AJP - GI Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 283: G856-G863, 2002. First published June 12, 2002; doi:10.1152/ajpgi.00503.2001
0193-1857/02 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/4/G856    most recent
00503.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Froh, M.
Right arrow Articles by Wheeler, M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Froh, M.
Right arrow Articles by Wheeler, M. D.
Vol. 283, Issue 4, G856-G863, October 2002

Molecular evidence for a glycine-gated chloride channel in macrophages and leukocytes

Matthias Froh, Ronald G. Thurmandagger, and Michael D. Wheeler

Laboratory of Hepatobiology and Toxicology, Department of Pharmacology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-7365


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Recent studies have demonstrated that glycine blunts the response of Kupffer cells to endotoxin. Based on pharmacological evidence, it was hypothesized that Kupffer cells and other macrophages contain a glycine-gated chloride channel similar to the glycine receptor expressed in neuronal tissues. Moreover, glycine stimulates influx of radiolabeled chloride in Kupffer cells in a dose-dependent manner. RT-PCR was used to identify mRNA of both alpha - and beta -subunits of the glycine receptor in rat Kupffer cells, peritoneal neutrophils, and splenic and alveolar macrophages, similar to the sequence generated from rat spinal cord. Importantly, the sequence of the cloned Kupffer cell glycine receptor fragment for the beta -subunit was >95% homologous with the receptor from the spinal cord. Membranes of these cells also contain a protein that is immunoreactive with antibodies against the glycine-gated chloride channel. These data demonstrate that Kupffer cells, as well as other macrophages and leukocytes, express mRNA and protein for a glycine-gated chloride channel with both molecular and pharmacological properties similar to the channel expressed in the central nervous system.

membrane potential; intracellular calcium; lipopolysaccharide


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

KUPFFER CELLS ARE THE RESIDENT macrophages of the liver representing ~80% of the total fixed macrophage population. They are involved in disease states, such as endotoxin shock (6), alcoholic liver diseases (18), and other toxicant-induced liver injury. They are derived from the monocyte/macrophage cell lineage, release physiologically active substances, such as eicosanoids and inflammatory cytokines (IL-1, IL-6, TNF-alpha ), and produce free radical species (19). Kupffer cells are activated like other macrophages by endotoxin, a component of the cell wall of gram-negative bacteria and are involved in tissue injury.

Glycine, a simple nonessential amino acid, is a well-known inhibitory neurotransmitter in the central nervous system, that acts via a glycine-gated chloride channel (e.g., in spinal cord) and has been shown to be protective against hypoxia, ischemia, and various cytotoxic substances (16, 29, 38). The glycine receptor (GlyR) is composed of one of four 48-kDa alpha -subunits and a 58-kDa beta -subunit and comprises a pentameric complex that forms a chloride-selective transmembrane channel (23).

It was shown that dietary glycine protected both the lung and liver against lethal doses of endotoxin in the rat (31) and improved graft survival after liver transplantation (3). Ikejima et al. (11) suggested that Kupffer cells contained a glycine-gated chloride channel, because glycine blunted LPS-induced increases in intracellular Ca2+. This increase in intracellular Ca2+ was dependent on extracellular Cl- and was reduced by strychnine, a selective inhibitor of the neuronal glycine-gated chloride channel. Chloride influx hyperpolarizes the membrane, which most likely blunts increases in intracellular Ca2+ by making voltage-dependent calcium channels more difficult to open (23). Furthermore, glycine stimulated the influx of radiolabeled chloride in peritoneal neutrophils (32) and alveolar macrophages (33), providing evidence for the existence of a GlyR in cells other then neuronal tissue. However, molecular evidence supporting the hypothesis that Kupffer cells and other macrophages express a glycine-gated chloride channel is lacking. Therefore, the aim of these studies was to test this hypothesis.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Preparation and culture of Kupffer cells and leukocytes. Male Sprague-Dawley rats (250-300 g) used in this study were housed in compliance with American Association for Accreditation of Laboratory Animal Care and institutional guidelines. The animal protocol for this study was reviewed and approved by the Institutional Review Board for Animal Care and Use at the University of North Carolina.

Kupffer cells were isolated by collagenase digestion and differential centrifugation using Percoll (Amersham Pharmacia Biotech, Uppsala, Sweden) as described elsewhere (20) with slight modifications. Briefly, the liver was perfused through the portal vein with Ca2+- and Mg2+-free HBSS at 37°C for 5 min at a flow rate of 20 ml/min. Subsequently, perfusion was with HBSS containing 0.02% collagenase IV (Sigma, St. Louis, MO) at 37°C for 10 min. After the liver was digested, it was excised and cut into small pieces in collagenase buffer. The suspension was filtered through nylon gauze and the filtrate was centrifuged two times at 70 g for 3 min at 4°C to remove parenchymal cells. The nonparenchymal cell fraction in the supernatant was washed with buffer and centrifuged at 650 g for 7 min at 4°C. Cell pellets were resuspended in buffer and centrifuged on a density cushion of Percoll (25 and 50%) at 2,500 g for 15 min at 4°C. The Kupffer cell fraction was collected, centrifuged at 650 g for 7 min and resuspended again in buffer. Viability of cells was determined by Trypan blue exclusion. Purity (>90%) of Kupffer cells cultures was evaluated by morphological observation and by phagocytic uptake of FITC-labeled 1-mm latex beads. Cells were seeded either onto 25-mm glass coverslips or 60-mm2 dishes and cultured in RPMI-1640 medium (GIBCO Laboratories Life Technologies, Grand Island, NY) supplemented with 10% FBS and antibiotics/antimycotics (100 U/ml of penicillin G, 100 µg/ml of streptomycin sulfate, and 0.25 µg/ml amphotericin B) at 37°C in a 5% CO2-containing atmosphere. Nonadherent cells were removed after 30 min by replacing the culture medium. Cells were cultured for 24 h before experiments.

Splenic macrophages were isolated as described by Lindén et al. (13) with minor modifications. The spleen was removed under aseptic conditions, and fragments were placed on sterile nylon mesh. Cells were rinsed through the nylon mesh with RPMI-1640 media containing 2 U/ml heparin and antibiotics before being washed twice and centrifuged at 300 g for 10 min. The cell pellet was resuspended in 0.15 M NH4Cl for 1 min to lyse the erythrocytes, and the volume was increased to 50 ml with media and centrifuged again at 300 g for 10 min followed by cultivation as described above.

Alveolar macrophages were isolated by bronchoalveolar lavage as described previously (5). Briefly, the trachea was cannulated and the lungs were lavaged five times with 10 ml of PBS warmed to 37°C. Cells were centrifuged at 500 g for 7 min, and the pellet was resuspended in RPMI-1640 medium and cultured as described above.

Neutrophils were isolated by standard procedures (32). Specifically, glycogen from oyster (1%) was dissolved in 35 ml saline and administered intraperitoneally to male Sprague-Dawley rats (~300 g) under light ether anesthesia. Four hours later, rats were reanesthetized, exanguinated, and cells in the peritoneum were removed by lavage with 35 ml of sterile PBS containing 2 U/ml heparin. The suspension was centrifuged at 500 g for 7 min, and erythrocytes were destroyed by hypotonic lysis in 0.15 M NH4Cl for 2 min. Cells were resuspended, centrifuged, and cultured in RPMI-1640 medium as described above.

Measurement of intracellular Ca2+ concentration in Kupffer cells. Intracellular Ca2+ concentration ([Ca2+]i) was measured fluorometrically using the fluorescent calcium indicator dye fura-2. Kupffer cells (1 × 106 cells/plate) were incubated in modified HBSS (mHBSS; in mM): 110 NaCl, 5 KCl, 0.3 Na2HPO4, 0.4 KH2PO4, 5.6 glucose, 0.8 MgSO4· 7 H2O, 4 NaHCO3, 1.26 CaCl2, 15 HEPES, pH 7.4 containing 5 µM fura-2 AM (Molecular Probes, Eugene, OR) at room temperature for 45 min. Coverslips plated with Kupffer cells were rinsed and placed in chambers with mHBSS at room temperature. Changes in fluorescence intensity of fura-2 at excitation wavelengths of 340 and 380 nm and emission at 510 nm were monitored in individual Kupffer cells. A Nikon inverted fluorescent microscope interfaced with dual-wavelength fluorescent photometer (Intracellular Imaging, Cincinnati, OH) was used to ratiometrically determine [Ca2+]i. Data were collected and analyzed using InCyt software (Intracellular Imaging).

Measurement of 36Cl influx by Kupffer cells. Assays for uptake of 36Cl used an adaptation of a method described for neurons by Schwartz et al. (27) and modified by Morrow and Paul (17). Briefly, 2 × 106 Kupffer cells were plated on coverslips in 60 mm2 culture dishes and incubated for 24 h as described above. For some experiments, cells were either treated or untreated with 1 U/ml PNGaseF (glycopeptidase F; Sigma-Aldrich, St. Louis, MO), an enzyme that removes N-linked glycosyl moieties, for 2 h before media were replaced with HEPES buffer (in mM): 20 HEPES, 118 NaCl, 4.7 KCl, 1.2 MgSO4, and 2.5 CaCl2, pH 7.4, and allowed to equilibrate for 10 min at room temperature. Coverslips were gently blotted dry and incubated in a petri dish with 2 ml of buffer containing 2 µCi/ml 36Cl in the presence of glycine (0-4 mM) and/or strychnine (1 µM) for 5 s. Chloride influx was linear between 2 and 10 s; thus a 5-s incubation time was chosen for all experiments. Chloride influx was terminated by washing the coverslip with ice-cold buffer for 3 s followed by a second wash for 7 s (17). Coverslips were placed in scintillation vials, and protein was solubilized by adding 1.6 ml NaOH (0.2 M) for 2 h. An aliquot (0.16 ml) was collected for determination of protein by the method of Lowry et al. (14). Ecolume (10 ml) was added, and radioactivity was determined by standard scintillation spectroscopy.

Protein isolation and immunoprecipitation/Western blotting. Crude membranes from Kupffer cells were obtained by differential centrifugation after lysis in Triton X-100 buffer as described by Betz et al. (4). Briefly, cells were washed in cold PBS and harvested by scraping in PBS after 24-h culture in RPMI-1640 medium. After homogenation, lysate underwent a 17,000-g centrifugation to remove nuclei and mitochondrial membranes, leaving plasma membranes and microsomal membranes. Supernatant was then centrifuged at 100,000 g. The resulting membrane pellet was then solublized in 1% Triton X-100 solution (150 mM NaCl, 25 mM Tris, 1.0% Triton X-100, and protease inhibitor cocktail) before further experiments. For immunoprecipitation 1 ml of cell lysate (100-500 µg of total cellular protein) was incubated with primary antibody (anti-GlyR-alpha +) for 1 h at 4°C followed by adding 20 µl A/G PLUS-Agarose (Santa Cruz Biotechnology, Santa Cruz, CA) and incubation overnight at 4°C on a rotating device. The pellet was collected by centrifugation (1,000 g for 5 min), washed, and resuspended in PBS. Protein was analyzed by 10% SDS-PAGE electrophoresis and transferred onto nitrocellulose by enhanced chemiluminesence (ECL; Hybond ECL; Amersham, United Kingdom) using a semidry transfer in 20% methanol. The membrane was blocked with 5% nonfat dry milk in TBS containing 0.05% Tween-20 (TTBS) for 1 h and was blotted for 8 h with a 1:100 dilution of rabbit anti-GlyR-alpha 1 polyclonal antibody (Chemicon, Temecula, CA) in 1% nonfat dry milk/TTBS. It was then blotted for 2 h with a 1:5,000 dilution of donkey anti-rabbit peroxidase conjugated antibody (Amersham Pharmacia Biotech) in 1% nonfat dry milk/TTBS. The membrane was washed three times for 10 min between blotting steps with TTBS. After incubation in secondary antibody and washing, the protein was detected by ECL (Amersham) and exposure to Kodak X-ray film.

RNA isolation and purification. After 24 h of incubation, Kupffer cells, splenic macrophages, alveolar macrophages and neutrophils were scraped into RPMI-1640 medium and centrifuged at 650 g for 7 min to pellet cells. The cells were resuspended in 1 ml of RNA-STAT60 (Tel-Test, Friendswood, TX) and allowed to lyse at room temperature for 5-10 min. Tissue from spinal cord was homogenized and lysed using the same protocol. The RNA was extracted and purified following the manufacturer's recommendations.

RT-PCR amplification of the GlyR sequence. An internal sequence of the GlyR was amplified using two-step RT-PCR. Briefly, 1 µg of total RNA was incubated at 95°C for 5 min and was added to 1 pmol of random hexamer (N6)n primers in a final volume of 11.5 µl. The mixture was incubated at room temperature for 10 min to allow primer annealing. RT (2.5 units) was then added to the mixture in a final volume of 50 µl also containing 20 mM DTT, 0.1 mM deoxynucleotide triphosphates (dNTPS), and RT reaction buffer. The RT reaction was carried out at 42°C for 45 min and stored at -20°C until further use. A 1-6 µl aliquot of the RT reaction was used for PCR amplification. The PCR reaction mixture included Taq polymerase reaction buffer (Boehringer-Mannheim, Mannheim, Germany), 2.0 mM MgCl2, 0.1 mM dNTPs, 0.2 mM of forward and reverse primers, and 2.5 U of Taq polymerase (Boehringer-Mannheim) in a final volume of 50 µl. The primers used for GlyR amplification were as follows: for the GlyR alpha 1-subunit (predicted product: 599 bp): sense: 5' ATCATGCAACTGGAAAGCTTTGGT 3', antisense: 5' GATGCCATCCTTGGCTTGCAGGCA 3'; for the GlyR alpha 2-subunit (predicted product: 599 bp): sense: 5' ATGGATGTCCAGACCTGTACAATG 3', antisense: 5' GCAGTGACCCATCCCATAACCGCT 3'; for the GlyR alpha 3-subunit (predicted product: 599 bp): sense: 5' CTGACATTAACACTCTCTTGTCCA 3', antisense: 5' CTCCAGTGCAAAAGCTTCTGTTTT 3'; for the GlyR alpha 4-subunit (predicted product: 479 bp): sense: 5' GGTCTGTGTAGCTATCAGTCTTTG 3', antisense: 5' GGAGATTGGTGTCCACCTGCTTAA 3'; for the GlyR beta -subunit (predicted product: 210 bp): sense: 5' ACGCAGCTAAGAAGAACACTGTGA 3', antisense: 5' CCAAGTTCCATTGTTGACTTCAATG 3'; for the GAPDH (predicted product: 988 bp): sense: 5' TGAAGGTCGGTGTCAACGGATTTG 3', antisense: 5' CATGTAGGCCATGAGGTCCACCAC 3'.

Amplification was performed using 30 cycles involving a 1-min denaturation at 94°C, a 1-min annealing at 51°C, and a 2-min extension at 72°C. The cycles were preceded by a 5-min incubation at 94°C and followed by a 10-min incubation at 72°C. Primers for rat GAPDH were used as an internal control. Reaction products were analyzed by 2.0% agarose gel electrophoresis.

RNase protection assay. A GlyR beta -subunit fragment of rat spinal cord cDNA was subcloned into a plasmid vector and purified using the TOPO TA Cloning Kit (Invitrogen, Carlsbad, CA) and the Wizard Plus Midipreps DNA purification system (Promega, Madison, WI) as described in the manufacturer's recommendations. The plasmid was linearized with HindIII restriction digest (Roche, Mannheim, Germany) and transcribed using a T7 RNA polymerase (Promega) to generate a ~175 nucleotides antisense RNA probe (the protected fragment was ~145 bp). The unprotected 30 bp was due to transcription of the 5' flanking region of the plasmid template. A ~125-nucleotide antisense probe specific for rat GAPDH was used as housekeeping gene (Pharmingen, San Diego, CA).

RNase protection assays were performed using the RiboQuant assay system (Pharmingen). Briefly, using single probe templates for GlyR and GAPDH, 32P-RNA probes were transcribed with T7 polymerase followed by phenol/chloroform extraction, and ethanol precipitation. Total RNA (10 µg) from Kupffer cells, splenic macrophages, alveolar macrophages, neutrophils, and spinal cord RNA (2 µg) were hybridized to 5 × 105 counts/min of probe overnight at 56°C and digested with RNase followed by proteinase K treatment, phenol/chloroform extraction, and ethanol and ammonium acetate precipitation. Samples were resolved on 5% acrylamide-bisacrylamide (19:1) urea gels. After drying, gels were visualized by autoradiography (8). Spinal cord RNA (2 µg) was hybridized only with the GAPDH probe template alone as a control.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Glycine blocks LPS-induced increases in [Ca2+]i in Kupffer cells. [Ca2+]i in cultured Kupffer cells was determined fluorometrically with the calcium indicator fura-2 as described in MATERIALS AND METHODS. After the addition of 10 µg/ml LPS, [Ca2+]i levels increased quickly, reaching ~300 nM in 60 s, followed by a rapid decline to basal levels within 3-5 min (Fig. 1A). Glycine (1 mM) added 3 min before LPS largely prevented the increase in [Ca2+]i, with values only reaching about one-third of maximal, confirming previous work by Ikejima et al. (11). Glycine alone had no measurable effect on [Ca2+]i (data not shown).


View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1.   Effect of glycine (GLY) on LPS-induced increases in intracellular Ca2+ concentration ([Ca2+]i) in Kupffer cells and working hypothesis. A: Kupffer cells were isolated and cultured as described in MATERIALS AND METHODS. After loading with fura-2, cells were incubated for 3 min in modified HBSS in the presence or absence of glycine (1 mM). LPS (final concentration 10 µg/ml) was added in 5% rat serum in modified HBSS, and [Ca2+]i was measured fluorometrically. Data are representative of experiments repeated 6 times. B: it is proposed that Kupffer cell membranes become hyperpolarized in the presence of glycine due to an influx of chloride through glycine-gated chloride channels. Hyperpolarization prevents LPS-induced increases in [Ca2+]i and activation of the Kupffer cells, thereby minimizing production of TNF-alpha and various other cytokines and eicosanoids.

Glycine stimulates influx of radiolabeled chloride in Kupffer cells. The glycine-gated chloride channel permits the influx of chloride into cells and hyperpolarizes the plasma membrane (11), preventing LPS-induced increases of [Ca2+]i (Fig. 1B). Indeed, radiolabeled chloride influx was stimulated with glycine in a dose-dependent manner with an EC50 ~100 µM (Fig. 2A). Glycine (1 mM) caused a significant ~4.5-fold influx of radiolabeled chloride. This effect of glycine was reduced significantly by the classical glycine-gated chloride channel antagonist strychnine (Fig. 2B). These data provide strong pharmacological evidence for the presence of a glycine-gated chloride channel on Kupffer cells.


View larger version (9K):
[in this window]
[in a new window]
 
Fig. 2.   Glycine stimulates influx of radiolabeled chloride in Kupffer cells. Cells (2 × 106) were plated onto 25 mm2 coverslips and incubated for 24 h at 37°C in RPMI-1640 supplemented with 10% FBS and antibiotics. Cells were washed with HEPES buffer before experiments. A: coverslips were added to buffer containing radiolabeled chloride and increasing concentrations of glycine for 5 s and washed twice in cold buffer. B: cells were added to buffer containing radiolabeled chloride alone, buffer containing radiolabeled chloride and 1 mM glycine, or buffer containing radiolabeled chloride, 1 mM glycine, and 1 µM strychnine for 5 s, and then washed twice in cold buffer. Counts were normalized to the amount of protein on each coverslip. Data are expressed as %control ± SD and are representative of at least 4 individual experiments (aP < 0.05 compared with control group; bP < 0.05 compared with glycine group, by ANOVA with Tukey's post hoc analysis).

Antibodies against the glycine-gated chloride channel are immunoreactive with macrophage/leukocyte membrane protein. Because pharmacological evidence for the GlyR exists in Kupffer cells and other macrophages, it was hypothesized that the receptor would be expressed in the plasma membrane and could be detected by immunoblotting. The GlyR in the neuronal tissue (brain and spinal cord) has been successfully detected using a polyclonal antibody (anti-GlyR-alpha 1) that recognizes regions on alpha -subunits (alpha 1 and alpha 2) of the receptor (22). In purified spinal cord and Kupffer cell membranes, the ~48-kDa alpha -subunits of the GlyR were detected by Western blot using the anti-GlyR-alpha 1 antibody (Fig. 3A). In peritoneal neutrophils and splenic and alveolar macrophages, the ~48-kDa protein was also detected by immunoprecipitation and Western blot (Fig. 3C). Because the same antibody was used for immunoprecipitation and Western blotting, both heavy chain and light chain were observed. Importantly, the anti-GlyR-alpha 1 antibody reacted with the cell extracts and is consistent with the hypothesis that a protein similar to the alpha -subunits of the spinal cord GlyR is present in Kupffer cells, peritoneal neutrophils, and splenic and alveolar macrophages.


View larger version (38K):
[in this window]
[in a new window]
 
Fig. 3.   Immunodetection of the glycine-gated chloride channel. A: Western blot using 50 µg spinal cord membrane extract (lane 1) and 30-200 µg of Kupffer cell membrane extract (lanes 3-6), using anti-glycine receptor-alpha 1 (anti-GlyR-alpha 1) polyclonal antibody as described in MATERIAL AND METHODS. B: spinal cord (50 µg) and Kupffer cell (100 µg) membrane extract was immunoprecipitated followed by Western blotting using anti-GlyR-alpha 1 (cross-reactive with the alpha 2-subunit) polyclonal antibody as primary antibody. Purified hepatocyte membrane extracts (100 µg) were used as a negative control. The heavy (~55 kDa) and light IgG (~27 kDa) chains from the primary antibody were also detected. C: spinal cord membrane extract (50 µg), splenic macrophages (500 µg), alveolar macrophages (500 µg), peritoneal neutrophils (500 µg), and Kupffer cell (100 µg) membrane extracts were immunoprecipitated followed by Western blotting using anti-GlyR-alpha 1 antibody.

Kupffer cells, neutrophils, and other macrophages differently express alpha -subunits of the GlyR. Because proteins for alpha -subunits for the GlyR exist in macrophages and leucocytes, RT-PCR for each subtype of the alpha -subunit was performed to determine what subunits are expressed in Kupffer cells, peritoneal neutrophils, and splenic and alveolar macrophages. Because the GlyR is a pentameric assembly of ligand-binding alpha -subunits (alpha 1-alpha 4) and a stuctural beta -subunit, PCR primers were designed to amplify an internal region of the different alpha -subunits. By using RT-PCR for the alpha 1-subunit, a fragment was generated for Kupffer cells as predicted from the cloned sequence of the spinal cord GlyR (Fig. 4A). However, no fragment could be amplified for peritoneal neutrophils, and splenic and alveolar macrophages. For the alpha 2-subunit, a fragment was generated from neutrophils, and splenic and alveolar macrophages but not from Kupffer cells (Fig. 4A). A 479-bp fragment for the alpha 4-subunit was amplified from all investigated macrophages and neutrophils (Fig. 4A). However, no fragment for the alpha 3-subunit could be amplified in the cells or in the spinal cord (data not shown). Also, GAPDH was amplified from all cells, resulting in 988-bp fragments as predicted from the sequence. For all fragments genomic contamination was excluded by direct PCR amplification of the mRNA. Additionally, RT-PCR of Kupffer cell mRNA for the GlyR beta -subunit was performed. The sequence of the cloned receptor fragment (~550 bp) was >95% homologous to the nucleotide sequence of GlyR beta -subunit from adult rat spinal cord (data not shown).


View larger version (40K):
[in this window]
[in a new window]
 
Fig. 4.   RT-PCR and RNase protection assay of the glycine-gated chloride channel. A: a ~599-bp fragment for GlyR alpha 1-subunit, a ~599-bp fragment for GlyR alpha 2-subunit, a ~479-bp fragment for GlyR alpha 4-subunit and, as control, a ~988-bp fragment for GAPDH were amplified from rat cell cDNA. RT-PCR of 1 µg of rat spinal cord mRNA and 3 µg of splenic macrophage, alveolar macrophage, Kupffer cell, and peritoneal neutrophils mRNA. B: detection of the glycine-gated chloride channel beta -subunit in macrophages and leukocytes. GlyR (~175 nucleotides) and GAPDH (~125 nucleotides) mRNA levels were measured by standard RNase protection assay as detailed in MATERIALS AND METHODS. GAPDH-labeled mRNA of spinal cord (lane 1). GlyR- and GAPDH-labeled mRNA (10 µg for macrophages/leucocytes and 2 µg for spinal cord) from spinal cord (lane 2), splenic macrophages (lane 3), alveolar macrophages (lane 4), Kupffer cells (lane 5), and neutrophils (lane 6) are shown.

Macrophages and leukocytes contain RNA for the beta -subunit of the GlyR. Because of the general structure of the GlyR (pentameric complex) including almost always the beta -subunit, this subunit was chosen for screening purposes. A cDNA fragment from the spinal cord GlyR beta -subunit was subcloned into a plasmid containing bacteriophage promoters and used as a template in a RNase protection assay. For internal control and quantification, a template for a housekeeping gene, GAPDH, was used. RNase protection assay from RNA of Kupffer cells, splenic macrophages, alveolar macrophages, and neutrophils showed the predicted GlyR template fragment (Fig. 4B) demonstrating the existence of GlyR RNA for the beta -subunit in all cell types studied. Hepatocytes (negative control) did not exhibit signals (data not shown).


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Anti-inflammatory actions of glycine. Glycine, a well-known inhibitory neurotransmitter in the spinal cord (23), exerts its inhibitory actions by binding its receptor (GlyR), which is largely localized in postsynaptic neuronal membranes (2). The amino acid hyperpolarizes the plasma membrane through a glycine-gated chloride channel and opposes excitatory postsynaptic potentials (23). Glycine has been investigated in several extraneuronal experimental models (see Table 1) and has been shown to be effective in liver in reperfusion injury (39), survival after transplantation (26) or alcohol-induced injury (9). In the lung, prevention of injury and a reduction of inflammation by glycine were demonstrated in an endotoxin shock model (31). In the kidney, cyclosporin A-induced nephrotoxicity could be prevented (38). Furthermore, Yang et al. (34) reported increased survival after glycine in a sepsis model. The beneficial effects of glycine in these different inflammatory disease states are thought to result from a unique mechanism of decreasing cell signaling and production of cytokines, such as TNF-alpha (30). However, inhibitory effects of glycine on cell signaling mechanisms support the existence of a glycine-gated chloride channel (see below).

                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Examples of beneficial effects of glycine in different models

Pharmacological evidence for a glycine-gated chloride channel in Kupffer cells. Recent pharmacological evidence has been presented supporting the hypothesis that a wide variety of cells, such as neutrophils (32), alveolar macrophages (33), endothelial cells, and Kupffer cells (11) contain glycine-gated chloride channels. Kupffer cells are activated by the LPS-LBP complex through a cell surface receptor involving CD14 and TLR-4 to cause a transient increase in [Ca2+]i (Fig. 1A). The production of cytokines depends on this increase in Ca2+ (Fig. 1B). The LPS-induced Ca2+ influx can be blunted by 60% in the presence of glycine (Fig. 1A) is reversed by low concentrations of strychnine, an antagonist to the GlyR in the central nervous system (7, 37). Therefore, it was hypothesized that Kupffer cells contain a glycine-gated chloride channel that blocks activation by blunting the increase in [Ca2+]i by hyperpolarization through an influx of extracellular chloride (Fig. 1B). Indeed, it is demonstrated that glycine stimulates chloride uptake in Kupffer cells in a dose-dependent manner (Fig. 2, A and B) consistent with studies in other macrophages and leukocytes (31, 32). Nevertheless, it is most likely that Ca2+ influx will not be completely inhibited by activation of the GlyR, because many other receptor/signaling mechanisms exist. Thus full inhibition of influx of Ca2+ (Fig. 1A) in the presence of glycine may not be expected.

Molecular evidence for a glycine-gated chloride channel in macrophages and leucocytes. Molecular evidence for a glycine-gated chloride channel in Kupffer cells and other macrophages is provided here, for the first time, using Western blotting, RT-PCR, and RNase protection assay (Figs. 3 and 4). Therefore, it is concluded that the GlyR is expressed in these cells. The molecular mass of the protein detected in the Kupffer cells (~48 kDa) as well as in neutrophils and splenic and alveolar macrophages is identical with the 48-kDa size of the alpha -subunits of the spinal cord GlyRs (Fig. 3). Because of the known cross-reactivity of the primary antibody among the GlyR alpha -subunit family (especially alpha 1 and alpha 2), RT-PCR with the use of specific primers for the different alpha -subunits (alpha 1-alpha 4) was performed to address which subunits were present in these cells. The molecular weight of the amplified RT-PCR product from Kupffer cells mRNA were as predicted for the GlyR alpha 1-subunit (Fig. 4A). Kupffer cells primarily express the alpha 1-subunit (Fig. 4A), which is one of the primary alpha -subunit isoforms expressed in adult rats, whereas other inflammatory cells contain different isoforms (e.g., splenic macrophages primarily express the alpha 2-subunit). These findings suggest that GlyR alpha -subunit heterogeneity exists within the monocyte/macrophage cell lineage population, possibly creating a functional diversity between these cells. Importantly, recent studies demonstrated that long-term glycine exposure blunts activation of alveolar macrophages and neutrophils but not of Kupffer cells (31), possibly suggesting differences in the GlyR subunit leading to differential regulation of desensitization. Specifically, long-term dietary glycine downregulates chloride channel function not only in Kupffer cells but also in neuronal tissue (1), which depends on phosphorylation of the alpha -subunit (25). Importantly, no expression for the GlyR alpha 3-subunit was observed in Kupffer cells, peritoneal neutrophils, or splenic or alveolar macrophages (data not shown) consistent with the finding that the alpha 3-subunit is only expressed in low levels in adult tissue (12). Interestingly, expression of the GlyR alpha 4-subunit was detected in Kupffer cells, neutrophils, and splenic and alveolar macrophages (Fig. 4A) but not in the spinal cord of rats. Finally, based on the fact that most adult GlyR contains the beta -subunit (21), an antisense probe for the beta -subunit was generated to be used in RNase protection assay as a screening method. Indeed, the beta -subunit mRNA was detected in Kupffer cells, splenic macrophages, neutrophils, and alveolar macrophages (Fig. 4B). In conclusion, these data along with previously published data provide molecular and pharmacological evidence that Kupffer cells and several inflammatory cells express a GlyR to the channel expressed in neuronal tissues.

Clinical implications. Based on the beneficial effects of glycine in different organs, such as liver (9, 10, 26, 35, 39), lung (31) and kidney (15, 38) in several different disease states including endotoxin-induced shock (10, 31), alcoholic hepatitis (9, 35), and sepsis (see Table 1), it is reasonable to propose that glycine would be useful in the treatment of many inflammatory diseases in humans. It could be given in the diet, and it is not toxic, making glycine potentially useful in a wide variety of inflammatory processes where macrophages or leucocytes are involved. Clinical trials are needed to help support or reject this hypothesis.


    ACKNOWLEDGEMENTS

This work was supported, in part, by grants from the National Institue on Alcohol Abuse and Alcoholism.


    FOOTNOTES

dagger Deceased 14 July 2001.

Address for reprint requests and other correspondence: M. D. Wheeler, University of North Carolina at Chapel Hill, Dept. of Pharmacology, 1124 Mary Ellen Jones Bldg., Chapel Hill, NC 27599-7365 (E-mail: wheelmi{at}med.unc.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

June 12, 2002;10.1152/ajpgi.00503.2001

Received 27 November 2001; accepted in final form 29 May 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Akaike, N, and Kaneda M. Glycine-gated chloride currents in acutely isolated rat hypothalamic neurons. J Neurophysiol 62: 1400-1408, 1989[Abstract/Free Full Text].

2.   Araki, T, Ito M, and Oscarsson O. Anion permeability of the synaptic and non-synaptic motoneurone membrane. J Physiol 159: 410-435, 1961[Free Full Text].

3.   Bachmann, S, Caldwell-Kenkel JC, Currin RT, Tanaka Y, Takei Y, Marzi I, and Thurman RG. Ultrastructural correlates of liver graft failure from storage injury: studies of graft protection by Carolina rinse solution and pantoxifylline. Transplant Proc 25: 1620-1624, 1993[Web of Science][Medline].

4.   Betz, H, Langosch D, Hoch W, Prior P, Pribilla I, Kuhse J, Schmieden V, Malosio ML, Matzenbach B, Holzinger F, Kuryatov A, Schmitt B, Maulet Y, and Becker CM. Structure and expression of inhibitory glycine receptors. In: Neuroreceptor Mechanisms in Brain, edited by Kito S.. New York: Plenum, 1991, p. 421-429.

5.   Bhat, M, Rojanasakul Y, Weber SL, Ma JYC, Castranova V, Banks DE, and Ma JKH Fluromicroscopic studies of bleomycin-induced intracellular oxidation in alveolar macrophages and its inhibition by taurine. Environ Health Perspect 102, Suppl10: 91-96, 1994.

6.   Chensue, SW, Terebuh PD, Remick DG, Scales WE, and Kunkel SL. In vivo biologic and immunohistochemical analysis of interleukin-1 alpha, beta and tumor necrosis factor during experimental endotoxemia: kinetics, Kupffer cell expression, and glucocorticoid effects. Am J Pathol 138: 395-402, 1991[Abstract].

7.   Curtis, DR. The depression of spinal inhibition by electrophoretically administered strychnine. Int J Neuropharmacol 1: 239-250, 1962[Web of Science].

8.   Gilman, M. Ribonuclease protection assay. In: Current Protocols in Molecular Biology, edited by Ausubel FM, Brent R, Kingston RE, Moore DD, Seiman JG, Smith JA, and Stuhl K.. New York: Wiley, 1999, p. 4.7.1-4.7.8.

9.   Iimuro, Y, Bradford BU, Forman DT, and Thurman RG. Glycine prevents alcohol-induced liver injury by decreasing alcohol in the stomach. Gastroenterology 110: 1536-1542, 1996[Web of Science][Medline].

10.   Ikejima, K, Iimuro Y, Forman DT, and Thurman RG. A diet containing glycine improves survival in endotoxin shock in the rat. Am J Physiol Gastrointest Liver Physiol 271: G97-G103, 1996[Abstract/Free Full Text].

11.   Ikejima, K, Qu W, Stachlewitz RF, and Thurman RG. Kupffer cells contain a glycine-gated chloride channel. Am J Physiol Gastrointest Liver Physiol 272: G1581-G1586, 1997[Abstract/Free Full Text].

12.   Kuhse, J, Schmieden V, and Betz H. Identification and functional expression of a novel binding subunit of the inhibitory glycine receptor. J Biol Chem 265: 22317-22320, 1990[Abstract/Free Full Text].

13.   Lindén, O, Dohlsten M, Boketoft Å, Hedlund G, and Sjögren HO. Catalase and lipopolysaccharide enhance proliferation in the rat mixed lymphocyte reaction. Scand J Immunol 26: 223-228, 1987[Web of Science][Medline].

14.   Lowry, OH, Rosebrough NJ, Farr AL, and Randall RJ. Protein measurement with the Folin phenol reagent. J Biol Chem 193: 265-275, 1951[Free Full Text].

15.   Miller, GW, Lock EA, and Schnellmann RG. Strychnine and glycine protect renal proximal tubules from various nephrotoxicants and act in the late phase of necrotic cell injury. Toxicol Appl Pharmacol 125: 192-197, 1994[Web of Science][Medline].

16.   Miller, GW, and Schnellmann RG. A putative cytoprotective receptor in the kidney: relation to the neuronal strychnine-sensitive glycine receptor. Life Sci 55: 27-34, 1994[Web of Science][Medline].

17.   Morrow, AL, and Paul SM. Benzodiazepin enhancement of gamma-aminobutyric acid mediated Cl- ion flux in rat brain synaptoneurosomes. J Neurochem 50: 302-306, 1988[Web of Science][Medline].

18.   Nolan, JP, Leibowitz A, and Vladatin AL. Influence of alcohol on Kupffer cell function and possible significance in liver injury. In: The Reticuloendothelial System and Pathogenesis of Liver Disease, edited by Liehr H, and Green M.. Amsterdam, The Netherlands: Elsevier, 1980, p. 125-136.

19.   Ogle, CK, Jun-Zhen W, Xialing M, Szczur K, Alexander W, and Ogle JD. Heterogeneity of Kupffer cell and splenic, alveolar and peritoneal macrophages for the production of TNF, IL-1, and IL-6. Inflammation 18: 511-523, 1994[Web of Science][Medline].

20.   Pertoft, H, and Smedsrod B. Separation and characterization of liver cells. In: Cell Separation: Methods and Selected Applications, , edited by Pretlow TG II, and Pretlow TP.. New York: Academic, 1987, vol. 4, p. 1-24.

21.   Pfeiffer, F, and Betz H. Solubilisation of the glycine receptor from the rat spinal cord. Brain Res 226: 273-279, 1981[Web of Science][Medline].

22.   Pfeiffer, F, Simler R, Grenningloh G, and Betz H. Monoclonal antibodies and peptide mapping reveal structural similarities between the subunits of the glycine receptor of rat spinal chord. Proc Natl Acad Sci USA 81: 7224-7227, 1984[Abstract/Free Full Text].

23.   Rajendra, S, Lynch JW, and Schofield PR. The glycine receptor. Pharmacol Ther 73: 121-146, 1997[Web of Science][Medline].

24.   Rose, ML, Madren J, Bunzendahl H, and Thurman RG. Dietary glycine inhibits the growth of B16 melanoma tumors in mice. Carcinogenesis 20: 793-798, 1999[Abstract/Free Full Text].

25.   Ruiz-Gomez, A, Vaello ML, Valdivieso F, and Mayor F, Jr. Phosphorylation of the 48-kDa subunit of the glycine receptor by protein kinase C. J Biol Chem 266: 559-566, 1991[Abstract/Free Full Text].

26.   Schemmer, P, Bradford BU, Rose ML, Bunzendahl H, Raleigh JA, Lemasters JJ, and Thurman RG. Intravenous glycine improves survival in rat liver transplantation. Am J Physiol Gastrointest Liver Physiol 276: G924-G932, 1999[Abstract/Free Full Text].

27.   Schwartz, RD, Paul SM, and Majewska MD. Factors modulating the sensitivity of a GABA-gated chloride channel. Clin Neuropharmacol 9: 389-391, 1986.

28.   Spittler, A, Reissner CM, Oehler JR, Gornikiewicz A, Gruenberger T, Manhart N, Brodowicz T, Mittlboeck M, Boltz-Nitulescu G, and Roth E. Immunomodulatory effects of glycine on LPS-treated monocytes: reduced TNF-alpha production and accelerated IL-10 expression. FASEB J 13: 563-571, 1999[Abstract/Free Full Text].

29.   Venkatachalam, MA, Weinberg JM, Patel Y, Saikumar P, and Dong Z. Cytoprotection of kidney epithelial cells by compounds that target amino acid chloride channels. Kidney Int 49: 449-460, 1996[Web of Science][Medline].

30.   Wheeler, MD, Ikejima K, Enomoto N, Stachlewitz RF, Seabra V, Zhong Z, Yin M, Schemmer P, Rose ML, Rusyn I, Bradford BU, and Thurman RG. Glycine: a new anti-inflammatory immunonutrient. Cell Mol Life Sci 56: 843-856, 1999[Web of Science][Medline].

31.   Wheeler, MD, Rose ML, Yamashima S, Enomoto N, Seabra V, Madren J, and Thurman RG. Dietary glycine blunts lung inflammatory cell influx following acute endotoxin. Am J Physiol Lung Cell Mol Physiol 279: L390-L398, 2000[Abstract/Free Full Text].

32.   Wheeler, MD, Stachlewitz RF, Ikejima K, Morrow AL, Ikejima K, and Thurman RG. Glycine-gated chloride channels in neutrophils attenuate calcium influx and superoxide production. FASEB J 14: 476-484, 2000[Abstract/Free Full Text].

33.   Wheeler, MD, and Thurman RG. Production of superoxide and TNF-alpha from alveolar macrophages is blunted by glycine. Am J Physiol Lung Cell Mol Physiol 277: L952-L959, 1999[Abstract/Free Full Text].

34.   Yang, S, Koo DJ, Chaudry IH, and Wang P. Glycine attenuates hepatocellular depression during early sepsis and reduces sepsis-induced mortality. Crit Care Med 29: 1201-1206, 2001[Web of Science][Medline].

35.   Yin, M, Ikejima K, Arteel GE, Seabra V, Bradford BU, Kono H, Rusyn I, and Thurman RG. Glycine accelerates recovery from alcohol-induced liver injury. J Pharmacol Exp Ther 286: 1014-1019, 1998[Abstract/Free Full Text].

36.   Yin, M, Rusyn I, Schoonhoven R, Graves LM, Rusyn EV, Li X, Li F, Cox AD, Harding TW, Bunzendahl H, Swenberg JA, and Thurman RG. Inhibition of chronic rejection of aortic allografts by dietary glycine. Transplantation 69: 773-780, 2000[Web of Science][Medline].

37.   Young, AB, and Snyder SH. Strychnine binding associated with glycine receptors of the central nervous system. Proc Natl Acad Sci USA 70: 2832-2836, 1973[Abstract/Free Full Text].

38.   Zhong, Z, Connor HD, Yin M, Moss N, Mason RP, Bunzendahl H, Forman DT, and Thurman RG. Dietary glycine and renal denervation prevents cyclosporin A-induced hydroxyl radical production in rat kidney. Mol Pharmacol 56: 455-463, 1999[Abstract/Free Full Text].

39.   Zhong, Z, Jones S, and Thurman RG. Glycine minimizes reperfusion injury in a low-flow, reflow liver perfusion model in the rat. Am J Physiol Gastrointest Liver Physiol 270: G332-G338, 1996[Abstract/Free Full Text].


Am J Physiol Gastrointest Liver Physiol 283(4):G856-G863
0193-1857/02 $5.00 Copyright © 2002 the American Physiological Society



This article has been cited by other articles:


Home page
J. Leukoc. Biol.Home page
K. Lubick, M. Radke, and M. Jutila
Securinine, a GABAA receptor antagonist, enhances macrophage clearance of phase II C. burnetii: comparison with TLR agonists
J. Leukoc. Biol., November 1, 2007; 82(5): 1062 - 1069.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
D. J. Stuckey, D. C. Anthony, J. P. Lowe, J. Miller, W. M. Palm, P. Styles, V. H. Perry, A. M. Blamire, and N. R. Sibson
Detection of the inhibitory neurotransmitter GABA in macrophages by magnetic resonance spectroscopy
J. Leukoc. Biol., August 1, 2005; 78(2): 393 - 400.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
J. W. Lynch
Molecular Structure and Function of the Glycine Receptor Chloride Channel
Physiol Rev, October 1, 2004; 84(4): 1051 - 1095.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
283/4/G856    most recent
00503.2001v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Froh, M.
Right arrow Articles by Wheeler, M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Froh, M.
Right arrow Articles by Wheeler, M. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online