AJP - GI Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 282: G1035-G1044, 2002. First published February 6, 2002; doi:10.1152/ajpgi.00494.2001
0193-1857/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/6/G1035    most recent
00494.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (58)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hata, K.
Right arrow Articles by Bamba, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hata, K.
Right arrow Articles by Bamba, T.
Vol. 282, Issue 6, G1035-G1044, June 2002

IL-17 stimulates inflammatory responses via NF-kappa B and MAP kinase pathways in human colonic myofibroblasts

Kazunori Hata, Akira Andoh, Mitsue Shimada, Sanae Fujino, Shigeki Bamba, Yoshio Araki, Takafumi Okuno, Yoshihide Fujiyama, and Tadao Bamba

Department of Internal Medicine, Shiga University of Medical Science, Otsu 520-2192, Japan


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Colonic subepithelial myofibroblasts (SEMFs) may play a role in the modulation of mucosal inflammatory responses. We investigated the effects of interleukin (IL)-17 on IL-6 and chemokine [IL-8 and monocyte chemoattractant protein (MCP)-1] secretion in colonic SEMFs. Cytokine expression was determined by ELISA and Northern blotting. Nuclear factor kappa B (NF-kappa B) DNA-binding activity was evaluated by electrophortetic gel mobility shift assay (EMSA). The activation of mitogen-activated protein kinase (MAPK) was assessed by immunoblotting. IL-6, IL-8, and MCP-1 secretions were rapidly induced by IL-17. IL-17 induced NF-kappa B activation within 45 min after stimulation. A blockade of NF-kappa B activation markedly reduced these responses. MAPK inhibitors (SB-203580, PD-98059, and U-0126) significantly reduced the IL-17-induced IL-6 and chemokine secretion. The combination of either IL-17 + IL-1beta or IL-17 + tumor necrosis factor (TNF)-alpha enhanced cytokine secretion; in particular, the effects of IL-17 + TNF-alpha on IL-6 secretion were much stronger than the other responses. This was dependent on the enhancement of IL-6 mRNA stability. In conclusion, human SEMFs secreted IL-6, IL-8, and MCP-1 in response to IL-17. These responses might play an important role in the pathogenesis of gut inflammation.

inflammation; chemokine; inflammatory bowel disease


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

INFLAMMATORY BOWEL DISEASES (IBDs), such as ulcerative colitis and Crohn's disease, are characterized by recurrent flare of inflammation on a background of chronic enterocolitis. The activation of T cells has been regarded as an important factor in the pathogenesis of IBD (8, 17, 25, 44).

Interleukin (IL)-17 is a newly identified T cell-specific cytokine (19, 51). Human IL-17 is a ~20-kDa glycoprotein of 155 amino acids, the sequence of which exhibits close homology to both cytotoxic T lymphocyte-associated antigen-8 and the open reading frame 13 of T-lymphotropic Herpesvirus saimiri. IL-17 secretion is strictly limited in activated CD4+ and CD8+ T lymphocytes, predominantly in the memory CD45RO+ cells (2, 26, 46). In particular, both the Th1 and Th2 subsets of CD4+ cells release IL-17. On the other hand, the IL-17 receptor is widely distributed on various cell types (50, 52), and there is increasing evidence that IL-17 is a potent mediator of the inflammatory responses in various tissues. For example, IL-17 induces several genes associated with inflammation, including IL-6, granulocyte colony stimulating factor, leukemia inhibitory factor, and intercellular adhesion molecule-1 (1, 6, 9, 10, 20, 26).

Subepithelial myofibroblasts (SEMFs) are present immediately subjacent to the basement membrane in the normal intestinal mucosa, juxtaposed against the bottom of the epithelial cells (30, 37, 38). These cells are specialized mesenchymal cells that exhibit the ultrastructural features of both fibroblasts and smooth muscle cells and can be characterized by positive immunoreactivity for both alpha -smooth muscle actin and vimentin (30, 37, 38, 43, 49). Previous studies have suggested that intestinal SEMFs may be classified as members of a family of functionally related cells, including hepatic Ito cells, glomerular mesangial cells, and orbital and synovial fibroblasts (49). The location of SEMFs below the basement membrane suggests that these cells may play a role in regulation of a number of epithelial cell functions, such as epithelial proliferation and differentiation, and/or extracellular matrix metabolism affecting the growth of the basement membrane. Recently, Mahida et al. (30) reported a method to isolate pure populations of SEMFs from the human colonic mucosa. These cells retain their representative and differentiated phenotypes, such as the positive expression of alpha -smooth muscle actin, vimentin, fibronectin, type IV collagen, and laminin (30). Recent studies using these cells have demonstrated that SEMFs can modulate the migration (restitution) of epithelial cells (33) and that they express cyclooxygenases (30). Another study (23) demonstrated that the proliferation of these cells is controlled by various growth factors. However, there is little information available on the immunologic functions of SEMFs, which may play an important role in the pathogenesis of IBD.

In this study, we investigated the potential role of IL-17 in the induction of inflammatory responses in SEMFs. In particular, we focused on the role of IL-17 in the induction of IL-6, IL-8, and monocyte chemoattractant protein (MCP)-1 secretion. The observations in this study indicate that T cells play an important role in the inflammatory responses of the intestine through the secretion of IL-17.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Reagents. Recombinant human IL-1beta , IL-17, and tumor necrosis factor (TNF)-alpha were obtained from R&D Systems (Minneapolis, MN). The inhibitor of p42/44 mitogen-activated protein kinases (MAPKs; PD-98059 and U-0126) (3, 18) and the inhibitor of p38 MAPK (SB-203580) (14) were purchased from Cell Signaling Technology (Beverly, MA). All other reagents used in this study were purchased from Sigma (St Louis, MO).

Culture of human colonic myofibroblasts. Primary cultures of SEMFs were generated according to the methods described by Mahida et al. (30). In brief, samples of the human adult colonic mucosa were obtained (with informed patient consent) from surgical specimens (>5 cm from the tumor margin) from patients undergoing a partial colectomy for carcinoma. The mucosa samples were completely denuded of epithelial cells by three 30-min incubations at 37°C in 1 mM EDTA (Sigma). The deepithelialized mucosal samples were subsequently cultured at 37°C in a 5% CO2 atmosphere in DMEM (GIBCO, Grand Island, NY) containing 10% fetal bovine serum (GIBCO). The denuded tissues were maintained in culture for up to 6 wk, and established colonies of myofibroblasts were cultured in DMEM containing 10% fetal bovine serum. All culture media were supplemented with 50 U/ml penicillin and 50 µg/ml streptomycin. The studies were performed on passages 2-6 of myofibroblasts isolated from six resection specimens.

Immunohistochemistry. Mouse monoclonal antibodies against alpha -smooth muscle actin and vimentin were obtained from Sigma. SEMF cells were grown on coverslips and then fixed with 3% paraformaldehyde and 0.05% glutaraldehyde in phosphate buffer before immunoperoxidase staining using a Vectastatin ABC peroxidase kit (Vector Laboratories, Burlingame, CA). After the incubation with the primary antibodies, biotinylated goat anti-mouse IgG was applied, followed by an avidin-biotinylated horseradish peroxidase complex. Color development was performed with diaminobenzidine with ammonium nickel sulfate.

Quantification of human IL-6, IL-8, and MCP-1. Amounts of antigenic IL-6, IL-8, and MCP-1 in the samples were determined by sandwich ELISA kits purchased from Bio-Source (Camarillo, CA).

Northern blot analysis. Total cellular RNA was isolated by the acid guanidinium thiocyanate-phenol-chloroform method (11). Northern blotting was performed according to the method previously described (4). Hybridization was performed with a 32P-labeled human IL-6 probe, generated by a random primed DNA labeling kit (Amersham, Arlington Heights, IL) and evaluated by autoradiography. The human IL-6 cDNA probe was prepared from a monolayer of human umbilical vein endothelial cells by the RT-PCR method using the following primers: 5', TGAGAAAGGAGACATGTAAC corresponding to nucleotides 262-282 isolated by May et al. (32): and 3', AGTGTCCTAACGCTCATACT corresponding to nucleotides 824-803. The PCR products were ligated into a TA cloning vector (Promega, Madison, WI) and sequenced by the dideoxynucleotide chain termination method (42). Hybridization for human IL-8 and MCP-1 was also performed according to the method described previously (4).

Nuclear extracts and electrophoretic gel mobility shift assays. Nuclear extracts were prepared from cells exposed to IL-1beta (10 ng/ml), IL-17 (500 ng/ml), and TNF-alpha (100 ng/ml) for 1.5 h according to the method of Dignam et al. (16). Consensus oligonucleotides of nuclear factor (NF)-kappa B (5': AGT TGA GGG GAC TTT CCC AGC C) (28) were used. The consensus sequence for binding NF-kappa B is underlined. The oligonucleotides were 5' end-labeled with T4 polynucleotide kinase (Promega) and [gamma -32P]ATP (Amersham). The binding reactions were performed according to methods previously described (4). Supershift experiments were performed as described above, except that 1 µl of antibody against each transcription factor was added to the binding mixture in the absence of any labeled probe. Antisera specifically recognizing each transcriptional factor were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Experiments with unlabeled oligonucleotides used a 100-fold molar excess relative to the radiolabeled oligonucleotide.

Western blot analysis. Cells were exposed to cytokines in the presence or absence of inhibitors for the indicated periods of time. Cells were then washed with PBS and lysed in SDS sample buffer containing 100 µM orthovanadate. Lysates were homogenized, and protein content was determined using the Bradford method. For Western blotting, 10 µg of protein from each sample was subjected to SDS-PAGE on a 4-20% gradient gel under reducing conditions. Proteins were then electrophoretically transferred onto a nitrocellulose membrane. Antibodies against phosphorylated and total MAPKs were purchased from Cell Signaling Technology, and peroxidase-conjugated second antibodies were purchased from Amersham. Subsequently, the detection was performed using an enhanced chemiluminescence Western blotting system (Amersham).

Measurement of radioactivity. Radioactivity of each band of Northern blotting was determined by the Instant Imager electronic autoradiography system (model 2024/417257; Packard, Meriden, CT). For comparison, each radioactivity was converted to relative radioactivity to the value of medium alone.

Statistical analysis. Data are expressed as means ± SD. Statistical significance of changes was determined by the Mann-Whitney U-test. Differences resulting in P values <0.05 were considered to be statistically significant.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

SEMF cells. Morphological features of SEMF cells were compatible with the characteristic features of myofibroblasts reported in the colon and other tissues (30, 37, 38, 43, 49) (Fig. 1A). Immunohistochemical studies of SEMFs at passages 3-6 showed that the cells expressed alpha -smooth muscle actin (Fig. 1B) and vimentin (Fig. 1C). Cells were also positive for laminin, fibronectin, and type IV collagen (data not shown). Filamentous immunostaining was clearly observed for alpha -smooth muscle actin and vimentin. These findings are consistent with these cells being myofibroblasts, with phenotypic features similar to myofibroblasts derived from other tissues.


View larger version (113K):
[in this window]
[in a new window]
 
Fig. 1.   Phase contrast picture and immunohistochemical staining of colonic subepithelial myofibroblasts (SEMFs). A: phase contrast (×40). Colonic SEMFs at passages 3-6 were immunostained with monoclonal antibodies against alpha -smooth muscle actin (B) and vimentin (C) (×200). D: normal mouse IgG was used to detect background staining (×200).

Induction of IL-6, IL-8, and MCP-1 secretion by IL-17. Human SEMFs were incubated for 24 h with increasing concentrations of IL-17. The amount of IL-6, IL-8, and MCP-1 secreted into the supernatants was determined by ELISA. As shown in Figs. 2A and 2B, the addition of IL-17 induced a dose-dependent and time-dependent increase in IL-6, IL-8, and MCP-1 secretion.


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2.   Effects of interleukin (IL)-17 on IL-6, IL-8, and monocyte chemoattractant protein (MCP)-1 secretion in human SEMFs. A: cells were incubated for 24 h in the presence of increasing concentrations of IL-17. B: cells were incubated with or without IL-17 (500 µg/ml), and concentrations of IL-6, IL-8, and MCP-1 in supernatants were determined by ELISA. Values are expressed as means ± SD (n = 4 experiments).

Induction of IL-6, IL-8, and MCP-1 mRNA expression by IL-17. Kinetics of the effects of IL-17 on IL-6, IL-8, and MCP-1 mRNA expression were evaluated in human SEMFs (Fig. 3, A and B). Cells were stimulated with IL-17 (500 ng/ml), and the abundance of IL-6, IL-8, and MCP-1 mRNA was determined by Northern blotting. IL-17 induced a rapid increase in the accumulation of IL-6 mRNA and reached a maximum at 1-3 h after stimulation. Thereafter, the induced IL-6 mRNA levels decreased gradually. Similarly, IL-17 induced an increase in the accumulation of IL-8 and MCP-1 mRNA, and these reached a maximum at 3 h. These levels also decreased gradually thereafter.


View larger version (42K):
[in this window]
[in a new window]
 
Fig. 3.   Kinetics of IL-17-induced IL-6, IL-8, and MCP-1 mRNA expression in human SEMFs. A: cells were stimulated with IL-17 (500 ng/ml), and the levels of IL-6, IL-8, and MCP-1 mRNA were sequentially determined by Northern blotting. Ribosomal RNA, stained by ethidium bromide, is demonstrated (bottom). B: radioactivity of each band was determined. For comparison, each radioactivity was converted to relative radioactivity to the value at the start of incubation.

Modulation of transcription factor activation. It has been reported that activation of transcriptional factor NF-kappa B plays a central role in the induction of the IL-6, IL-8, and MCP-1 genes (29, 48). To elucidate the mechanisms underlying the response to IL-17, we evaluated the activation of the transcription factor NF-kappa B in human SEMFs. As demonstrated in Fig. 4A, stimulation with IL-17 (500 ng/ml) for 1.5 h induced an increase in NF-kappa B DNA-binding activity. Effects of IL-17 were rather weak compared with those induced by IL-1beta and TNF-alpha . The specificity of this reaction was confirmed by the addition of cold oligo-DNA, which abolished the reactive band. The addition of antibodies directed against the 50,000 mol wt (p50) and a 65,000 mol wt (p65) subunits of NF-kappa B induced supershifts of the binding complexes, indicating that this binding complex was a heterodimer consisting of p50 and p65 subunits.


View larger version (46K):
[in this window]
[in a new window]
 
Fig. 4.   A: electrophoretic gel mobility shift assays (EMSAs) for nuclear factor (NF)-kappa B DNA-binding activities. Cells were incubated with medium alone or IL-17 (500 ng/ml), IL-1beta (10 ng/ml), and TNF-alpha (100 ng/ml) for 1.5 h, and then nuclear extracts were prepared (P value not significant). Right, nonspecific band (N.S.). Lane 1, medium alone; lane 2, IL-17; lane 3, IL-1beta ; lane 4, TNF-alpha ; lane 5, IL-17 + cold probe; lane 6, IL-17 + anti-p50 antibody; and lane 7, IL-17 + anti-p65 antibody. B: kinetics of IL-17-induced NF-kappa B DNA-binding activity. Cells were stimulated with IL-17 (500 ng/ml), and then NF-kappa B DNA-binding activity was sequentially determined by EMSAs.

Kinetics of NF-kappa B DNA-binding activity induced by IL-17 was determined (Fig. 4B). IL-17 induced a rapid increase in NF-kappa B DNA-binding activity within 45 min (0.75 h), and then this was gradually decreased to basal level.

Effects of NF-kappa B inhibitors. To confirm the role of NF-kappa B activation, we assessed the actions of NF-kappa B inhibitors, such as the pyrrolidine derivative of dithiocarbamate (PDTC) (46) and N-tosyl-L-phenylalanine chloromethyl ketone (TPCK) (41) on IL-6, IL-8, and MCP-1 mRNA expression. A role for oxygen radicals in mediating NF-kappa B activation has been postulated, and antioxidants such as PDTC have been shown to block NF-kappa B activation in several cell lines (46). TPCK blocks NF-kappa B activation by preventing the degradation of the predominant inhibitory molecule Ikappa Balpha and inhibits the translocation of NF-kappa B into the nucleus (41). As shown in Fig. 5A, PDTC and TPCK completely blocked IL-17-induced NF-kappa B DNA-binding activity. The addition of PDTC blocked IL-17-induced IL-6, IL-8, and MCP-1 gene expression (Fig. 5B). TPCK potently attenuated IL-17-induced IL-6, IL-8, and MCP-1 mRNA expression in human SEMFs (Fig. 5B). These findings indicate that the activation of NF-kappa B may play a major role in the induction of IL-6, IL-8, and MCP-1 mRNA expression in these cells.


View larger version (57K):
[in this window]
[in a new window]
 
Fig. 5.   Effects of the NF-kappa B inhibitors. A: cells were stimulated for 1.5 h with IL-17 (500 ng/ml), IL-17 + pyrrolidine derivative of dithicarbamate (PDTC) (20 µM), or IL-17 + N-tosyl-L-phenylalamnine chloromethyl ketone (TPCK) (20 µM), and then NF-kappa B DNA-binding activity was determined by EMSAs. B: cells were incubated for 3 h with IL-17 (500 ng/ml) in the presence or absence of either PDTC (20 µM) or TPCK (20 µM), and then the total cellular RNA was extracted. The IL-6, IL-8, and MCP-1 mRNA expression was analyzed by Northern blotting.

IL-17 induces the activation of MAPKs. In various cells, the MAPK family has been shown to play an important role in regulating gene expression in response to inflammatory mediators (12, 21, 22). However, it has not been fully studied whether MAPKs participate in IL-17 signaling. To assess whether similar responses are involved in our system, we evaluated the effects of IL-17 on MAPK phosphorylation in human SEMFs. As shown in Fig. 6A, IL-17 induced the phosphorylation of p42/44 [extracellular signal-regulated kinases (ERK)] and p38 MAPKs as early as 15 min after stimulation. These results indicate that MAPK pathways are rapidly activated by IL-17 in human SEMFs. Phosphorylation of the MAPKs was actually blocked by MAPK inhibitors in these cells (Fig. 6A). The cells were pretreated for 15 min with the inhibitors of p42/44 MAPKs (PD-98059 and U-0126) and the inhibitor of p38 MAPK (SB-203580) and were then stimulated with cytokines for 15 min. PD-98059 and U-0126 inhibited p42/44 MAPK phosphorylation but did not affect p38 MAPK phosphorylation. SB-203580 blocked p38 MAPK phosphorylation but did not affect p42/44 MAPK phosphorylation.


View larger version (26K):
[in this window]
[in a new window]
 
Fig. 6.   A: effects of mitogen-activated protein kinase (MAPK) inhibitors on IL-17-induced MAPK activation. Cells were pretreated with 20 µM MAPK inhibitors (SB-203580, PD-98059 or U-0126) for 15 min. Cells were stimulated with IL-17 (500 ng/ml) for 15 min and lysed for Western blotting. B; effects of MAPK inhibitors on IL-17-induced IL-6, IL-8, and MCP-1 secretion. Cells were incubated for 24 h with IL-17 (500 ng/ml) in the presence or absence of 20 µM MAPK inhibitors, and the concentrations of IL-6, IL-8, and MCP-1 in the supernatants were determined by ELISA. Values are expressed as means ± SD (n = 4). There were significant differences from the values in the absence of MAPK inhibitors (* P < 0.05).

Suppression of the IL-6, IL-8, and MCP-1 induction by MAPK inhibitors. To evaluate the effects of MAPKs on the induction of IL-6, IL-8, and MCP-1 secretion by IL-17 in human SEMFs, the effects of SB-203580, PD-98059, and U-0126 were examined. As shown in Fig. 6B, each inhibitor significantly reduced the IL-17-induced IL-6, IL-8, and MCP-1 secretion. These results indicate that p42/44 and p38 MAPKs play an important role in IL-17-induced IL-6, IL-8, and MCP-1 secretion.

Combination effects of IL-17 + TNF-alpha and/or IL-17 + IL-1beta . Combined effects of IL-17 + TNF-alpha or IL-17 + IL-1beta were evaluated. Cells were incubated with stimulators for 24 h, and IL-6, IL-8, and MCP-1 levels were then determined. As shown in Fig. 7A, IL-17 dose dependently enhanced both TNF-alpha - and IL-1beta -induced IL-6 secretion. Enhancing effects of IL-17 on TNF-alpha -induced IL-6 secretion were much stronger than those on IL-1beta -induced IL-6 secretion. IL-17 dose dependently enhanced both TNF-alpha - and IL-1beta -induced IL-8 and MCP-1 secretion (Fig. 7B), but these were modest compared with the effect of IL-17 on TNF-alpha -induced IL-6 secretion.


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 7.   Combined effects of IL-17 + TNF-alpha or IL-17 + IL-1beta on IL-6, IL-8, and MCP-1 secretion. Cells were cultured for 24 h in the presence of various concentrations of the cytokines, and the concentration of IL-6, IL-8, and MCP-1 in the supernatants was determined by ELISA. Values are expressed as means ± SD (n = 4 experiments). Nos. in parentheses, ng/ml.

Combined effects of IL-17 + IL-1beta or IL-17 + TNF-alpha on IL-6, IL-8, and MCP-1 mRNA expression were investigated (Fig. 8, A and B). Cells were stimulated for 3 h, and then the IL-6, IL-8, and MCP-1 mRNA levels were determined by Northern blotting. These combinations increased the IL-6, IL-8, and MCP-1 mRNA levels compared with the effects of each individual cytokine. In particular, the combined effect of IL-17 + TNF-alpha on IL-6 mRNA expression was strong.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 8.   Combined effects of IL-17, IL-1beta , and TNF-alpha on IL-6, IL-8, and MCP-1 mRNA expression and NF-kappa B activation. A: cells were cultured for 3 h with IL-17 (500 ng/ml), IL-1beta (10 ng/ml), TNF-alpha (100 ng/ml), IL-17 + IL-1beta , or IL-17 + TNF-alpha , and then the IL-6, IL-8, and MCP-1 mRNA expression was determined by Northern blotting. B: radioactivity of each band of Northern blotting. For comparison, each radioactivity was converted to relative radioactivity to the value of IL-1beta or TNF-alpha alone. C: cells were stimulated with cytokines for 1.5 h, and NF-kappa B DNA-binding activity was determined by EMSA.

To define the mechanism involved in the strong induction of IL-6 mRNA by IL-17 + TNF-alpha , we investigated NF-kappa B activation. As shown in Fig. 8C, electrophoretic gel mobility shift assays demonstrated that the effects of IL-17 on both IL-1beta - and TNF-alpha -induced NF-kappa B DNA-binding activities were modest, suggesting that the transcriptional mechanism might not play a major role in the strong induction of IL-6 by IL-17 + TNF-alpha .

IL-17 enhances TNF-alpha -induced IL-6 mRNA stabilities. To evaluate the posttranscriptional regulation of IL-6 mRNA, we looked at the effects of IL-17 on the TNF-alpha -induced IL-6 or IL-8 mRNA stability. Cells were stimulated with cytokines for 3 h, and then a chasing approach using the transcription inhibitor actinomycin D and Northern blot analysis were performed. As shown in Fig. 9A, the levels of TNF-alpha -induced IL-6 mRNA decreased rapidly, but IL-17 markedly enhanced its stabilities. Furthermore, this effect was completely attenuated by the addition of SB-203580, an inhibitor of p38 MAPK, although the addition of PD-98059, the inhibitor of p42/44 MAPKs, had no effect. These observations indicate that the potent enhancing effects of IL-17 on TNF-alpha -induced IL-6 mRNA expression are mainly mediated by the induction of IL-6 mRNA stabilization and that the activation of p38 MAPK plays an important role in this process. On the other hand, TNF-alpha -induced IL-8 mRNA was stable, and this was not modulated by the addition of IL-17 (Fig. 9B).


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 9.   Changes in IL-6 (A) and IL-8 (B) mRNA stabilities. The cells were stimulated with TNF-alpha (100 ng/ml) or IL-17 (500 ng/ml) + TNF-alpha (100 ng/ml) for 3 h, and then actinomycin D (2 µg/ml) was added to the cultures. Total RNA was prepared at the times indicated and was processed for Northern blotting. To evaluate the role of p38 MAPK, SB-203580 (20 µM) was added simultaneously with actinomycin D after 3 h stimulation with IL-17 + TNF-alpha .


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Chronic mucosal inflammation is characterized by inflammatory cell infiltration with epithelial cell proliferation and migration, accompanied by an increased turnover of extracellular matrix components in the subepithelial region (40, 47). In this process, SEMFs may play an important role, although the precise functions of these cells remain unclear due to a lack of suitable experimental models. For this purpose, isolated cells are a useful tool for the study of the cellular responses associated with mucosal inflammation. In this study, we used normal human colonic SEMFs isolated by the method reported by Mahida et al. (30).

IL-6 plays an important role in the development of the acute phase response in various tissues via its broad proinflammatory actions (36, 39). Evidence obtained in studies of experimental animals and supported by data from humans suggests that the excessive production of IL-6 is involved in the pathogenesis of IBD (3, 15). However, the local biosynthetic site for IL-6 in the intestine remains unclear.

Chemokines also have a broad range of actions on the recruitment and function of specific populations of leukocytes at the site of inflammation. These factors also play an important role in the initiation and maintenance of the host inflammatory response (7, 34). Chemokines are structurally divided into several groups based on the presence of an intervening amino acid between the first two cysteine residues (e.g., CXC, and CC chemokines) (47, 48). The CXC chemokines act as chemoattractants and activators of neutrophils (e.g., IL-8), whereas the CC chemokines function mainly as chemoattractants for monocytes, eosinophils, T cells, and basophils (e.g., MCP-1).

T cell activation has been reported to play an important role in the pathogenesis of IBD (8, 17, 25, 44). The infiltration of T cells is a characteristic feature of the chronic inflammation in IBD, and neutrophil infiltration becomes more prominent in accordance with the progression of disease activity. The IL-6, IL-8, and MCP-1 secretion by human SEMFs in response to IL-17 emphasizes the importance of T cell products in the induction of inflammation in the intestine. Furthermore, in human SEMFs, the combination of IL-17 with either IL-1beta or TNF-alpha strongly enhances IL-6, IL-8, and MCP-1 secretion; the effect of IL-17 + TNF-alpha on IL-6 secretion was particularly strong. These responses were clearly observed, even at low concentrations. These results indicate that the cytokines produced by monocytes/macrophages (IL-1beta and TNF-alpha ) and T cells (IL-17) can cooperate in the induction of IL-6, IL-8, and MCP-1 secretion in human SEMFs at the low concentrations that are physiologically relevant.

Many cytokine-inducible responses are mediated by DNA-binding proteins such as NF-kappa B (28). The promoter regions of the human IL-6, IL-8, and MCP-1 genes have been cloned and have been shown to contain putative consensus binding motifs for NF-kappa B (29, 48). Our results demonstrated that the activation of NF-kappa B was necessary for IL-17-induced IL-6, IL-8, and MCP-1 gene expression in human SEMFs. Evidence supporting this conclusion may be summarized. First, IL-17 rapidly induced nuclear proteins that exhibited binding to an oligonucleotide containing an NF-kappa B consensus recognition motif. Binding specificity was confirmed by experiments in which binding was blocked by the addition of excess cold NF-kappa B oligonucleotide. Second, inhibition of NF-kappa B activation by PDTC and TPCK induced a marked decrease in IL-17-induced IL-6, IL-8, and MCP-1 mRNA expression. PDTC and TPCK are potent inhibitors of NF-kappa B activation (41, 46).

MAPK activation has been regarded as another important signaling event in response to proinflammatory stimuli. Three subgroups of the MAPK family have been identified, and all are phosphorylated on their tyrosine and threonine residues by upstream kinases, the MAPK kinases. The p44 and p42 ERK1/2 mediate responses mainly to mitogenic stimuli, whereas the c-Jun NH2-terminal kinases and p38 mediate responses to cellular stress (12, 21, 22). In this study, we showed that IL-17 can activate two groups of MAPKs in human SEMFs. The role of the MAPKs in IL-17-induced IL-6, IL-8, and MCP-1 secretion was also investigated by using specific inhibitors. Imidazole compound SB-203580 is a specific inhibitor of p38 MAPK (14). SB-203580 caused a significant decrease in the IL-17-induced IL-6, IL-8, and MCP-1 secretion, indicating that p38 activation was involved. This observation is compatible with the recent report by Craig et al. (13) indicating that the stimulation of p38 MAPK by the MAPK kinase MKK6 activates NF-kappa B DNA-binding activity and induces IL-6 secretion. In addition, we addressed the role of ERK1/2 in our system. PD-98059 is a specific inhibitor of MAPK/ERK kinase (MEK1) (3), the kinase directly upstream to ERK1/2, and U-0126 is a specific inhibitor of MEK1 and MEK2 (18). U-0126 blocked the phosphorylation of ERK1/2 more potently than PD-98059. PD-98059 and U-0126 caused a significant inhibition of the IL-17-induced IL-6, IL-8, and MCP-1 secretion. Thus we concluded that ERK1/2 MAPKs also participate in the IL-6, IL-8, and MCP-1 secretion induced by IL-17 in human SEMFs.

Molecular mechanisms involved in the strong induction of IL-6 secretion by the combination of IL-17 + TNF-alpha remains to be clarified. One possible approach may be to evaluate the changes in the NF-kappa B binding activity. However, IL-17 exerted modest effects on both IL-1beta - and TNF-alpha -induced NF-kappa B DNA-binding activity, suggesting that transcriptional mechanisms did not play a role. We next evaluated the changes in mRNA stabilities. As shown in Fig. 9, TNF-alpha -induced IL-6 mRNA decreased rapidly, whereas TNF-alpha -induced IL-8 mRNA was stable. The addition of IL-17 markedly prolonged the half-life of TNF-alpha -induced IL-6 mRNA, indicating that the strong induction of IL-6 mRNA by IL-17 + TNF-alpha was mainly mediated by the enhancement of the stability of the IL-6 gene. As reported (27, 31, 35) in other genes, the activation of p38 MAPK was involved in the induction of IL-6 gene stabilization by IL-17 + TNF-alpha , because SB-203580 completely attenuated these responses. Because the effects of PD-98059 on IL-6 gene stability were negligible, ERK1/2 MAPKs did not play a role in the induction of IL-6 gene stabilization by IL-17 + TNF-alpha . It has been reported that MKK-6- or MKK-3-induced-p38 activation phosphorylates the kinase MAPK-activated protein kinase 2 (MAPKAPK2) (31). The mRNA stabilization by p38 activation is considered to be mediated by MAPKAPK2, although the relevant substrates of MAPKAPK2 have not fully been identified (31). The precise mechanisms and molecules participating in IL-17 + TNF-alpha -induced IL-6 gene stabilization should be determined in the future.

In conclusion, this study demonstrated for the first time that IL-17 induces IL-6, IL-8, and MCP-1 secretion in human colonic SEMFs. Although the importance of proinflammatory cytokines in the pathogenesis of IBD is becoming increasingly apparent, the precise mechanisms responsible for the cellular responses have not been fully identified. It is likely that many inflammatory genes are induced in SEMFs in the colonic mucosa. Further investigations using SEMFs will clarify the regulatory mechanisms involved in the pathogenesis of IBD.


    ACKNOWLEDGEMENTS

This study was supported, in part, by Grants-in-Aid 12470121 and 13470119 for Scientific Research (B) from the Ministry of Education, Culture, Sports, Science and Technology of Japan.


    FOOTNOTES

Address for reprint requests and other correspondence: A. Andoh, Dept. of Internal Medicine, Shiga University of Medical Science, Seta-Tsukinowa, Otsu 520-2192, Japan (E-mail: andoh{at}belle.shiga-med.ac.jp).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published February 6, 2002;10.1152/ajpgi.00494.2001

Received 19 November 2001; accepted in final form 24 January 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Albanesi, C, Cavani A, and Girolomoni G. IL-17 is produced by nickel-specific T lymphocytes and regulates ICAM-1 expression and chemokine production in human keratinocytes: synergistic or antagonist effects with IFN-gamma and TNF-alpha . J Immunol 162: 494-502, 1999[Abstract/Free Full Text].

2.   Albanesi, C, Scarponi C, Cavani A, Federici M, Nasorri F, and Girolomoni G. Interleukin-17 is produced by both Th1 and Th2 lymphocytes, and modulates interferon-gamma - and interleukin-4-induced activation of human keratinocytes. J Invest Dermatol 115: 81-87, 2000[Web of Science][Medline].

3.   Alessi, DR, Cuenda A, Cohen P, Dudley DT, and Saltiel AR. PD 098059 is a specific inhibitor of the activation of mitogen-activated protein kinase kinase in vitro and in vivo. J Biol Chem 270: 27489-27494, 1995[Abstract/Free Full Text].

4.   Andoh, A, Takaya H, Saotome T, Shimada M, Hata K, Araki Y, Nakamura F, Shintani Y, Fujiyama Y, and Bamba T. Cytokine regulation of chemokine (IL-8, MCP-1, and RANTES) gene expression in human pancreatic periacinar myofibroblasts. Gastroenterology 119: 211-219, 2000[Web of Science][Medline].

5.   Atreya, R, Mudter J, Finotto S, Mullberg J, Jostock T, Wirtz S, Schutz M, Bartsch B, Holtmann M, Becker C, Strand D, Czaja J, Schlaak JF, Lehr HA, Autschbach F, Schurmann G, Nishimoto N, Yoshizaki K, Ito H, Kishimoto T, Galle PR, Rose-John S, and Neurath MF. Blockade of interleukin-6 trans signaling suppress T-cell resistance against apoptosis in chronic intestinal inflammation: evidence in Crohn's disease and experimental colitis in vivo. Nat Med 6: 583-588, 2000[Web of Science][Medline].

6.   Awane, M, Andres PG, Li DJ, and Reinecker HC. NF-kappa B-inducing kinase is a common mediator of IL-17-, TNF-alpha -, and IL-1beta -induced chemokine promoter activation in intestinal epithelial cells. J Immunol 162: 5337-5344, 1999[Abstract/Free Full Text].

7.   Baggiolimi, M, Dewald B, and Moser B. Interleukin-8 and related chemotactic cytokines---CXC and CC chemokines. Adv Immunol 55: 97-179, 1994[Web of Science][Medline].

8.   Boirivant, M, Marini M, DiFelice G, Pronio AM, Montesani C, Tersigni R, and Strober W. Lamina propria T cells in Crohn's disease and other gastrointestinal inflammation show defective CD2 pathway-induced apoptosis. Gastroenterology 116: 557-565, 1999[Web of Science][Medline].

9.   Cai, XY, Gommol J-CP, Justice L, Narula SK, and Fine JS. Regulation of granulocyte colony-stimulating factor gene expression by interleukin-17. Immunol Lett 62: 51-58, 1998[Web of Science][Medline].

10.   Chabaud, M, Fossiez F, Taupin JL, and Miossec P. Enhancing effects of IL-17 on IL-1-induced IL-6 and leukemia inhibitory factor production by rheumatoid arthritis synoviocytes and its regulation by Th2 cytokines. J Immunol 161: 409-414, 1998[Abstract/Free Full Text].

11.   Chomczynski, P, and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987[Web of Science][Medline].

12.   Cobb, MH, and Goldsmith EJ. How MAP kinases are regulated. J Biol Chem 270: 14843-14846, 1995[Free Full Text].

13.   Craig, R, Larkin A, Mingo AM, Thuerauf DJ, Andrews C, McDonough PM, and Glembotski CC. p38 MAPK and NF-kappa B collaborate to induce interleukin-6 gene expression and release. Evidence for a cytoprotective autocrine signaling pathway in a cardiac myocyte model system. J Biol Chem 275: 23814-23824, 2000[Abstract/Free Full Text].

14.   Cuenda, A, Rouse J, Doza YN, Meier R, Cohen P, Gallagher TF, Young PR, and Lee JC. SB-203580 is a specific inhibitor of a MAP kinase homologue which is stimulated by cellular stresses and interleukin-1. FEBS Lett 364: 229-233, 1995[Web of Science][Medline].

15.   Desreumaux, P. Specific targeting of IL-6 signaling pathway: a new way to treat IBD? Gut 47: 465-466, 2000[Free Full Text].

16.   Dignam, JD, Lebovitz RM, and Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11: 1475-1489, 1983[Abstract/Free Full Text].

17.   Dohi, T, Fujihashi K, Kiyono H, Elson CO, and McGhee JR. Mice deficient in Th1- and Th2-type cytokines develop distinct forms of hapten-induced colitis. Gastroenterology 119: 724-733, 2000[Web of Science][Medline].

18.   Favata, MF, Horiuchi KY, Manos EJ, Daulerio AJ, Stradley DA, Feeser WS, Van Dyk DE, Pitts WJ, Earl RA, Hobbs F, Copeland RA, Magolda RL, Scherle PA, and Trzaskos JM. Identification of a novel inhibitor of mitogen-activated protein kinase kinase. J Biol Chem 273: 18623-18632, 1998[Abstract/Free Full Text].

19.   Fossiez, F, Banchereau J, Murry R, van Kooten C, Garrone P, and Lebecque S. Interleukin-17. Intern Rev Immunol 16: 541-551, 1998[Medline].

20.   Fossiez, F, Djossou O, Chomarat P, Flores RL, Ait YS, Maat C, Pin JJ, Garrone P, Garcia E, Saeland S, Blanchard D, Gaillard C, Das Mahapatra B, Rouvier E, Golstein P, Banchereau J, and Lebecque S. T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J Exp Med 183: 2593-2603, 1996[Abstract/Free Full Text].

21.   Freshney, NW, Rawlinson L, Guesdon F, Jones E, Cowley S, Hsuan J, and Saklatvala J. Interleukin-1 activates a novel protein kinase cascade that results in the phosphorylation of Hsp27. Cell 78: 1039-1049, 1994[Web of Science][Medline].

22.   Han, J, Lee JD, Bibbs L, and Ulevitch RJ. A MAP kinase targeted by endotoxin and hyperosmolarity in mammalian cells. Science 265: 808-811, 1994[Abstract/Free Full Text].

23.   Jobson, TM, Billington CK, and Hall IP. Regulation of proliferation of human colonic subepithelial myofibroblasts by mediators important in intestinal inflammation. J Clin Invest 101: 2650-2657, 1998[Web of Science][Medline].

24.   Jovanovic, DV, Di Battista JA, Martel PJ, Jolicoeur FC, He Y, Zhang M, Mineau F, and Pelletier JP. IL-17 stimulates the production and expression of proinflammatory cytokines, IL-1beta and TNF-alpha by human macrophages. J Immunol 60: 3513-3521, 1998.

25.   Kam, LY, and Targan SR. Cytokine-based therapies in inflammatory bowel disease. Curr Opin Gastroenterol 15: 302-307, 1999[Medline].

26.   Kennedy, J, Rossi DL, Zurawski SM, Vega F, Kastelein RA, Wagner JL, Hannum CH, and Zlotnik A. Mouse IL-17: a cytokine preferentially expressed by alpha beta TCR+ CD4-CD8- T cells. J Interferon Cytokine Res 16: 611-617, 1996[Web of Science][Medline].

27.   Lasa, M, Mahtani KR, Finch A, Brewer G, Saklatvala J, and Clark AR. Regulation of cyclooxygenase 2 mRNA stability by the mitogen-activated protein kinase p38 signaling cascade. Mol Cell Biol 20: 4265-4274, 2000[Abstract/Free Full Text].

28.   Lenardo, MJ, and Baltimore D. NF-kappa B: a pleiotropic mediator of inducible and tissue-specific gene control. Cell 58: 227-229, 1989[Web of Science][Medline].

29.   Libermann, TA, and Baltimore D. Activation of interleukin-6 gene expression through the NF-kappa B transcription factor. Mol Cell Biol 10: 2327-2334, 1990[Abstract/Free Full Text].

30.   Mahida, YR, Beltinger J, Marh S, Goke M, Gray T, Podolsky DK, and Hawkey CJ. Adult human colonic subepithelial myofibroblasts express extracellular matrix proteins and cyclooxygenase-1 and -2. Am J Physiol Gastrointest Liver Physiol 273: G1341-G1348, 1997[Abstract/Free Full Text].

31.   Mahtani, KR, Brook M, Dean JLE, Sully G, Saklatvala J, and Clark AR. Mitogen-activated protein kinase p38 controls the expression and posttranslational modification of tristetraprolin, a regulator of tumor necrosis factor alpha mRNA stability. Mol Cell Biol 21: 6461-6469, 2001[Abstract/Free Full Text].

32.   May, LT, Helfgott DC, and Sehgal PB. Anti-beta -interferon antibodies inhibit the increased expression of HLA-B7 mRNA in tumor necrosis factor-treated human fibroblasts: structural studies of the beta 2 interferon involved. Proc Natl Acad Sci USA 83: 8957-8961, 1986[Abstract/Free Full Text].

33.   McKaig, BC, Makh SS, Hawkey CJ, Podolsky DK, and Mahida YR. Normal human colonic subepithelial myofibroblasts enhance epithelial migration (restitution) via TGF-beta 3. Am J Physiol Gastrointest Liver Physiol 276: G1087-G1093, 1999[Abstract/Free Full Text].

34.   Miller, MD, and Krangel MS. Biology and biochemistry of the chemokines: a family of chemotactic and inflammatory cytokines. Crit Rev Immunol 12: 17-46, 1992[Web of Science][Medline].

35.   Montero, L, and Nagamine Y. Regulation by p38 mitogen-activated protein kinase of adenylate- and uridylate-rich element-mediated urokinase-type plasminogen activator (uPA) messenger RNA stability and uPA-dependent in vitro cell invasion. Cancer Res 59: 5286-5293, 1999[Abstract/Free Full Text].

36.   Papanicolaou, DA, Wilder RL, Manolagas SC, and Chrousos GP. The pathophysiologic roles of interleukin-6 in human disease. Ann Int Med 128: 127-137, 1998[Abstract/Free Full Text].

37.   Powell, DW, Mifflin RC, Valentich JD, Crowe SE, Saada JI, and West AB. Myofibroblasts. I. Paracrine cells important in health and disease. Am J Physiol Cell Physiol 277: C1-C9, 1999[Abstract/Free Full Text].

38.   Powell, DW, Mifflin RC, Valentich JD, Crowe SE, Saada JI, and West AB Myofibroblasts. II. Intestinal subepithelial myofibroblasts. Am J Physiol Cell Physiol 277: C183-C201, 1999[Abstract/Free Full Text].

39.   Richards, CD. Interleukin-6. In: Cyokines, edited by Mire-Sluis A, and Thorpe R.. San Diego: Academic, 1998, p. 87-100.

40.   Riddle, RH. Pathology of idiopathic inflammatory bowel disease. In: Inflammatory Bowel Disease (4th ed.), edited by Kirsner JB, and Shorter RG.. Baltimore, MD: Williams & Wilkins, 1995, p. 517-552.

41.   Rovin, BH, Dickerson JA, Tan LC, and Hebert CA. Activation of nuclear factor-kappa B correlates with MCP-1 expression by human mesangial cells. Kidney Int 48: 1263-1271, 1995[Web of Science][Medline].

42.   Sanger, F, Nicklen S, and Coulson AR. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463-5467, 1977[Abstract/Free Full Text].

43.   Sappino, AP, Schurch W, and Gabbiani G. Differentiation repertoire of fibroblastic cells: expression of cytoskeletal proteins as marker of phenotypic modulations. Lab Invest 63: 144-161, 1990[Web of Science][Medline].

44.   Saubermann, LJ, Probert CSJ, Christ AD, Chott A, Turner JR, Stevens AC, Balk SP, and Blumberg RS. Evidence of T cell receptor beta -chain patterns in inflammatory and noninflammatory bowel disease states. Am J Physiol Gastrointest Liver Physiol 276: G613-G621, 1999[Abstract/Free Full Text].

45.   Schreck, R, Meier B, Manne DN, Droge W, and Baeuerle PA. Dithiocarbamate as potent inhibitors of nuclear factor kappa B activation in intact cells. J Exp Med 175: 1181-1194, 1992[Abstract/Free Full Text].

46.   Shin, HC, Benbernou N, Esnault S, and Guenounou M. Expression of IL-17 in human memory CD45RO+ T lymphocytes and its regulation by protein kinase A pathway. Cytokine 11: 257-266, 1999[Web of Science][Medline].

47.   Stenson, WF. Inflammatory bowel disease. In: Textbook of Gastroenterology (2nd ed.), edited by Yamada T, Alpers DH, Owyang C, Powel D, and Silverstein F.. Philadelphia, PA: Lippincott, 1995, p. 1748-1806.

48.   Tanabe, O, Akira S, Kamiya T, Wong GG, Hirano T, and Kishimoto T. Genomic structure of the murine IL-6 gene. High degree conservation of potential regulatory sequences between mouse and human. J Immunol 141: 3875-3881, 1988[Abstract].

49.   Valentich, JD, and Powell DW. Intestinal subepithelial myofibroblasts and mucosal immunophysiology. Curr Opin Gastroenterol 10: 645-651, 1994.

50.   Yao, Z, Fanslow WC, Seldin MF, Rousseau AM, Painter SL, Comeau MR, Cohen JI, and Spriggs MK. Herpesvirus saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor. Immunity 3: 811-821, 1995[Web of Science][Medline].

51.   Yao, Z, Painter SL, Fanslow WC, Ulrich D, Macduff M, Spriggs MK, and Armitage RJ. Human IL-17: a novel cytokine derived from T cells. J Immunol 155: 5483-5486, 1995[Abstract].

52.   Yao, Z, Spriggs MK, Derry JM, Strockbine L, Park LS, Van den Bos T, Zappone JD, Painter SL, and Armitage RJ. Molecular characterization of the human interleukin (IL)-17 receptor. Cytokine 9: 794-800, 1997[Web of Science][Medline].


Am J Physiol Gastrointest Liver Physiol 282(6):G1035-G1044
0193-1857/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
J. Immunol.Home page
K. E. Sivick, M. A. Schaller, S. N. Smith, and H. L. T. Mobley
The Innate Immune Response to Uropathogenic Escherichia coli Involves IL-17A in a Murine Model of Urinary Tract Infection
J. Immunol., February 15, 2010; 184(4): 2065 - 2075.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
A. J. Schetter, G. H. Nguyen, E. D. Bowman, E. A. Mathe, S. T. Yuen, J. E. Hawkes, C. M. Croce, S. Y. Leung, and C. C. Harris
Association of Inflammation-Related and microRNA Gene Expression with Cancer-Specific Mortality of Colon Adenocarcinoma
Clin. Cancer Res., September 15, 2009; 15(18): 5878 - 5887.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Nishida, A. Andoh, O. Inatomi, and Y. Fujiyama
Interleukin-32 Expression in the Pancreas
J. Biol. Chem., June 26, 2009; 284(26): 17868 - 17876.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
S. Samuel, R. Walsh, J. Webb, A. Robins, C. Potten, and Y. R. Mahida
Characterization of putative stem cells in isolated human colonic crypt epithelial cells and their interactions with myofibroblasts
Am J Physiol Cell Physiol, February 1, 2009; 296(2): C296 - C305.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. Nishida, A. Andoh, M. Shioya, S. Kim-Mitsuyama, A. Takayanagi, and Y. Fujiyama
Phosphatidylinositol 3-kinase/Akt signaling mediates interleukin-32{alpha} induction in human pancreatic periacinar myofibroblasts
Am J Physiol Gastrointest Liver Physiol, March 1, 2008; 294(3): G831 - G838.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
W. Ning, A. M. K. Choi, and C. Li
Carbon monoxide inhibits IL-17-induced IL-6 production through the MAPK pathway in human pulmonary epithelial cells
Am J Physiol Lung Cell Mol Physiol, August 1, 2005; 289(2): L268 - L273.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. van den Berg, M. Kuiper, M. Snoek, W. Timens, D. S. Postma, H. M. Jansen, and R. Lutter
Interleukin-17 Induces Hyperresponsive Interleukin-8 and Interleukin-6 Production to Tumor Necrosis Factor-{alpha} in Structural Lung Cells
Am. J. Respir. Cell Mol. Biol., July 1, 2005; 33(1): 97 - 104.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. Bamba, A. Andoh, H. Yasui, J. Makino, S. Kim, and Y. Fujiyama
Regulation of IL-11 expression in intestinal myofibroblasts: role of c-Jun AP-1- and MAPK-dependent pathways
Am J Physiol Gastrointest Liver Physiol, August 8, 2003; 285(3): G529 - G538.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. Venkatraman, B. S. Ramakrishna, R. V. Shaji, N. S. N. Kumar, A. Pulimood, and S. Patra
Amelioration of dextran sulfate colitis by butyrate: role of heat shock protein 70 and NF-{kappa}B
Am J Physiol Gastrointest Liver Physiol, June 9, 2003; 285(1): G177 - G184.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Andoh, S. Fujino, S. Bamba, Y. Araki, T. Okuno, T. Bamba, and Y. Fujiyama
IL-17 Selectively Down-Regulates TNF-{alpha}-Induced RANTES Gene Expression in Human Colonic Subepithelial Myofibroblasts
J. Immunol., August 15, 2002; 169(4): 1683 - 1687.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/6/G1035    most recent
00494.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (58)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hata, K.
Right arrow Articles by Bamba, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hata, K.
Right arrow Articles by Bamba, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online