by human macrophages.
J Immunol
60:
3513-3521,
1998.
25.
Kam, LY,
and
Targan SR.
Cytokine-based therapies in inflammatory bowel disease.
Curr Opin Gastroenterol
15:
302-307,
1999[Medline].
26.
Kennedy, J,
Rossi DL,
Zurawski SM,
Vega F,
Kastelein RA,
Wagner JL,
Hannum CH,
and
Zlotnik A.
Mouse IL-17: a cytokine preferentially expressed by 
TCR+ CD4
CD8
T cells.
J Interferon Cytokine Res
16:
611-617,
1996[Web of Science][Medline].
27.
Lasa, M,
Mahtani KR,
Finch A,
Brewer G,
Saklatvala J,
and
Clark AR.
Regulation of cyclooxygenase 2 mRNA stability by the mitogen-activated protein kinase p38 signaling cascade.
Mol Cell Biol
20:
4265-4274,
2000
28.
Lenardo, MJ,
and
Baltimore D.
NF-
B: a pleiotropic mediator of inducible and tissue-specific gene control.
Cell
58:
227-229,
1989[Web of Science][Medline].
29.
Libermann, TA,
and
Baltimore D.
Activation of interleukin-6 gene expression through the NF-
B transcription factor.
Mol Cell Biol
10:
2327-2334,
1990
30.
Mahida, YR,
Beltinger J,
Marh S,
Goke M,
Gray T,
Podolsky DK,
and
Hawkey CJ.
Adult human colonic subepithelial myofibroblasts express extracellular matrix proteins and cyclooxygenase-1 and -2.
Am J Physiol Gastrointest Liver Physiol
273:
G1341-G1348,
1997
31.
Mahtani, KR,
Brook M,
Dean JLE,
Sully G,
Saklatvala J,
and
Clark AR.
Mitogen-activated protein kinase p38 controls the expression and posttranslational modification of tristetraprolin, a regulator of tumor necrosis factor alpha mRNA stability.
Mol Cell Biol
21:
6461-6469,
2001
32.
May, LT,
Helfgott DC,
and
Sehgal PB.
Anti-
-interferon antibodies inhibit the increased expression of HLA-B7 mRNA in tumor necrosis factor-treated human fibroblasts: structural studies of the
2 interferon involved.
Proc Natl Acad Sci USA
83:
8957-8961,
1986
33.
McKaig, BC,
Makh SS,
Hawkey CJ,
Podolsky DK,
and
Mahida YR.
Normal human colonic subepithelial myofibroblasts enhance epithelial migration (restitution) via TGF-
3.
Am J Physiol Gastrointest Liver Physiol
276:
G1087-G1093,
1999
34.
Miller, MD,
and
Krangel MS.
Biology and biochemistry of the chemokines: a family of chemotactic and inflammatory cytokines.
Crit Rev Immunol
12:
17-46,
1992[Web of Science][Medline].
35.
Montero, L,
and
Nagamine Y.
Regulation by p38 mitogen-activated protein kinase of adenylate- and uridylate-rich element-mediated urokinase-type plasminogen activator (uPA) messenger RNA stability and uPA-dependent in vitro cell invasion.
Cancer Res
59:
5286-5293,
1999
36.
Papanicolaou, DA,
Wilder RL,
Manolagas SC,
and
Chrousos GP.
The pathophysiologic roles of interleukin-6 in human disease.
Ann Int Med
128:
127-137,
1998
37.
Powell, DW,
Mifflin RC,
Valentich JD,
Crowe SE,
Saada JI,
and
West AB.
Myofibroblasts. I. Paracrine cells important in health and disease.
Am J Physiol Cell Physiol
277:
C1-C9,
1999
38.
Powell, DW,
Mifflin RC,
Valentich JD,
Crowe SE,
Saada JI,
and
West AB
Myofibroblasts. II. Intestinal subepithelial myofibroblasts.
Am J Physiol Cell Physiol
277:
C183-C201,
1999
39.
Richards, CD.
Interleukin-6.
In: Cyokines, edited by Mire-Sluis A,
and Thorpe R.. San Diego: Academic, 1998, p. 87-100.
40.
Riddle, RH.
Pathology of idiopathic inflammatory bowel disease.
In: Inflammatory Bowel Disease (4th ed.), edited by Kirsner JB,
and Shorter RG.. Baltimore, MD: Williams & Wilkins, 1995, p. 517-552.
41.
Rovin, BH,
Dickerson JA,
Tan LC,
and
Hebert CA.
Activation of nuclear factor-
B correlates with MCP-1 expression by human mesangial cells.
Kidney Int
48:
1263-1271,
1995[Web of Science][Medline].
42.
Sanger, F,
Nicklen S,
and
Coulson AR.
DNA sequencing with chain-terminating inhibitors.
Proc Natl Acad Sci USA
74:
5463-5467,
1977
43.
Sappino, AP,
Schurch W,
and
Gabbiani G.
Differentiation repertoire of fibroblastic cells: expression of cytoskeletal proteins as marker of phenotypic modulations.
Lab Invest
63:
144-161,
1990[Web of Science][Medline].
44.
Saubermann, LJ,
Probert CSJ,
Christ AD,
Chott A,
Turner JR,
Stevens AC,
Balk SP,
and
Blumberg RS.
Evidence of T cell receptor
-chain patterns in inflammatory and noninflammatory bowel disease states.
Am J Physiol Gastrointest Liver Physiol
276:
G613-G621,
1999
45.
Schreck, R,
Meier B,
Manne DN,
Droge W,
and
Baeuerle PA.
Dithiocarbamate as potent inhibitors of nuclear factor
B activation in intact cells.
J Exp Med
175:
1181-1194,
1992
46.
Shin, HC,
Benbernou N,
Esnault S,
and
Guenounou M.
Expression of IL-17 in human memory CD45RO+ T lymphocytes and its regulation by protein kinase A pathway.
Cytokine
11:
257-266,
1999[Web of Science][Medline].
47.
Stenson, WF.
Inflammatory bowel disease.
In: Textbook of Gastroenterology (2nd ed.), edited by Yamada T,
Alpers DH,
Owyang C,
Powel D,
and Silverstein F.. Philadelphia, PA: Lippincott, 1995, p. 1748-1806.
48.
Tanabe, O,
Akira S,
Kamiya T,
Wong GG,
Hirano T,
and
Kishimoto T.
Genomic structure of the murine IL-6 gene. High degree conservation of potential regulatory sequences between mouse and human.
J Immunol
141:
3875-3881,
1988[Abstract].
49.
Valentich, JD,
and
Powell DW.
Intestinal subepithelial myofibroblasts and mucosal immunophysiology.
Curr Opin Gastroenterol
10:
645-651,
1994.
50.
Yao, Z,
Fanslow WC,
Seldin MF,
Rousseau AM,
Painter SL,
Comeau MR,
Cohen JI,
and
Spriggs MK.
Herpesvirus saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor.
Immunity
3:
811-821,
1995[Web of Science][Medline].
51.
Yao, Z,
Painter SL,
Fanslow WC,
Ulrich D,
Macduff M,
Spriggs MK,
and
Armitage RJ.
Human IL-17: a novel cytokine derived from T cells.
J Immunol
155:
5483-5486,
1995[Abstract].
52.
Yao, Z,
Spriggs MK,
Derry JM,
Strockbine L,
Park LS,
Van den Bos T,
Zappone JD,
Painter SL,
and
Armitage RJ.
Molecular characterization of the human interleukin (IL)-17 receptor.
Cytokine
9:
794-800,
1997[Web of Science][Medline].
This article has been cited by other articles:
![]() |
K. E. Sivick, M. A. Schaller, S. N. Smith, and H. L. T. Mobley The Innate Immune Response to Uropathogenic Escherichia coli Involves IL-17A in a Murine Model of Urinary Tract Infection J. Immunol., February 15, 2010; 184(4): 2065 - 2075. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Schetter, G. H. Nguyen, E. D. Bowman, E. A. Mathe, S. T. Yuen, J. E. Hawkes, C. M. Croce, S. Y. Leung, and C. C. Harris Association of Inflammation-Related and microRNA Gene Expression with Cancer-Specific Mortality of Colon Adenocarcinoma Clin. Cancer Res., September 15, 2009; 15(18): 5878 - 5887. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nishida, A. Andoh, O. Inatomi, and Y. Fujiyama Interleukin-32 Expression in the Pancreas J. Biol. Chem., June 26, 2009; 284(26): 17868 - 17876. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Samuel, R. Walsh, J. Webb, A. Robins, C. Potten, and Y. R. Mahida Characterization of putative stem cells in isolated human colonic crypt epithelial cells and their interactions with myofibroblasts Am J Physiol Cell Physiol, February 1, 2009; 296(2): C296 - C305. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Nishida, A. Andoh, M. Shioya, S. Kim-Mitsuyama, A. Takayanagi, and Y. Fujiyama Phosphatidylinositol 3-kinase/Akt signaling mediates interleukin-32{alpha} induction in human pancreatic periacinar myofibroblasts Am J Physiol Gastrointest Liver Physiol, March 1, 2008; 294(3): G831 - G838. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Ning, A. M. K. Choi, and C. Li Carbon monoxide inhibits IL-17-induced IL-6 production through the MAPK pathway in human pulmonary epithelial cells Am J Physiol Lung Cell Mol Physiol, August 1, 2005; 289(2): L268 - L273. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. van den Berg, M. Kuiper, M. Snoek, W. Timens, D. S. Postma, H. M. Jansen, and R. Lutter Interleukin-17 Induces Hyperresponsive Interleukin-8 and Interleukin-6 Production to Tumor Necrosis Factor-{alpha} in Structural Lung Cells Am. J. Respir. Cell Mol. Biol., July 1, 2005; 33(1): 97 - 104. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bamba, A. Andoh, H. Yasui, J. Makino, S. Kim, and Y. Fujiyama Regulation of IL-11 expression in intestinal myofibroblasts: role of c-Jun AP-1- and MAPK-dependent pathways Am J Physiol Gastrointest Liver Physiol, August 8, 2003; 285(3): G529 - G538. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Venkatraman, B. S. Ramakrishna, R. V. Shaji, N. S. N. Kumar, A. Pulimood, and S. Patra Amelioration of dextran sulfate colitis by butyrate: role of heat shock protein 70 and NF-{kappa}B Am J Physiol Gastrointest Liver Physiol, June 9, 2003; 285(1): G177 - G184. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Andoh, S. Fujino, S. Bamba, Y. Araki, T. Okuno, T. Bamba, and Y. Fujiyama IL-17 Selectively Down-Regulates TNF-{alpha}-Induced RANTES Gene Expression in Human Colonic Subepithelial Myofibroblasts J. Immunol., August 15, 2002; 169(4): 1683 - 1687. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |