AJP - GI Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 282: G981-G990, 2002. First published January 9, 2002; doi:10.1152/ajpgi.00293.2001
0193-1857/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/6/G981    most recent
00293.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (16)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mathurin, P.
Right arrow Articles by Tsukamoto, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mathurin, P.
Right arrow Articles by Tsukamoto, H.
Vol. 282, Issue 6, G981-G990, June 2002

IL-10 receptor and coreceptor expression in quiescent and activated hepatic stellate cells

Philippe Mathurin1, Shigang Xiong1, Kusum K. Kharbanda4, Nary Veal1, Takeo Miyahara1, Kenta Motomura1, Richard A. Rippe5, Max G. Bachem6, and Hidekazu Tsukamoto1,2,3

Departments of 1 Pathology and 2 Medicine, Keck School of Medicine of the University of Southern California, Los Angeles 90089; 3 Veterans Affairs Greater Los Angeles Healthcare System, Sepulveda, California 91343; 4 Department of Veterans Affairs Medical Center, Omaha, Nebraska 68198; 5 Department of Medicine, University of North Carolina at Chapel Hill, North Carolina 27599-7038; and 6 Institute for Clinical Chemistry, University of Ulm, Ulm, Germany 89070


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Interleukin (IL)-10 expression is induced in activated hepatic stellate cells (HSC) in vitro and in vivo. We analyzed expression of IL-10 receptor (IL-10R) and coreceptor cytokine receptor family (CRF2-4) in HSC. We aimed to clone and sequence partial cDNA for rat IL-10R and CRF2-4, determine their expression in activated rat HSC in vivo and in vitro, and examine the biological responsiveness of HSC to exogenous IL-10. PCR cloning and sequencing of partial rat IL-10R and CRF2-4 cDNAs revealed 86% homology with corresponding mouse sequences. In hepatic macrophages, Northern blot with cloned IL-10R cDNA detected an expected 3.5-kb transcript, and IL-10R and CRF2-4 mRNAs showed steady constitutive expression after in vitro lipopolysaccharide treatment or cholestatic liver injury. IL-10R mRNA expression, as confirmed by immunohistochemistry, was induced 20.1- and 8.6-fold in HSC from cholestatic livers and 7-day culture-activated HSC, respectively but CRF2-4 mRNA levels were unchanged. Under serum-free conditions, IL-10 had minimal effects on collagen production but reduced DNA synthesis, matrix metalloprotease-2 mRNA levels, and activity in HSC. With serum, IL-10 inhibited both collagen production and DNA synthesis but had no effect on procollagen-alpha 1(I) mRNA levels. This shows concomitant induction of IL-10R but not CRF2-4 to that of IL-10 by activated HSC in vitro and in vivo and associated acquisition of the responsiveness to IL-10, entailing complex effects on HSC.

interleukin-10; cytokine receptor family 2-4; procollagen-alpha 1(I) ; matrix metalloprotease-2; matrix metalloprotease-13; monocyte-chemoattracting protein-1; liver fibrosis


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

INTERLEUKIN (IL)-10 was originally identified as a molecule from Th2 cells that downregulates Th1 cell functions. IL-10 is mainly produced by Th2 CD4+ cells, CD5+ B cells, and macrophages and inhibits inflammatory and cell-mediated immune responses while enhancing humoral immunity (26).

Protective effects of IL-10 on the liver have previously been demonstrated in different animal models (20-22, 33) in which IL-10 inhibited the release of tumor necrosis factor (TNF)-alpha , a critical factor implicated in a direct cytotoxic or indirect neutrophil-dependent mechanism of liver injury (10, 25, 27). In galactosamine/lipopolysaccharide (LPS) liver injury, administration of recombinant IL-10 decreased the serum levels of TNF-alpha and alanine aminotransferase, hepatocyte necrosis, expression of adhesion molecules, neutrophil infiltration, and lethality (20, 33). Conversely, antibodies against IL-10 accentuated the increases in serum TNF-alpha and alanine aminotransferase and the severity of hepatic necrosis in this model (20). IL-10 was also shown to protect mice from immune-mediated hepatitis induced by administration of concanavalin A (21).

In addition to anti-inflammatory effects, IL-10 may possess regulatory activities toward matrix homeostasis. In vitro, it downregulates type I collagen expression and increases expression of matrix metalloprotease-1 (MMP)-1 and -3 by cultured skin fibroblasts (31). In vivo, IL-10 knockout mice developed excessive skin scar formation after exposure to irritant oil (32). A recent pilot trial demonstrated reduction of fibrosis in patients with chronic hepatitis C infection who received IL-10 (28), but it still remains to be determined whether this response is due to a direct antifibrotic effect or is secondary to IL-10's anti-inflammatory effect.

Hepatic stellate cells (HSC), the vitamin A-storing perisinusoidal cells, participate in matrix remodeling and wound healing via their myofibroblastic activation (4). HSC also express IL-10 on activation (43). In vitro, addition of anti-IL-10 antibodies to culture-activated HSC was shown to increase collagen production via induction of procollagen-alpha 1(I) and inhibition of MMP-13 expression (43). Moreover, IL-10 knockout mice developed more severe carbon tetrachloride-induced fibrosis than wild-type animals (22, 38). Together, these results supported the hypothesis that IL-10 may act as a regulator of liver fibrogenesis (40, 41).

Like other cytokines, IL-10 exerts its effects through cell surface receptors. Human and mouse IL-10 receptors (IL-10R) have been cloned, and their functional domains have been analyzed (11, 13, 35-37). Interestingly, the lower sensitivity to human IL-10 of mouse Ba/F3 cells expressing the recombinant human IL-10R compared with those expressing the recombinant mouse IL-10R led to the identification of another IL-10R subunit required for IL-10 signaling (12, 19). This coreceptor, named cytokine receptor family (CRF2-4), was shown to be an accessory chain essential for the ligand-activated IL-10R to initiate its signal transduction (17). Indeed, CRF2-4-deficient mice show the phenotype of IL-10-deficient mice and the lack of responsiveness to IL-10 (34).

Even though an accumulating body of evidence exists in support of the regulatory role of IL-10 in liver fibrogenesis, the mechanisms underlying this regulation are still elusive. To our knowledge, virtually nothing is known about the expression of IL-10R and coreceptor in HSC. In the present study, we pursued the following specific aims: 1) to partially clone and sequence rat IL-10R and rat CRF2-4; 2) to examine regulation of these genes in activated HSC in vivo and in vitro; and 3) to determine the biological responsiveness of cultured HSC to IL-10 in relation to changes in their IL-10R expression.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

RNA extraction and RT-PCR. Total RNA from freshly isolated and cultured cells was extracted by the guanidium-phenol-chloroform method of Chomczynski and Sacchi (1). The quantity and quality of RNA samples were determined by measuring the absorbance at 260 nm and verifying the 18S/28S ribosomal RNA integrity with ethidium bromide staining of agarose gels, respectively. Three micrograms of total RNA was reverse transcribed by adding 30 µl of a master mix of RT buffer (Perkin-Elmer, Norwalk, CT), 0.5 mmol/l dNTP mixture, 1 U/µl RNase inhibitor, 600 units of Moloney murine leukemia virus RT, and 2 µl oligo(dT) at 37°C for 60 min. The RT was heat inactivated at 99°C for 5 min and cooled at 5°C for 5 min. The synthesized cDNA were amplified using a specific set of primers designed from published sequences (6, 8, 29, 43) as follows: IL-10, CTGGCTCAGCACTGCTAT and ATTCATGGCCTTGTAGACAC; procollagen-alpha 1(I), ACAGCACGCTTGTGGAT and GTCTTCAAGCAAGAGGACCA; MMP-13, CGAACACTCAAATGGTCCCA and TCCACATGGTTGGGAAGTTC; MMP-2, GGATCATTGGTTACACACCTGACC and TGTATTCCCGACCGTTGAACAG; and beta -actin, GAGCTATGAGCTGCCTGACG and AGCACTTGCGGTCCACGATG. PCR was performed in a volume of 50 µl containing 2 µl of cDNA mixture, 2 mM MgCl2, 50 mM KCl, 10 mM Tris · HCl (pH 8.3), 200 µM of each dNTP, 1.25 units Taq polymerase, and 20 pM of each primer. PCR was carried out with an initial 5-min denaturation at 94°C, followed by 35 cycles of amplification (60 s at 94°C, 50 s at 60°C, 2 min at 72°C) and a final incubation of 10 min at 72°C. For beta -actin, PCR was performed for only 25 cycles.

Rat IL-10R and rat CRF2-4 cDNA sequencing. Partial cloning of the rat IL-10R and CRF2-4 was performed by PCR. Mouse IL-10R and CRF2-4 sequences were downloaded from the GenBank database using MacDNASIS software (Hitachi). We designed three independent sets of primers in different locations of the mouse IL-10R and CRF2-4 sequences using MacDNASIS. The primer sequences, the nucleotide position in mouse sequences, and the expected sizes of PCR products are given in Table 1. Each set of primers was used to perform PCR amplification on RNA extracted from culture-activated HSC according to the protocol described above. The size of each PCR product was tested on agarose gel with ethidium bromide staining. The fragments generated by PCR were isolated from agarose gel with an elution buffer and ligated into a TA cloning vector followed by cloning procedures according to the TA cloning kit (One-Step PCR cloning; Invitrogen, San Diego, CA). After a large-scale plasmid preparation, the sequence of each cDNA was determined by using the chain determination method (US Biochemical). A partial EcoRI fragment of the clone obtained with the second set of IL-10R primers was purified as above and used as a probe for Northern blot hybridization.

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Mouse primers for IL-10R and CRF2-4

Competitive RT-PCR. Competitive RT-PCR is one of the approaches to overcome the variability in quantification by PCR. In the present study, we performed the competitive PCR using an RNA competitive template containing the specific primer sites for rat IL-10R (primer sequences are given in RESULTS). This RNA competitor was generated by in vitro transcription using a competitive RNA transcription kit (Takara's; Panvera, Madison, WI). For competitive PCR, sample RNA was amplified in the presence of the increasing amount of the RNA competitor.

Northern blot analysis. For Northern blot analysis for IL-10R and procollagen-alpha 1(I), ~5-20 µg of total RNA was electrophoresed in 1% agarose gel containing formaldehyde and transferred to a nylon filter (Micron Separations, Wesboro, MA) as described (43). PCR-cloned rat IL-10R cDNA obtained with the second set of primers and rat procollagen-alpha 1(I) cDNA were labeled with [alpha -32P]dCTP using a random primer labeling kit (Life Technologies). The filter was prehybridized and hybridized with the 32P-labeled cDNAs at 50°C and then washed at a high stringency at 50°C as described previously (42).

Bile duct ligation. Bile duct ligation was performed on male Wistar rats weighing 550-650 g by aseptic ligation and scission of the common bile duct (BDL) as previously described (29). Another group of rats was sham-operated by exposing the bile duct without ligation or scission as a control (Sham). HSC were isolated 1 wk after the surgery. The animal protocol in this study was approved by the Institutional Care and Use Committee of the University of Southern California.

HSC isolation and biochemical assays. HSC were isolated from normal, BDL, and Sham Wistar rats by in situ digestion of the liver and arabinogalactan gradient ultracentrifugation as reported previously (29, 42). The purity of the cells was examined by phase-contrast microscopy, and the viability was examined by Trypan blue exclusion. The purity and the viability of the cells from the animals exceeded 96 and 94%, respectively. HSC isolated from the BDL model have previously been characterized to be activated and to have increased expression of procollagen-alpha 1(I), transforming growth factor-beta 1, and alpha -smooth muscle actin (24, 26). In vitro activation of HSC was achieved by culturing the HSC on plastic using 6- or 24-well plates. The cells were cultured in RPMI or DMEM with 10% fetal calf serum for 3 or 7 days according to the design of the experiment. For measurement of collagen production by 3- or 7-day cultured HSC, the cells were incubated for 18 h in serum-free or supplemented (10% vol/vol) DMEM with ascorbic acid (50 µg/ml), beta -aminopropionitrite fumarate (50 µg/ml), and [2,3,4,5-3H]proline (10 µCi/ml) in the presence or absence of rat recombinant IL-10 (R&D Systems, Minneapolis, MN) (43). The cell and media proteins were precipitated with 10% trichloroacetic acid, and collagen production was determined by a collagenase digestion method (43). HSC DNA synthesis was determined under both serum-free and supplemented conditions by incorporation of [3H]thymidine (10 µCi/ml) as previously described (43). Quantification of monocyte-chemoattracting protein (MCP)-1 secreted by cultured HSC was performed by sandwich ELISA using the commercially available kit according to the manufacturer's instructions (Biosource, Camarillo, CA). The 3 or 7 day cultured HSC were incubated in serum-free DMEM in the absence or presence of IL-10 with or without TNF-alpha for 18 h. The conditioned medium was collected and centrifuged at 12,000 rpm for 1 min. The supernatant was stored at -70°C until assay. MMP activity in HSC-conditioned medium was determined using zymographic analysis under denaturing but nonreducing conditions. In brief, each sample (10-20 µl) was applied onto a denaturing 8% SDS-PAGE gel (1 g/100 ml) containing 0.1% gelatin (Sigma, St. Louis, MO) for MMP-2 and -9 (23) or 0.1% collagen I (Sigma) for MMP-13 (7). Electrophoresis was performed at 25 mA constant current for 2 h at room temperature, followed by equilibration in distilled water containing 2.5% Triton X-100 for 1 h to remove SDS. The gel was then incubated in enzyme buffer containing 50 mM Tris · HCl (pH 8.0), 200 mM NaCl, 5 mM CaCl2, and 0.02% Brij 35 for 18 h at 37°C. Bands of enzymatic activity were visualized by negative staining with standard Coomassie brilliant blue dye solution (Bio-Rad, Hercules, CA). Molecular sizes of bands displaying enzymatic activity were identified by comparison with prestained standard proteins (Bio-Rad).

IL-10R immunofluorescence. The 3 and 7 day cultured HSC on chamber slides were fixed by ice-cold acetone for 10 min and air dried. The culture slides were first rehydrated with PBS. Nonspecific binding was blocked with a TNB buffer (50 mM Tris, 150 mM NaCl, 0.5% bovine serum albumin, and 0.5% sodium azide, pH 7.7). Goat anti-murine IL-10R antibodies (R&D Systems) were diluted 1:1,000 in TBS (50 mM Tris and 150 mM NaCl, pH 7.4) and applied onto the slides overnight. After three washes with a TNT buffer (50 mM Tris, 150 mM NaCl, and 0.05% Tween-40, pH 7.4), biotinylated rabbit anti-goat IgG (DAKO, Glostrup, Denmark), diluted 1:500 in TNB, was applied and incubated for 1 h. After three washes with TNT buffer, horseradish peroxidase-conjugated streptavidin (DAKO), diluted 1:100 in TNB, was added and incubated for another hour. Thereafter, the slides were washed again three times using TNT buffer, and tyramid signal amplification (TSA) reagent (NEN-Life Science Products, Boston, MA), diluted 1:50, was applied for 20 min. After three washes, Streptavidine-Red613 (GIBCO-BRL Life Technologies, Eggernstein, Germany), diluted 1:100 in TBS, was applied for 20 min. After the final washes, nuclei were stained by bisbenzimide (Hoeschst-33258; Sigma, Munich, Germany). Fluorescence was observed and photographed with a fluorescence microscope (C. Zeiss, Oberkochen, Germany) equipped with epilumination at the magnification of ×200 or ×400.

Hepatic macrophage isolation and culture. Hepatic macrophages were isolated from normal, BDL, and Sham Wistar rats as described before (14). The purity and viability always exceeded 85% and 90%, respectively. Freshly isolated hepatic macrophages were immediately processed for RNA extraction. For the culture experiments, hepatic macrophages were seeded at 30 × 106 cells/100-mm dish and further purified by the adherence method as previously described (5, 14). After the adherence purification, the purity of hepatic macrophages exceeded 95% as assessed by latex bead (1 µm) phagocytosis. The cells were incubated with RPMI 5% fetal calf serum for 2 days following the adherence method for in vitro experiments. For stimulation with LPS, the cells were washed twice with PBS, incubated in serum-free RPMI, and exposed to LPS (500 ng/ml; Escherichia coli 026:B6, cell culture grade, prepared by TCA precipitation and gel filtration chromatography; Sigma) for 1, 2, 6, 8, 18, and 24 h.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Partial sequences of rat IL-10R and CRF2-4 genes. We first tested whether the primers designed from the mouse sequences led to PCR products with the expected sizes. Following ~30-35 cycles of PCR on RNA from culture-activated HSC, the use of three sets of primers (Table 1) yields products with sizes matching those predicted from the sequence (data not shown). RT-PCR for CRF2-4 was also performed using the three sets of primers, and it also produced three expected sizes of the product. RT-PCR of RNA from hepatic macrophages produced detectable products for both IL-10R and CRF2-4 but required only 20-25 cycles of amplification, suggesting higher expression of these genes in hepatic macrophages. The PCR fragments from HSC RNA were subsequently cloned and sequenced. Analysis of the rat sequence from each PCR product for IL-10R revealed 85% homology with the mouse sequence. A partial sequence of 1,215 nt for rat IL-10R was obtained after a combination of three independent sequencings. For CRF2-4, a partial rat sequence of 449 nt disclosed a similar pattern of homology (86%) to that of the mouse sequence. Using the obtained sequence of rat IL-10R, we designed a new specific set of primers to yield a 319-nt PCR product: 5'-CCAACTGGACCATCACTGAAACTC-3' and 5'-GCCTTGTTAATTCGGGATTCCAC-3'. Northern blot analysis was performed using a PCR-cloned IL-10R cDNA. This detected a 3.5-kb transcript in hepatic macrophage RNA, a size identical to the mouse IL-10R mRNA (Fig. 1). The levels of IL-10R mRNA in cultured HSC were too low to be detected by this method (Fig. 1).


View larger version (66K):
[in this window]
[in a new window]
 
Fig. 1.   Northern blot analysis was performed on hepatic macrophage (HM) and hepatic stellate cell (HSC) RNA using the fragment of the cloned rat interleukin (IL)-10 receptor (IL-10R) cDNA. The analysis detected a 3.5-kb transcript in RNA from freshly isolated normal rat HM, but no message was detected in RNA from HSC cultured on plastic for 3 or 7 days.

IL-10R and CRF2-4 expression by hepatic macrophages. Regulation of hepatic macrophage expression of IL-10R and its coreceptor CRF2-4 was examined next by RT-PCR. In vitro, the treatment of cultured hepatic macrophages with LPS resulted in expected, time-dependent induction of TNF-alpha and IL-10 (Fig. 2). IL-10R mRNA showed a tendency to be increased, but this change was not significant and reproducible (Fig. 2). This finding corroborates steady constitutive expression of IL-10R previously demonstrated in hepatic macrophages (16). CRF2-4 mRNA levels in hepatic macrophages were also unaffected by LPS challenge (data not shown). We also examined the expression of IL-10R in hepatic macrophages isolated from rats with cholestatic liver injury. Northern blot analysis of hepatic macrophage RNA from BDL rats showed similar levels of IL-10R mRNA to those from Sham animals (Fig. 3).


View larger version (50K):
[in this window]
[in a new window]
 
Fig. 2.   Endotoxin stimulation does not affect IL-10R mRNA in HM. Stimulation of cultured HM with lipopolysaccharide (LPS; 500 ng/ml) does not cause significant and consistent induction of IL-10R mRNA levels, whereas tumor necrosis factor (TNF)-alpha and IL-10 expression are upregulated as expected.



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 3.   No changes in IL-10R mRNA expression by HM in cholestatic liver injury. A: Northern blot analysis shows constitutive and steady expression of IL-10R mRNA in HM isolated from sham-operated (Sham HM) and bile duct-ligated animals (BDL HM). B: loading of 18S and 28S rRNA.

IL-10R and CRF2-4 expression by culture-activated HSC. We next examined regulation of IL-10R and CRF2-4 expression in activation of HSC in culture. Six independent experiments revealed a reproducible increase in IL-10R mRNA in 7-day culture-activated HSC compared with freshly isolated HSC (day 0) or 3-day cultures of quiescent HSC. A representative set of data is shown in Fig. 4. Culture activation of HSC on day 7 was clearly observed under phase contrast microscopy and was confirmed by conspicuous upregulation of the procollagen-alpha 1(I) gene (Fig. 4). On the other hand, the level of CRF2-4 mRNA was not changed in culture-activated HSC (Fig. 4). To quantitatively determine the induction of IL-10R mRNA in culture-activated HSC, a competitive RT-PCR was performed using a constructed RNA competitive template. As shown in Fig. 5, an increasing amount of the competitor resulted in a progressive reduction in the level of IL-10R product while reciprocally raising the level of the competitor product. However, the range of the competitor concentration required for this competition was much higher with the samples from 7-day HSC than those from 3-day HSC. In fact, the computation of our results revealed that the level of IL-10R mRNA was 20.1-fold higher in 7-day culture-activated HSC than in quiescent, 3-day HSC (1.438 × 106 ± 0.384 × 106 vs. 0.716 × 105 ± 0.205 × 105 copies/µl, P = 0.02).


View larger version (47K):
[in this window]
[in a new window]
 
Fig. 4.   Freshly isolated HSC (day 0) or quiescent HSC cultured on plastic for 3 days express very low levels of IL-10R mRNA, whereas HSCs culture-activated for 7 days show a significant increase in this message. The apparent induction of procollagen-alpha 1(I) mRNA expression confirms the culture-activated state of HSC on day 7. Conversely, CRF2-4 mRNA is constitutively expressed and not affected by culture activation.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 5.   Representative data for IL-10R competitive PCR for RNA extracted from 3- vs. 7-day cultured HSC. Addition of an increasing concentration of the IL-10R competitor RNA resulted in progressive reduction in the level of IL-10R product and increased the level of the competitor product. Note that the range of the competitor concentrations used for 7-day HSC is more than an order of magnitude higher than that used for 3-day HSC.

To verify the observed induction of IL-10R in culture-activated HSC at the protein level, immunostaining was performed on 3-day HSC (Fig. 6, A-C) and 7-day HSC (Fig. 6, D-F). Immunofluorescence staining for IL-10R is minimal in 3-day HSC (Fig. 6, B and C), but it is clearly intensified in 7-day HSC (Fig. 6, E and F). Note that a contaminating lymphocyte in the 3-day HSC culture is positively stained for IL-10R, (Fig. 6B), serving as an inadvertent positive control. Figure 6, A and D, are negative controls for staining without the primary antibodies.


View larger version (99K):
[in this window]
[in a new window]
 
Fig. 6.   Increased immunostaining for IL-10R in culture-activated HSC. Immunostaining was performed on 3- (A-C) and 7-day cultured HSC (D-F). Immunofluorescence staining is minimal in 3-day HSC (B and C), whereas it is clearly increased in 7-day HSC (E and F). The arrow in B indicates a contaminating lymphocyte that is intensely positive for IL-10R. A and D are negative controls for staining without the primary antibodies.

IL-10R and CRF2-4 expression by HSC from cholestatic liver injury. We next examined regulation of IL-10R and CRF2-4 expression in rat HSC on activation in vivo induced by cholestatic liver injury. As expected, HSC isolated from BDL rats had induced expression of activation marker genes such as procollagen-alpha 1(I) and IL-10 (Fig. 7) (43). In these cells, mRNA expression of IL-10R was induced, whereas that for CRF2-4 was unchanged (Fig. 7). These results were reproducible in HSC isolated from six pairs of BDL and Sham rats. Competitive RT-PCR for IL-10R was performed (Fig. 8) and demonstrated an 8.6-fold induction in BDL compared with Sham rats (5.876 × 105 ± 0.477 × 105 vs. 6.834 × 104 ± 0.989 × 104 copies/µl, P < 0.0001).


View larger version (87K):
[in this window]
[in a new window]
 
Fig. 7.   Activated HSC in cholestatic liver injury express higher levels of IL-10R mRNA. Expression of IL-10R mRNA is induced in HSC isolated from cholestatic liver injury (BDL HSC) concomitant to induction of IL-10 and procollagen-alpha 1(I) compared with HSC from sham-operated rats (Sham HSC). CRF2-4 mRNA is constitutively expressed and shows no changes in BDL HSC.



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 8.   Representative data for IL-10R competitive PCR for RNA extracted from cholestatic liver injury (BDL HSC) vs. sham-operated animals (Sham HSC). Note that higher concentrations of the competitor were used for BDL HSC.

Biological responsiveness of culture-activated HSC to IL-10. To assess functional consequences of induced IL-10R expression in culture-activated HSC, 3- and 7-day HSC were treated with IL-10, and its effects on collagen production, DNA synthesis, MMP-13 and -2 expression, and MCP-1 production were assessed. IL-10 had minimal effects on the net collagen production by 3- or 7-day HSC under serum-free conditions (Fig. 9A). In contrast, IL-10 modestly but consistently decreased collagen production in 7-day HSC under serum-stimulated conditions (Fig. 9A). DNA synthesis was not affected by IL-10 in 3-day HSC but was decreased in 7-day HSC cultured in serum-free medium with 100 ng/ml of IL-10 (Fig. 9B). Under serum-supplemented conditions, this inhibition was more consistently observed even with lower concentrations of IL-10, suggesting that serum-stimulated HSC are more sensitive to inhibitory effects of IL-10 (Fig. 9B). Effects of IL-10 on procollagen-alpha 1(I) mRNA levels were next examined by Northern blot analysis. As shown in Fig. 9C, regardless of whether the media contained serum or not, IL-10 had no effects on procollagen-alpha 1(I) mRNA in either 3- or 7-day cultured HSC. Next, we examined the effects of IL-10 on MMP-13 and -2 expression. Again, no effects were observed in 3-day HSC (Fig. 10, A and B). The 7-day HSC showed higher basal expression of MMP-13 mRNA compared with 3-day HSC, and this was further increased by the treatment with IL-10 (Fig. 10A). However, we could not detect MMP-13 activity in the medium of 7-day HSC with or without IL-10 treatment by a zymography assay. MMP-2 mRNA level was increased in 7-day HSC compared with 3-day HSC and was reduced twofold by IL-10 in 7-day HSC (Fig. 10B). This inhibition was also confirmed at the activity level because the zymography analysis demonstrated a twofold reduction in MMP-2 activity (Fig. 10C). IL-10 failed to affect basal or TNF-alpha induced MCP-1 production by either 3- or 7-day HSC (Table 2).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 9.   Effects of IL-10 on HSC collagen production, DNA synthesis, and procollagen-alpha 1(I) mRNA expression. The 3- or 7-day cultured HSC were treated with IL-10 under serum-free (FCS-) or serum-supplemented (FCS+) conditions, and the effects on collagen production (A), DNA synthesis (B), and procollagen-alpha 1(I) mRNA levels (C) were analyzed. Note that only in 7-day HSC was a modest (+22%) but significant decrease in DNA synthesis by IL-10 (100 ng/ml) observed under serum-free conditions. In contrast, in serum-stimulated cells on day 7, IL-10 consistently inhibits collagen production and DNA synthesis but had no effects on procollagen-alpha 1(I) mRNA levels. *P < 0.05, **P < 0.01 vs. control (no IL-10).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 10.   Effects of IL-10 on HSC matrix metalloprotease (MMP)-2 and -13 expression. The 3- or 7-day cultured HSC were treated with IL-10 under serum-free conditions, and its effects on MMP-13 mRNA levels (A), MMP-2 mRNA levels (B), and MMP-2 activity (C) were assessed. Note that expression of MMP-13 and MMP-2 mRNA by 3-day HSC are not affected by IL-10. The 7-day HSC have higher levels of MMP-13 and MMP-2 mRNA, and MMP-13 expression is further increased with IL-10, whereas MMP-2 mRNA is reduced by the same treatment. Inhibition of MMP-2 expression is also confirmed at the activity level, as shown by reduced intensities of a zymographic band corresponding to a MMP-2 molecular weight (C).


                              
View this table:
[in this window]
[in a new window]
 
Table 2.   MCP-1 production by HSC

Thus these results demonstrate a correlation of induced IL-10R expression in 7-day HSC with their acquisition of the biological responsiveness to IL-10. They also show the complexity of IL-10-mediated effects on HSC functions, which are significantly influenced depending on whether HSC are tested under serum-free or supplemented conditions. Under serum-stimulated conditions, IL-10's inhibitory effects on DNA synthesis and collagen production become apparent in addition to its suppression of MMP-2 expression.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Enhanced autocrine expression of IL-10 by activated HSC was demonstrated by others and us (39, 43) and was suggested to regulate matrix expression. Because IL-10 induces its biological response in cells by interacting with its specific receptors expressed on the target cell surface, our primary objective was to evaluate regulation of the expression of IL-10R and coreceptor in activation of HSC in vitro and in vivo. To achieve this objective, we first cloned and sequenced rat IL-10R and CRF2-4 cDNAs. In support of the authenticity of the cDNAs, we generated the following results: 1) all of the PCR products matched the sizes expected from the known mouse sequences; 2) rat IL-10R and CRF2-4 clones revealed 86% homology with the corresponding mouse sequences; and 3) Northern blot analysis using a cloned IL-10R cDNA detected a transcript with a very similar if not identical size to the mouse IL-10R mRNA. Macrophages are one of the known target cell types for IL-10 that induces profound inhibition of expression of proinflammatory cytokines such as TNF-alpha , IL-1alpha , IL-1beta , IL-6, and IL-8 (2, 9, 15). IL-10 also reduces monocyte expression of major histocompatibility complex class II (3). To further test our sequence-specific primers and cDNAs, we first examined the expression of IL-10R and CRF2-4 in hepatic macrophages. Indeed, we demonstrated that the levels of IL-10R and CRF2-4 mRNA were substantially higher in hepatic macrophages than in HSC. We further showed that neither LPS stimulation in vitro nor activation in vivo by cholestatic liver injury resulted in alterations in the expression of IL-10R mRNA, corroborating the previous reports on LPS-stimulated hepatic macrophages (16) and RAW 264.7, a murine macrophage cell line (44). In addition, we also demonstrated that the expression of CRF2-4, the IL-10 coreceptor, was constitutive and unaffected by the activation state of hepatic macrophages.

In contrast to hepatic macrophages, IL-10R expression was conspicuously upregulated in culture or in in vivo activated HSC, and this was concomitant with induction of IL-10 (Fig. 7) (39, 43), supporting an induced autocrine loop involving this cytokine in activated HSC. With regard to CRF2-4, the IL-10 coreceptor, we did not observe any significant changes in its mRNA expression in HSC in response to activation either in vivo or in vitro. These results suggest that CRF2-4 and IL-10R do not share the same mechanisms of regulation in HSC. Since IL-10-induced signal transduction occurs only when both IL-10R and CRF2-4 are present (17), we can speculate that the weak expression of IL-10R in quiescent HSC is a major limiting factor for their lack of the responsiveness to IL-10 and that induction of IL-10R in activated HSC confers the responsiveness.

Indeed, our biological data support this notion. In 7-day culture-activated HSC with induced IL-10R expression only, the treatment with rat recombinant IL-10 caused inhibition of DNA synthesis, upregulation of MMP-13, and downregulation of MMP-2 expression. Our previous study (43) using antibodies against murine IL-10 showed that neutralization of IL-10 produced by culture-activated HSC stimulated collagen and inhibited MMP-13 expression, suggesting antifibrotic effects of HSC-derived IL-10. The present study demonstrated no effects on collagen production under serum-free conditions but showed inhibition of this parameter in serum-stimulated HSC. Even though a magnitude of inhibition is modest, these results highlight that the culture condition is a critical determinant for IL-10's effects. IL-10 also had an inhibitory effect on HSC DNA synthesis, the effect which was also accentuated in serum-stimulated HSC. MMP-13 mRNA expression was clearly induced by IL-10, and this effect corroborates our previous observation using the IL-10-neutralizing antibodies. However, the biological implication of this finding is not certain since we failed to detect MMP-13 activity in the culture media by a zymography assay. In contrast, MMP-2 expression was inhibited by IL-10 at both mRNA and activity levels. This effect may also be considered antifibrotic because MMP-2 is implicated in matrix remodeling and HSC migration through degradation of collagen IV, laminin, and proteoglycans in the initiation of liver fibrogenesis.

Even though IL-10 consistently inhibited collagen production by serum-stimulated HSC, IL-10 did not suppress the steady-state mRNA levels for procollagen-alpha 1(I). This is contrary to upregulated procollagen-alpha 1(I) mRNA expression by HSC treated with anti-IL-10 antibodies (43). Reasons for this discrepancy are not known presently but may include problematic nonspecific effects of the antibodies used in the previous study, differential responses to low endogenous concentrations of IL-10 and higher concentrations of exogenous IL-10 used in the present study, or different culture durations used in the two studies (~3-5 days vs. 7 days in the previous vs. present studies). Furthermore, the different activation state of cultured HSC may result in the differential sensitivity to IL-10's effects. As highlighted in the present study, serum stimulation alone can profoundly increase HSC's sensitivity to IL-10. Since we did not observe any effects on procollagen-alpha 1(I) mRNA, IL-10's inhibition of collagen production is likely mediated by translational or posttranslational effects.

Another important mediator expressed by activated HSC is MCP-1. In our study, IL-10 treatment did not affect either basal or TNF-alpha -induced MCP-1 production by cultured HSC. This is in contrast to inhibition of MCP-1 production by IL-10 in activated intestinal epithelial cells (18) and inhibition of the endotoxin-induced release of macrophage inflammatory protein-1 and MCP-1 by IL-10 in healthy subjects, which was shown to be independent from IL-10's inhibitory effect on TNF-alpha production (30).

Collectively, these results show rather complex and multiple effects of IL-10 on the fibrogenic potential of cultured HSC. In summary, the present study demonstrated coordinated induction of IL-10R and IL-10 in activated HSC in vitro and in vivo, suggesting that establishment of this autocrine loop may be of physiological relevance. The responsiveness to exogenous IL-10 was conferred by IL-10R induction in culture-activated HSC, but IL-10-mediated regulation of HSC biology was multifarious with induction of both MMP-13 mRNA and suppressed DNA synthesis and MMP-2 activity. Furthermore, under serum-stimulated conditions, IL-10's inhibitory effects on DNA synthesis and collagen production become apparent. Further investigation of IL-10's translational and posttranslational regulation of collagen expression and of the molecular mechanisms underlying IL-10's inhibitory effects on DNA synthesis and MMP-2 are required to fully understand the mechanisms and significance of induced IL-10 autocrine loop in HSC activation and liver fibrogenesis.


    ACKNOWLEDGEMENTS

This work was supported by National Institutes of Health Grants R37-AA-06603 (to H. Tsukamoto), R01-DR-34987 (to R. A. Rippe), R01-AA-10459 (to R. A. Rippe), P50-AA-11999 (to USC-UCLA Research Center for Alcoholic Liver and Pancreatic Diseases), R24-AA-12885 (Nonparenchymal Liver Cell Core), and P30-DK-48522 (USC Research Center for Liver Diseases) and by the Medical Research Service, Department of Veterans Affairs (to K. K. Kharbanda and H. Tsukamoto). Dr. Mathurin's research fellowship was supported by French grants (Bourse Tournut, Laboratoire Glaxo Wellcome, and Institut Lilly).


    FOOTNOTES

Current address for P. Mathurin: Service d'Hépatogastroentérologie du Professeur Paris, Hôpital Claude Hurriez 2ème étage Est, Avenue Michel Polonovski, CHRU Lille, 59037 Lille, France.

Address for reprint requests and other correspondence: H. Tsukamoto, Keck School of Medicine of the Univ. of Southern California, 1333 San Pablo St., MMR-412, Los Angeles, CA 90089 (E-mail: htsukamo{at}hsc.usc.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published January 9, 2002;10.1152/ajpgi.00293.2001

Received 10 July 2001; accepted in final form 23 December 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Chomczynski, P, and Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156-159, 1987[Web of Science][Medline].

2.   De Waal Malefyt, R, Abrams J, Bennett B, Figdor CG, and de Vries JE. Interleukin 10 (IL-10) inhibits cytokine synthesis by human monocytes: an autoregulatory role of IL-10 produced by monocytes. J Exp Med 174: 1209-1220, 1991[Abstract/Free Full Text].

3.   De Waal Malefyt, R, Haanen J, Spits H, Roncarolo MG, te Velde A, Figdor C, Johnson K, Kastelein R, Yssel H, and de Vries JE. Interleukin 10 (IL-10) and viral IL-10 strongly reduce antigen-specific human T cell proliferation by diminishing the antigen-presenting capacity of monocytes via downregulation of class II major histocompatibility complex expression. J Exp Med 174: 915-924, 1991[Abstract/Free Full Text].

4.   Friedman, SL. Hepatic stellate cells. Prog Liver Dis 14: 101-130, 1996[Medline].

5.   Friedman, SL, and Roll FJ. Isolation and culture of hepatic lipocytes, Kupffer cells, and sinusoidal endothelial cells by density gradient centrifugation with Stractan. Anal Biochem 161: 207-218, 1987[Web of Science][Medline].

6.   Genovese, C, Rowe D, and Kream B. Construction of DNA sequences complementary to rat alpha 1 and alpha 2 collagen mRNA and their use in studying the regulation of type I collagen synthesis by 1,25-dihydroxyvitamin D. Biochemistry 23: 6210-6216, 1984[Medline].

7.   Gogly, B, Groult N, Hornebeck W, Godeau G, and Pellat B. Collagen zymography as a sensitive and specific technique for the determination of subpicogram levels of interstitial collagenase. Anal Biochem 255: 211-216, 1998[Web of Science][Medline].

8.   Goodman, RE, Oblak J, and Bell RG. Synthesis and characterization of rat interleukin-10 (IL-10) cDNA clones from the RNA of cultured OX8- OX22- thoracic duct T cells. Biochem Biophys Res Commun 189: 1-7, 1992[Web of Science][Medline].

9.   Hart, PH, Jones CA, and Finlay-Jones JJ. Monocytes cultured in cytokine-defined environments differ from freshly isolated monocytes in their responses to IL-4 and IL-10. J Leukoc Biol 57: 909-918, 1995[Abstract].

10.   Hishinuma, I, Nagakawa J, Hirota K, Miyamoto K, Tsukidate K, Yamanaka T, Katayama K, and Yamatsu I. Involvement of tumor necrosis factor-alpha in development of hepatic injury in galactosamine-sensitized mice. Hepatology 12: 1187-1191, 1990[Web of Science][Medline].

11.   Ho, AS, Liu Y, Khan TA, Hsu DH, Bazan JF, and Moore KW. A receptor for interleukin 10 is related to interferon receptors. Proc Natl Acad Sci USA 90: 11267-11271, 1993[Abstract/Free Full Text].

12.   Ho, AS, and Moore KW. Interleukin-10 and its receptor. Ther Immunol 1: 173-185, 1994[Medline].

13.   Ho, AS, Wei SH, Mui AL, Miyajima A, and Moore KW. Functional regions of the mouse interleukin-10 receptor cytoplasmic domain. Mol Cell Biol 15: 5043-5053, 1995[Abstract].

14.   Kamimura, S, and Tsukamoto H. Cytokine gene expression by Kupffer cells in experimental alcoholic liver disease. Hepatology 22: 1304-1309, 1995[Web of Science][Medline].

15.   Knolle, PA, Loser E, Protzer U, Duchmann R, Schmitt E, zum Buschenfelde KH, Rose-John S, and Gerken G. Regulation of endotoxin-induced IL-6 production in liver sinusoidal endothelial cells and Kupffer cells by IL-10. Clin Exp Immunol 107: 555-561, 1997[Web of Science][Medline].

16.   Knolle, PA, Uhrig A, Protzer U, Trippler M, Duchmann R, Meyer zum Buschenfelde KH, and Gerken G. Interleukin-10 expression is autoregulated at the transcriptional level in human and murine Kupffer cells. Hepatology 27: 93-99, 1998[Web of Science][Medline].

17.   Kotenko, SV, Krause CD, Izotova LS, Pollack BP, Wu W, and Pestka S. Identification and functional characterization of a second chain of the interleukin-10 receptor complex. EMBO J 16: 5894-5903, 1997[Web of Science][Medline].

18.   Kucharzik, T, Lugering N, Pauels HG, Domschke W, and Stoll R. IL-4, IL-10 and IL-13 down-regulate monocyte-chemoattracting protein-1 (MCP-1) production in activated intestinal epithelial cells. Clin Exp Immunol 111: 152-157, 1998[Web of Science][Medline].

19.   Liu, Y, Wei SH, Ho AS, de Waal Malefyt R, and Moore KW. Expression cloning and characterization of a human IL-10 receptor. J Immunol 152: 1821-1829, 1994[Abstract].

20.   Louis, H, Le Moine O, Peny MO, Gulbis B, Nisol F, Goldman M, and Deviere J. Hepatoprotective role of interleukin 10 in galactosamine/lipopolysaccharide mouse liver injury. Gastroenterology 112: 935-942, 1997[Web of Science][Medline].

21.   Louis, H, Le Moine O, Peny MO, Quertinmont E, Fokan D, Goldman M, and Deviere J. Production and role of interleukin-10 in concanavalin A-induced hepatitis in mice. Hepatology 25: 1382-1389, 1997[Web of Science][Medline].

22.   Louis, H, Van Laethem JL, Wu W, Quertinmont E, Degraef C, Van den Berg K, Demols A, Goldman M, Le Moine O, Geerts A, and Deviere J. Interleukin-10 controls neutrophilic infiltration, hepatocyte proliferation, and liver fibrosis induced by carbon tetrachloride in mice. Hepatology 28: 1607-1615, 1998[Web of Science][Medline].

23.   Manicourt, DH, and Lefebvre V. An assay for matrix metalloproteinases and other proteases acting on proteoglycans, casein, or gelatin. Anal Biochem 215: 171-179, 1993[Web of Science][Medline].

24.   Miyahara, T, Schrum L, Rippe R, Xiong S, Yee HF, Jr, Motomura K, Anania FA, Willson TM, and Tsukamoto H. Peroxisome proliferator-activated receptors and hepatic stellate cell activation. J Biol Chem 275: 35715-35722, 2000[Abstract/Free Full Text].

25.   Mizuhara, H, O'Neill E, Seki N, Ogawa T, Kusunoki C, Otsuka K, Satoh S, Niwa M, Senoh H, and Fujiwara H. T cell activation-associated hepatic injury: mediation by tumor necrosis factors and protection by interleukin 6. J Exp Med 179: 1529-1537, 1994[Abstract/Free Full Text].

26.   Moore, KW, O'Garra A, de Waal Malefyt R, Vieira P, and Mosmann TR. Interleukin-10. Annu Rev Immunol 11: 165-190, 1993[Web of Science][Medline].

27.   Nagakawa, J, Hishinuma I, Hirota K, Miyamoto K, Yamanaka T, Tsukidate K, Katayama K, and Yamatsu I. Involvement of tumor necrosis factor-alpha in the pathogenesis of activated macrophage-mediated hepatitis in mice. Gastroenterology 99: 758-765, 1990[Web of Science][Medline].

28.   Nelson, DR, Lauwers GY, Lau JY, and Davis GL. Interleukin 10 treatment reduces fibrosis in patients with chronic hepatitis C: a pilot trial of interferon nonresponders. Gastroenterology 118: 655-660, 2000[Web of Science][Medline].

29.   Ohata, M, Lin M, Satre M, and Tsukamoto H. Diminished retinoic acid signaling in hepatic stellate cells in cholestatic liver fibrosis. Am J Physiol Gastrointest Liver Physiol 272: G589-G596, 1997[Abstract/Free Full Text].

30.   Olszyna, DP, Pajkrt D, Lauw FN, van Deventer SJ, and van Der PT. Interleukin 10 inhibits the release of CC chemokines during human endotoxemia. J Infect Dis 181: 613-620, 2000[Web of Science][Medline].

31.   Reitamo, S, Remitz A, Tamai K, and Uitto J. Interleukin-10 modulates type I collagen and matrix metalloprotease gene expression in cultured human skin fibroblasts. J Clin Invest 94: 2489-2492, 1994[Web of Science][Medline].

32.   Rennick, D, Davidson N, and Berg D. Interleukin-10 gene knock-out mice: a model of chronic inflammation. Clin Immunol Immunopathol 76: S174-S178, 1995[Web of Science][Medline].

33.   Santucci, L, Fiorucci S, Chiorean M, Brunori PM, Di Matteo FM, Sidoni A, Migliorati G, and Morelli A. Interleukin 10 reduces lethality and hepatic injury induced by lipopolysaccharide in galactosamine-sensitized mice. Gastroenterology 111: 736-744, 1996[Web of Science][Medline].

34.   Spencer, SD, Di Marco F, Hooley J, Pitts-Meek S, Bauer M, Ryan AM, Sordat B, Gibbs VC, and Aguet M. The orphan receptor CRF2-4 is an essential subunit of the interleukin 10 receptor. J Exp Med 187: 571-578, 1998[Abstract/Free Full Text].

35.   Tan, JC, Braun S, Rong H, DiGiacomo R, Dolphin E, Baldwin S, Narula SK, Zavodny PJ, and Chou CC. Characterization of recombinant extracellular domain of human interleukin-10 receptor. J Biol Chem 270: 12906-12911, 1995[Abstract/Free Full Text].

36.   Tan, JC, Indelicato SR, Narula SK, Zavodny PJ, and Chou CC. Characterization of interleukin-10 receptors on human and mouse cells. J Biol Chem 268: 21053-21059, 1993[Abstract/Free Full Text].

37.   Taniyama, T, Takai S, Miyazaki E, Fukumura R, Sato J, Kobayashi Y, Hirakawa T, Moore KW, and Yamada K. The human interleukin-10 receptor gene maps to chromosome 11q23.3. Hum Genet 95: 99-101, 1995[Web of Science][Medline].

38.   Thompson, K, Maltby J, Fallowfield J, McAulay M, Millward-Sadler H, and Sheron N. Interleukin-10 expression and function in experimental murine liver inflammation and fibrosis. Hepatology 28: 1597-1606, 1998[Web of Science][Medline].

39.   Thompson, KC, Trowern A, Fowell A, Marathe M, Haycock C, Arthur MJ, and Sheron N. Primary rat and mouse hepatic stellate cells express the macrophage inhibitor cytokine interleukin-10 during the course of activation in vitro. Hepatology 28: 1518-1524, 1998[Web of Science][Medline].

40.   Tsukamoto, H. Is interleukin-10 antifibrogenic in chronic liver injury? Hepatology 28: 1707-1709, 1998[Web of Science][Medline].

41.   Tsukamoto, H. Cytokine regulation of hepatic stellate cells in liver fibrosis. Alcohol Clin Exp Res 23: 911-916, 1999[Web of Science][Medline].

42.   Tsukamoto, H, Cheng S, and Blaner WS. Effects of dietary polyunsaturated fat on ethanol-induced Ito cell activation. Am J Physiol Gastrointest Liver Physiol 270: G581-G586, 1996[Abstract/Free Full Text].

43.   Wang, SC, Ohata M, Schrum L, Rippe RA, and Tsukamoto H. Expression of interleukin-10 by in vitro and in vivo activated hepatic stellate cells. J Biol Chem 273: 302-308, 1998[Abstract/Free Full Text].

44.   Weber-Nordt, RM, Meraz MA, and Schreiber RD. Lipopolysaccharide-dependent induction of IL-10 receptor expression on murine fibroblasts. J Immunol 153: 3734-3744, 1994[Abstract].


Am J Physiol Gastrointest Liver Physiol 282(6):G981-G990



This article has been cited by other articles:


Home page
NeurologyHome page
F. Gilli, P. Valentino, M. Caldano, L. Granieri, M. Capobianco, S. Malucchi, A. Sala, F. Marnetto, and A. Bertolotto
Expression and regulation of IFN{alpha}/{beta} receptor in IFN{beta}-treated patients with multiple sclerosis
Neurology, December 9, 2008; 71(24): 1940 - 1947.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. Horani, N. Muhanna, O. Pappo, A. Melhem, C. E. Alvarez, S. Doron, W. Wehbi, K. Dimitrios, S. L. Friedman, and R. Safadi
Beneficial effect of glatiramer acetate (Copaxone) on immune modulation of experimental hepatic fibrosis
Am J Physiol Gastrointest Liver Physiol, February 1, 2007; 292(2): G628 - G638.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
M. van de Bovenkamp, G. M. M. Groothuis, A. L. Draaisma, M. T. Merema, J. I. Bezuijen, M. J. van Gils, D. K. F. Meijer, S. L. Friedman, and P. Olinga
Precision-Cut Liver Slices as a New Model to Study Toxicity-Induced Hepatic Stellate Cell Activation in a Physiologic Milieu
Toxicol. Sci., May 1, 2005; 85(1): 632 - 638.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
282/6/G981    most recent
00293.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (16)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mathurin, P.
Right arrow Articles by Tsukamoto, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mathurin, P.
Right arrow Articles by Tsukamoto, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online