|
|
||||||||
, andLaboratory of Hepatobiology and Toxicology, Department of Pharmacology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599-7365
| |
ABSTRACT |
|---|
|
|
|---|
Recent studies have demonstrated that
glycine blunts the response of Kupffer cells to endotoxin. Based on
pharmacological evidence, it was hypothesized that Kupffer cells and
other macrophages contain a glycine-gated chloride channel similar to
the glycine receptor expressed in neuronal tissues. Moreover, glycine
stimulates influx of radiolabeled chloride in Kupffer cells in a
dose-dependent manner. RT-PCR was used to identify mRNA of both
-
and
-subunits of the glycine receptor in rat Kupffer cells,
peritoneal neutrophils, and splenic and alveolar macrophages, similar
to the sequence generated from rat spinal cord. Importantly, the
sequence of the cloned Kupffer cell glycine receptor fragment for the
-subunit was >95% homologous with the receptor from the spinal
cord. Membranes of these cells also contain a protein that is
immunoreactive with antibodies against the glycine-gated chloride
channel. These data demonstrate that Kupffer cells, as well as other
macrophages and leukocytes, express mRNA and protein for a
glycine-gated chloride channel with both molecular and pharmacological
properties similar to the channel expressed in the central nervous system.
membrane potential; intracellular calcium; lipopolysaccharide
| |
INTRODUCTION |
|---|
|
|
|---|
KUPFFER CELLS ARE THE
RESIDENT macrophages of the liver representing ~80% of the
total fixed macrophage population. They are involved in disease states,
such as endotoxin shock (6), alcoholic liver diseases
(18), and other toxicant-induced liver injury. They are
derived from the monocyte/macrophage cell lineage, release physiologically active substances, such as eicosanoids and inflammatory cytokines (IL-1, IL-6, TNF-
), and produce free radical species (19). Kupffer cells are activated like other macrophages
by endotoxin, a component of the cell wall of gram-negative bacteria and are involved in tissue injury.
Glycine, a simple nonessential amino acid, is a well-known inhibitory
neurotransmitter in the central nervous system, that acts via a
glycine-gated chloride channel (e.g., in spinal cord) and has been
shown to be protective against hypoxia, ischemia, and various
cytotoxic substances (16, 29, 38). The glycine receptor
(GlyR) is composed of one of four 48-kDa
-subunits and a 58-kDa
-subunit and comprises a pentameric complex that forms a
chloride-selective transmembrane channel (23).
It was shown that dietary glycine protected both the lung and liver
against lethal doses of endotoxin in the rat (31) and improved graft survival after liver transplantation (3).
Ikejima et al. (11) suggested that Kupffer cells contained
a glycine-gated chloride channel, because glycine blunted LPS-induced
increases in intracellular Ca2+. This increase in
intracellular Ca2+ was dependent on extracellular
Cl
and was reduced by strychnine, a selective inhibitor
of the neuronal glycine-gated chloride channel. Chloride influx
hyperpolarizes the membrane, which most likely blunts increases in
intracellular Ca2+ by making voltage-dependent calcium
channels more difficult to open (23). Furthermore, glycine
stimulated the influx of radiolabeled chloride in peritoneal
neutrophils (32) and alveolar macrophages (33), providing evidence for the existence of a GlyR in
cells other then neuronal tissue. However, molecular evidence
supporting the hypothesis that Kupffer cells and other macrophages
express a glycine-gated chloride channel is lacking. Therefore, the aim of these studies was to test this hypothesis.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Preparation and culture of Kupffer cells and leukocytes. Male Sprague-Dawley rats (250-300 g) used in this study were housed in compliance with American Association for Accreditation of Laboratory Animal Care and institutional guidelines. The animal protocol for this study was reviewed and approved by the Institutional Review Board for Animal Care and Use at the University of North Carolina.
Kupffer cells were isolated by collagenase digestion and differential centrifugation using Percoll (Amersham Pharmacia Biotech, Uppsala, Sweden) as described elsewhere (20) with slight modifications. Briefly, the liver was perfused through the portal vein with Ca2+- and Mg2+-free HBSS at 37°C for 5 min at a flow rate of 20 ml/min. Subsequently, perfusion was with HBSS containing 0.02% collagenase IV (Sigma, St. Louis, MO) at 37°C for 10 min. After the liver was digested, it was excised and cut into small pieces in collagenase buffer. The suspension was filtered through nylon gauze and the filtrate was centrifuged two times at 70 g for 3 min at 4°C to remove parenchymal cells. The nonparenchymal cell fraction in the supernatant was washed with buffer and centrifuged at 650 g for 7 min at 4°C. Cell pellets were resuspended in buffer and centrifuged on a density cushion of Percoll (25 and 50%) at 2,500 g for 15 min at 4°C. The Kupffer cell fraction was collected, centrifuged at 650 g for 7 min and resuspended again in buffer. Viability of cells was determined by Trypan blue exclusion. Purity (>90%) of Kupffer cells cultures was evaluated by morphological observation and by phagocytic uptake of FITC-labeled 1-mm latex beads. Cells were seeded either onto 25-mm glass coverslips or 60-mm2 dishes and cultured in RPMI-1640 medium (GIBCO Laboratories Life Technologies, Grand Island, NY) supplemented with 10% FBS and antibiotics/antimycotics (100 U/ml of penicillin G, 100 µg/ml of streptomycin sulfate, and 0.25 µg/ml amphotericin B) at 37°C in a 5% CO2-containing atmosphere. Nonadherent cells were removed after 30 min by replacing the culture medium. Cells were cultured for 24 h before experiments. Splenic macrophages were isolated as described by Lindén et al. (13) with minor modifications. The spleen was removed under aseptic conditions, and fragments were placed on sterile nylon mesh. Cells were rinsed through the nylon mesh with RPMI-1640 media containing 2 U/ml heparin and antibiotics before being washed twice and centrifuged at 300 g for 10 min. The cell pellet was resuspended in 0.15 M NH4Cl for 1 min to lyse the erythrocytes, and the volume was increased to 50 ml with media and centrifuged again at 300 g for 10 min followed by cultivation as described above. Alveolar macrophages were isolated by bronchoalveolar lavage as described previously (5). Briefly, the trachea was cannulated and the lungs were lavaged five times with 10 ml of PBS warmed to 37°C. Cells were centrifuged at 500 g for 7 min, and the pellet was resuspended in RPMI-1640 medium and cultured as described above. Neutrophils were isolated by standard procedures (32). Specifically, glycogen from oyster (1%) was dissolved in 35 ml saline and administered intraperitoneally to male Sprague-Dawley rats (~300 g) under light ether anesthesia. Four hours later, rats were reanesthetized, exanguinated, and cells in the peritoneum were removed by lavage with 35 ml of sterile PBS containing 2 U/ml heparin. The suspension was centrifuged at 500 g for 7 min, and erythrocytes were destroyed by hypotonic lysis in 0.15 M NH4Cl for 2 min. Cells were resuspended, centrifuged, and cultured in RPMI-1640 medium as described above.Measurement of intracellular Ca2+ concentration in Kupffer cells. Intracellular Ca2+ concentration ([Ca2+]i) was measured fluorometrically using the fluorescent calcium indicator dye fura-2. Kupffer cells (1 × 106 cells/plate) were incubated in modified HBSS (mHBSS; in mM): 110 NaCl, 5 KCl, 0.3 Na2HPO4, 0.4 KH2PO4, 5.6 glucose, 0.8 MgSO4· 7 H2O, 4 NaHCO3, 1.26 CaCl2, 15 HEPES, pH 7.4 containing 5 µM fura-2 AM (Molecular Probes, Eugene, OR) at room temperature for 45 min. Coverslips plated with Kupffer cells were rinsed and placed in chambers with mHBSS at room temperature. Changes in fluorescence intensity of fura-2 at excitation wavelengths of 340 and 380 nm and emission at 510 nm were monitored in individual Kupffer cells. A Nikon inverted fluorescent microscope interfaced with dual-wavelength fluorescent photometer (Intracellular Imaging, Cincinnati, OH) was used to ratiometrically determine [Ca2+]i. Data were collected and analyzed using InCyt software (Intracellular Imaging).
Measurement of 36Cl influx by Kupffer cells. Assays for uptake of 36Cl used an adaptation of a method described for neurons by Schwartz et al. (27) and modified by Morrow and Paul (17). Briefly, 2 × 106 Kupffer cells were plated on coverslips in 60 mm2 culture dishes and incubated for 24 h as described above. For some experiments, cells were either treated or untreated with 1 U/ml PNGaseF (glycopeptidase F; Sigma-Aldrich, St. Louis, MO), an enzyme that removes N-linked glycosyl moieties, for 2 h before media were replaced with HEPES buffer (in mM): 20 HEPES, 118 NaCl, 4.7 KCl, 1.2 MgSO4, and 2.5 CaCl2, pH 7.4, and allowed to equilibrate for 10 min at room temperature. Coverslips were gently blotted dry and incubated in a petri dish with 2 ml of buffer containing 2 µCi/ml 36Cl in the presence of glycine (0-4 mM) and/or strychnine (1 µM) for 5 s. Chloride influx was linear between 2 and 10 s; thus a 5-s incubation time was chosen for all experiments. Chloride influx was terminated by washing the coverslip with ice-cold buffer for 3 s followed by a second wash for 7 s (17). Coverslips were placed in scintillation vials, and protein was solubilized by adding 1.6 ml NaOH (0.2 M) for 2 h. An aliquot (0.16 ml) was collected for determination of protein by the method of Lowry et al. (14). Ecolume (10 ml) was added, and radioactivity was determined by standard scintillation spectroscopy.
Protein isolation and immunoprecipitation/Western blotting.
Crude membranes from Kupffer cells were obtained by differential
centrifugation after lysis in Triton X-100 buffer as described by Betz
et al. (4). Briefly, cells were washed in cold PBS and
harvested by scraping in PBS after 24-h culture in RPMI-1640 medium.
After homogenation, lysate underwent a 17,000-g
centrifugation to remove nuclei and mitochondrial membranes, leaving
plasma membranes and microsomal membranes. Supernatant was then
centrifuged at 100,000 g. The resulting membrane pellet was
then solublized in 1% Triton X-100 solution (150 mM NaCl, 25 mM Tris,
1.0% Triton X-100, and protease inhibitor cocktail) before further
experiments. For immunoprecipitation 1 ml of cell lysate (100-500
µg of total cellular protein) was incubated with primary antibody
(anti-GlyR-
+) for 1 h at 4°C followed by adding
20 µl A/G PLUS-Agarose (Santa Cruz Biotechnology, Santa Cruz, CA) and
incubation overnight at 4°C on a rotating device. The pellet was
collected by centrifugation (1,000 g for 5 min), washed, and
resuspended in PBS. Protein was analyzed by 10% SDS-PAGE
electrophoresis and transferred onto nitrocellulose by enhanced
chemiluminesence (ECL; Hybond ECL; Amersham, United Kingdom) using a
semidry transfer in 20% methanol. The membrane was blocked with 5%
nonfat dry milk in TBS containing 0.05% Tween-20 (TTBS) for 1 h
and was blotted for 8 h with a 1:100 dilution of rabbit
anti-GlyR-
1 polyclonal antibody (Chemicon, Temecula, CA)
in 1% nonfat dry milk/TTBS. It was then blotted for 2 h with a
1:5,000 dilution of donkey anti-rabbit peroxidase conjugated antibody
(Amersham Pharmacia Biotech) in 1% nonfat dry milk/TTBS. The membrane
was washed three times for 10 min between blotting steps with TTBS.
After incubation in secondary antibody and washing, the protein was
detected by ECL (Amersham) and exposure to Kodak X-ray film.
RNA isolation and purification. After 24 h of incubation, Kupffer cells, splenic macrophages, alveolar macrophages and neutrophils were scraped into RPMI-1640 medium and centrifuged at 650 g for 7 min to pellet cells. The cells were resuspended in 1 ml of RNA-STAT60 (Tel-Test, Friendswood, TX) and allowed to lyse at room temperature for 5-10 min. Tissue from spinal cord was homogenized and lysed using the same protocol. The RNA was extracted and purified following the manufacturer's recommendations.
RT-PCR amplification of the GlyR sequence.
An internal sequence of the GlyR was amplified using two-step RT-PCR.
Briefly, 1 µg of total RNA was incubated at 95°C for 5 min and was
added to 1 pmol of random hexamer (N6)n primers in a final volume of 11.5 µl. The mixture was incubated at room temperature for 10 min to allow primer annealing. RT (2.5 units) was
then added to the mixture in a final volume of 50 µl also containing
20 mM DTT, 0.1 mM deoxynucleotide triphosphates (dNTPS), and RT
reaction buffer. The RT reaction was carried out at 42°C for 45 min
and stored at
20°C until further use. A 1-6 µl aliquot of
the RT reaction was used for PCR amplification. The PCR
reaction mixture included Taq polymerase reaction buffer
(Boehringer-Mannheim, Mannheim, Germany), 2.0 mM MgCl2, 0.1 mM dNTPs, 0.2 mM of forward and reverse primers, and 2.5 U of
Taq polymerase (Boehringer-Mannheim) in a final volume of 50 µl. The primers used for GlyR amplification were as follows: for the
GlyR
1-subunit (predicted product: 599 bp): sense: 5'
ATCATGCAACTGGAAAGCTTTGGT 3', antisense: 5' GATGCCATCCTTGGCTTGCAGGCA 3';
for the GlyR
2-subunit (predicted product: 599 bp):
sense: 5' ATGGATGTCCAGACCTGTACAATG 3', antisense: 5'
GCAGTGACCCATCCCATAACCGCT 3'; for the GlyR
3-subunit
(predicted product: 599 bp): sense: 5' CTGACATTAACACTCTCTTGTCCA 3',
antisense: 5' CTCCAGTGCAAAAGCTTCTGTTTT 3'; for the GlyR
4-subunit (predicted product: 479 bp): sense: 5'
GGTCTGTGTAGCTATCAGTCTTTG 3', antisense: 5'
GGAGATTGGTGTCCACCTGCTTAA 3'; for the GlyR
-subunit (predicted
product: 210 bp): sense: 5' ACGCAGCTAAGAAGAACACTGTGA 3', antisense: 5'
CCAAGTTCCATTGTTGACTTCAATG 3'; for the GAPDH (predicted product: 988 bp): sense: 5' TGAAGGTCGGTGTCAACGGATTTG 3', antisense: 5'
CATGTAGGCCATGAGGTCCACCAC 3'.
RNase protection assay.
A GlyR
-subunit fragment of rat spinal cord cDNA was subcloned into
a plasmid vector and purified using the TOPO TA Cloning Kit
(Invitrogen, Carlsbad, CA) and the Wizard Plus Midipreps DNA purification system (Promega, Madison, WI) as described in the manufacturer's recommendations. The plasmid was linearized with HindIII restriction digest (Roche, Mannheim, Germany) and
transcribed using a T7 RNA polymerase (Promega) to generate a ~175
nucleotides antisense RNA probe (the protected fragment was ~145 bp).
The unprotected 30 bp was due to transcription of the 5' flanking region of the plasmid template. A ~125-nucleotide antisense probe specific for rat GAPDH was used as housekeeping gene (Pharmingen, San
Diego, CA).
| |
RESULTS |
|---|
|
|
|---|
Glycine blocks LPS-induced increases in
[Ca2+]i in Kupffer cells.
[Ca2+]i in cultured Kupffer cells was
determined fluorometrically with the calcium indicator fura-2 as
described in MATERIALS AND METHODS. After the addition of
10 µg/ml LPS, [Ca2+]i levels increased
quickly, reaching ~300 nM in 60 s, followed by a rapid decline
to basal levels within 3-5 min (Fig.
1A). Glycine (1 mM) added 3 min before LPS largely prevented the increase in [Ca2+]i, with values only reaching about
one-third of maximal, confirming previous work by Ikejima et al.
(11). Glycine alone had no measurable effect on
[Ca2+]i (data not shown).
|
Glycine stimulates influx of radiolabeled chloride in Kupffer
cells.
The glycine-gated chloride channel permits the influx of chloride into
cells and hyperpolarizes the plasma membrane (11), preventing LPS-induced increases of [Ca2+]i
(Fig. 1B). Indeed, radiolabeled chloride influx was
stimulated with glycine in a dose-dependent manner with an
EC50 ~100 µM (Fig. 2A). Glycine (1 mM) caused a
significant ~4.5-fold influx of radiolabeled chloride. This effect of
glycine was reduced significantly by the classical glycine-gated
chloride channel antagonist strychnine (Fig. 2B). These data
provide strong pharmacological evidence for the presence of a
glycine-gated chloride channel on Kupffer cells.
|
Antibodies against the glycine-gated chloride channel are
immunoreactive with macrophage/leukocyte membrane protein.
Because pharmacological evidence for the GlyR exists in Kupffer cells
and other macrophages, it was hypothesized that the receptor would be
expressed in the plasma membrane and could be detected by
immunoblotting. The GlyR in the neuronal tissue (brain and spinal cord)
has been successfully detected using a polyclonal antibody
(anti-GlyR-
1) that recognizes regions on
-subunits (
1 and
2) of the receptor
(22). In purified spinal cord and Kupffer cell membranes,
the ~48-kDa
-subunits of the GlyR were detected by Western blot
using the anti-GlyR-
1 antibody (Fig. 3A). In peritoneal neutrophils
and splenic and alveolar macrophages, the ~48-kDa protein was also
detected by immunoprecipitation and Western blot (Fig. 3C).
Because the same antibody was used for immunoprecipitation and Western
blotting, both heavy chain and light chain were observed. Importantly,
the anti-GlyR-
1 antibody reacted with the cell extracts
and is consistent with the hypothesis that a protein similar to the
-subunits of the spinal cord GlyR is present in Kupffer cells,
peritoneal neutrophils, and splenic and alveolar macrophages.
|
Kupffer cells, neutrophils, and other macrophages differently
express
-subunits of the GlyR.
Because proteins for
-subunits for the GlyR exist in macrophages and
leucocytes, RT-PCR for each subtype of the
-subunit was performed to
determine what subunits are expressed in Kupffer cells, peritoneal
neutrophils, and splenic and alveolar macrophages. Because the GlyR is
a pentameric assembly of ligand-binding
-subunits (
1-
4) and a stuctural
-subunit,
PCR primers were designed to amplify an internal region of the
different
-subunits. By using RT-PCR for the
1-subunit, a fragment was generated for Kupffer cells as
predicted from the cloned sequence of the spinal cord GlyR (Fig.
4A). However, no fragment
could be amplified for peritoneal neutrophils, and splenic and alveolar
macrophages. For the
2-subunit, a fragment was generated
from neutrophils, and splenic and alveolar macrophages but not from
Kupffer cells (Fig. 4A). A 479-bp fragment for the
4-subunit was amplified from all investigated
macrophages and neutrophils (Fig. 4A). However, no fragment
for the
3-subunit could be amplified in the cells or in
the spinal cord (data not shown). Also, GAPDH was amplified from all
cells, resulting in 988-bp fragments as predicted from the sequence.
For all fragments genomic contamination was excluded by direct PCR
amplification of the mRNA. Additionally, RT-PCR of Kupffer cell mRNA
for the GlyR
-subunit was performed. The sequence of the cloned
receptor fragment (~550 bp) was >95% homologous to the nucleotide
sequence of GlyR
-subunit from adult rat spinal cord (data not
shown).
|
Macrophages and leukocytes contain RNA for the
-subunit of the
GlyR.
Because of the general structure of the GlyR (pentameric complex)
including almost always the
-subunit, this subunit was chosen for
screening purposes. A cDNA fragment from the spinal cord GlyR
-subunit was subcloned into a plasmid containing bacteriophage promoters and used as a template in a RNase protection assay. For
internal control and quantification, a template for a housekeeping gene, GAPDH, was used. RNase protection assay from RNA of Kupffer cells, splenic macrophages, alveolar macrophages, and neutrophils showed the predicted GlyR template fragment (Fig. 4B)
demonstrating the existence of GlyR RNA for the
-subunit in all cell
types studied. Hepatocytes (negative control) did not exhibit signals (data not shown).
| |
DISCUSSION |
|---|
|
|
|---|
Anti-inflammatory actions of glycine.
Glycine, a well-known inhibitory neurotransmitter in the spinal cord
(23), exerts its inhibitory actions by binding its receptor (GlyR), which is largely localized in postsynaptic neuronal membranes (2). The amino acid hyperpolarizes the plasma
membrane through a glycine-gated chloride channel and opposes
excitatory postsynaptic potentials (23). Glycine has been
investigated in several extraneuronal experimental models (see Table
1) and has been shown to be effective in
liver in reperfusion injury (39), survival after
transplantation (26) or alcohol-induced injury
(9). In the lung, prevention of injury and a reduction of
inflammation by glycine were demonstrated in an endotoxin shock model
(31). In the kidney, cyclosporin A-induced nephrotoxicity could be prevented (38). Furthermore, Yang et al.
(34) reported increased survival after glycine in a sepsis
model. The beneficial effects of glycine in these different
inflammatory disease states are thought to result from a unique
mechanism of decreasing cell signaling and production of cytokines,
such as TNF-
(30). However, inhibitory effects of
glycine on cell signaling mechanisms support the existence of a
glycine-gated chloride channel (see below).
|
Pharmacological evidence for a glycine-gated chloride channel in Kupffer cells. Recent pharmacological evidence has been presented supporting the hypothesis that a wide variety of cells, such as neutrophils (32), alveolar macrophages (33), endothelial cells, and Kupffer cells (11) contain glycine-gated chloride channels. Kupffer cells are activated by the LPS-LBP complex through a cell surface receptor involving CD14 and TLR-4 to cause a transient increase in [Ca2+]i (Fig. 1A). The production of cytokines depends on this increase in Ca2+ (Fig. 1B). The LPS-induced Ca2+ influx can be blunted by 60% in the presence of glycine (Fig. 1A) is reversed by low concentrations of strychnine, an antagonist to the GlyR in the central nervous system (7, 37). Therefore, it was hypothesized that Kupffer cells contain a glycine-gated chloride channel that blocks activation by blunting the increase in [Ca2+]i by hyperpolarization through an influx of extracellular chloride (Fig. 1B). Indeed, it is demonstrated that glycine stimulates chloride uptake in Kupffer cells in a dose-dependent manner (Fig. 2, A and B) consistent with studies in other macrophages and leukocytes (31, 32). Nevertheless, it is most likely that Ca2+ influx will not be completely inhibited by activation of the GlyR, because many other receptor/signaling mechanisms exist. Thus full inhibition of influx of Ca2+ (Fig. 1A) in the presence of glycine may not be expected.
Molecular evidence for a glycine-gated chloride channel in
macrophages and leucocytes.
Molecular evidence for a glycine-gated chloride channel in Kupffer
cells and other macrophages is provided here, for the first time, using
Western blotting, RT-PCR, and RNase protection assay (Figs. 3 and 4).
Therefore, it is concluded that the GlyR is expressed in these cells.
The molecular mass of the protein detected in the Kupffer cells (~48
kDa) as well as in neutrophils and splenic and alveolar macrophages is
identical with the 48-kDa size of the
-subunits of the spinal cord
GlyRs (Fig. 3). Because of the known cross-reactivity of the primary
antibody among the GlyR
-subunit family (especially
1
and
2), RT-PCR with the use of specific primers for the
different
-subunits (
1-
4) was
performed to address which subunits were present in these cells. The
molecular weight of the amplified RT-PCR product from Kupffer cells
mRNA were as predicted for the GlyR
1-subunit (Fig.
4A). Kupffer cells primarily express the
1-subunit (Fig. 4A), which is one of the primary
-subunit isoforms expressed in adult rats, whereas other inflammatory cells contain different isoforms (e.g., splenic
macrophages primarily express the
2-subunit). These
findings suggest that GlyR
-subunit heterogeneity exists within the
monocyte/macrophage cell lineage population, possibly creating a
functional diversity between these cells. Importantly, recent studies
demonstrated that long-term glycine exposure blunts activation of
alveolar macrophages and neutrophils but not of Kupffer cells
(31), possibly suggesting differences in the GlyR subunit
leading to differential regulation of desensitization. Specifically,
long-term dietary glycine downregulates chloride channel function not
only in Kupffer cells but also in neuronal tissue (1),
which depends on phosphorylation of the
-subunit (25).
Importantly, no expression for the GlyR
3-subunit was
observed in Kupffer cells, peritoneal neutrophils, or splenic or
alveolar macrophages (data not shown) consistent with the finding that
the
3-subunit is only expressed in low levels
in adult tissue (12). Interestingly, expression of the GlyR
4-subunit was detected in Kupffer cells,
neutrophils, and splenic and alveolar macrophages (Fig. 4A)
but not in the spinal cord of rats. Finally, based on the fact that
most adult GlyR contains the
-subunit (21), an
antisense probe for the
-subunit was generated to be used in RNase
protection assay as a screening method. Indeed, the
-subunit mRNA
was detected in Kupffer cells, splenic macrophages, neutrophils, and
alveolar macrophages (Fig. 4B). In conclusion, these data
along with previously published data provide molecular and
pharmacological evidence that Kupffer cells and several inflammatory
cells express a GlyR to the channel expressed in neuronal tissues.
Clinical implications. Based on the beneficial effects of glycine in different organs, such as liver (9, 10, 26, 35, 39), lung (31) and kidney (15, 38) in several different disease states including endotoxin-induced shock (10, 31), alcoholic hepatitis (9, 35), and sepsis (see Table 1), it is reasonable to propose that glycine would be useful in the treatment of many inflammatory diseases in humans. It could be given in the diet, and it is not toxic, making glycine potentially useful in a wide variety of inflammatory processes where macrophages or leucocytes are involved. Clinical trials are needed to help support or reject this hypothesis.
| |
ACKNOWLEDGEMENTS |
|---|
This work was supported, in part, by grants from the National Institue on Alcohol Abuse and Alcoholism.
| |
FOOTNOTES |
|---|
Address for reprint requests and other correspondence: M. D. Wheeler, University of North Carolina at Chapel Hill, Dept. of Pharmacology, 1124 Mary Ellen Jones Bldg., Chapel Hill, NC 27599-7365 (E-mail: wheelmi{at}med.unc.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
June 12, 2002;10.1152/ajpgi.00503.2001
Received 27 November 2001; accepted in final form 29 May 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Akaike, N,
and
Kaneda M.
Glycine-gated chloride currents in acutely isolated rat hypothalamic neurons.
J Neurophysiol
62:
1400-1408,
1989
2.
Araki, T,
Ito M,
and
Oscarsson O.
Anion permeability of the synaptic and non-synaptic motoneurone membrane.
J Physiol
159:
410-435,
1961
3.
Bachmann, S,
Caldwell-Kenkel JC,
Currin RT,
Tanaka Y,
Takei Y,
Marzi I,
and
Thurman RG.
Ultrastructural correlates of liver graft failure from storage injury: studies of graft protection by Carolina rinse solution and pantoxifylline.
Transplant Proc
25:
1620-1624,
1993[ISI][Medline].
4.
Betz, H,
Langosch D,
Hoch W,
Prior P,
Pribilla I,
Kuhse J,
Schmieden V,
Malosio ML,
Matzenbach B,
Holzinger F,
Kuryatov A,
Schmitt B,
Maulet Y,
and
Becker CM.
Structure and expression of inhibitory glycine receptors.
In: Neuroreceptor Mechanisms in Brain, edited by Kito S.. New York: Plenum, 1991, p. 421-429.
5.
Bhat, M,
Rojanasakul Y,
Weber SL,
Ma JYC,
Castranova V,
Banks DE,
and
Ma JKH
Fluromicroscopic studies of bleomycin-induced intracellular oxidation in alveolar macrophages and its inhibition by taurine.
Environ Health Perspect
102, Suppl10:
91-96,
1994.
6.
Chensue, SW,
Terebuh PD,
Remick DG,
Scales WE,
and
Kunkel SL.
In vivo biologic and immunohistochemical analysis of interleukin-1 alpha, beta and tumor necrosis factor during experimental endotoxemia: kinetics, Kupffer cell expression, and glucocorticoid effects.
Am J Pathol
138:
395-402,
1991[Abstract].
7.
Curtis, DR.
The depression of spinal inhibition by electrophoretically administered strychnine.
Int J Neuropharmacol
1:
239-250,
1962[ISI].
8.
Gilman, M.
Ribonuclease protection assay.
In: Current Protocols in Molecular Biology, edited by Ausubel FM,
Brent R,
Kingston RE,
Moore DD,
Seiman JG,
Smith JA,
and Stuhl K.. New York: Wiley, 1999, p. 4.7.1-4.7.8.
9.
Iimuro, Y,
Bradford BU,
Forman DT,
and
Thurman RG.
Glycine prevents alcohol-induced liver injury by decreasing alcohol in the stomach.
Gastroenterology
110:
1536-1542,
1996[ISI][Medline].
10.
Ikejima, K,
Iimuro Y,
Forman DT,
and
Thurman RG.
A diet containing glycine improves survival in endotoxin shock in the rat.
Am J Physiol Gastrointest Liver Physiol
271:
G97-G103,
1996
11.
Ikejima, K,
Qu W,
Stachlewitz RF,
and
Thurman RG.
Kupffer cells contain a glycine-gated chloride channel.
Am J Physiol Gastrointest Liver Physiol
272:
G1581-G1586,
1997
12.
Kuhse, J,
Schmieden V,
and
Betz H.
Identification and functional expression of a novel binding subunit of the inhibitory glycine receptor.
J Biol Chem
265:
22317-22320,
1990
13.
Lindén, O,
Dohlsten M,
Boketoft Å,
Hedlund G,
and
Sjögren HO.
Catalase and lipopolysaccharide enhance proliferation in the rat mixed lymphocyte reaction.
Scand J Immunol
26:
223-228,
1987[ISI][Medline].
14.
Lowry, OH,
Rosebrough NJ,
Farr AL,
and
Randall RJ.
Protein measurement with the Folin phenol reagent.
J Biol Chem
193:
265-275,
1951
15.
Miller, GW,
Lock EA,
and
Schnellmann RG.
Strychnine and glycine protect renal proximal tubules from various nephrotoxicants and act in the late phase of necrotic cell injury.
Toxicol Appl Pharmacol
125:
192-197,
1994[ISI][Medline].
16.
Miller, GW,
and
Schnellmann RG.
A putative cytoprotective receptor in the kidney: relation to the neuronal strychnine-sensitive glycine receptor.
Life Sci
55:
27-34,
1994[ISI][Medline].
17.
Morrow, AL,
and
Paul SM.
Benzodiazepin enhancement of gamma-aminobutyric acid mediated Cl
ion flux in rat brain synaptoneurosomes.
J Neurochem
50:
302-306,
1988[ISI][Medline].
18.
Nolan, JP,
Leibowitz A,
and
Vladatin AL.
Influence of alcohol on Kupffer cell function and possible significance in liver injury.
In: The Reticuloendothelial System and Pathogenesis of Liver Disease, edited by Liehr H,
and Green M.. Amsterdam, The Netherlands: Elsevier, 1980, p. 125-136.
19.
Ogle, CK,
Jun-Zhen W,
Xialing M,
Szczur K,
Alexander W,
and
Ogle JD.
Heterogeneity of Kupffer cell and splenic, alveolar and peritoneal macrophages for the production of TNF, IL-1, and IL-6.
Inflammation
18:
511-523,
1994[ISI][Medline].
20.
Pertoft, H,
and
Smedsrod B.
Separation and characterization of liver cells.
In: Cell Separation: Methods and Selected Applications, , edited by Pretlow TG II,
and Pretlow TP.. New York: Academic, 1987, vol. 4, p. 1-24.
21.
Pfeiffer, F,
and
Betz H.
Solubilisation of the glycine receptor from the rat spinal cord.
Brain Res
226:
273-279,
1981[ISI][Medline].
22.
Pfeiffer, F,
Simler R,
Grenningloh G,
and
Betz H.
Monoclonal antibodies and peptide mapping reveal structural similarities between the subunits of the glycine receptor of rat spinal chord.
Proc Natl Acad Sci USA
81:
7224-7227,
1984
23.
Rajendra, S,
Lynch JW,
and
Schofield PR.
The glycine receptor.
Pharmacol Ther
73:
121-146,
1997[ISI][Medline].
24.
Rose, ML,
Madren J,
Bunzendahl H,
and
Thurman RG.
Dietary glycine inhibits the growth of B16 melanoma tumors in mice.
Carcinogenesis
20:
793-798,
1999
25.
Ruiz-Gomez, A,
Vaello ML,
Valdivieso F,
and
Mayor F, Jr.
Phosphorylation of the 48-kDa subunit of the glycine receptor by protein kinase C.
J Biol Chem
266:
559-566,
1991
26.
Schemmer, P,
Bradford BU,
Rose ML,
Bunzendahl H,
Raleigh JA,
Lemasters JJ,
and
Thurman RG.
Intravenous glycine improves survival in rat liver transplantation.
Am J Physiol Gastrointest Liver Physiol
276:
G924-G932,
1999
27.
Schwartz, RD,
Paul SM,
and
Majewska MD.
Factors modulating the sensitivity of a GABA-gated chloride channel.
Clin Neuropharmacol
9:
389-391,
1986.
28.
Spittler, A,
Reissner CM,
Oehler JR,
Gornikiewicz A,
Gruenberger T,
Manhart N,
Brodowicz T,
Mittlboeck M,
Boltz-Nitulescu G,
and
Roth E.
Immunomodulatory effects of glycine on LPS-treated monocytes: reduced TNF-
production and accelerated IL-10 expression.
FASEB J
13:
563-571,
1999
29.
Venkatachalam, MA,
Weinberg JM,
Patel Y,
Saikumar P,
and
Dong Z.
Cytoprotection of kidney epithelial cells by compounds that target amino acid chloride channels.
Kidney Int
49:
449-460,
1996[ISI][Medline].
30.
Wheeler, MD,
Ikejima K,
Enomoto N,
Stachlewitz RF,
Seabra V,
Zhong Z,
Yin M,
Schemmer P,
Rose ML,
Rusyn I,
Bradford BU,
and
Thurman RG.
Glycine: a new anti-inflammatory immunonutrient.
Cell Mol Life Sci
56:
843-856,
1999[ISI][Medline].
31.
Wheeler, MD,
Rose ML,
Yamashima S,
Enomoto N,
Seabra V,
Madren J,
and
Thurman RG.
Dietary glycine blunts lung inflammatory cell influx following acute endotoxin.
Am J Physiol Lung Cell Mol Physiol
279:
L390-L398,
2000
32.
Wheeler, MD,
Stachlewitz RF,
Ikejima K,
Morrow AL,
Ikejima K,
and
Thurman RG.
Glycine-gated chloride channels in neutrophils attenuate calcium influx and superoxide production.
FASEB J
14:
476-484,
2000
33.
Wheeler, MD,
and
Thurman RG.
Production of superoxide and TNF-
from alveolar macrophages is blunted by glycine.
Am J Physiol Lung Cell Mol Physiol
277:
L952-L959,
1999
34.
Yang, S,
Koo DJ,
Chaudry IH,
and
Wang P.
Glycine attenuates hepatocellular depression during early sepsis and reduces sepsis-induced mortality.
Crit Care Med
29:
1201-1206,
2001[ISI][Medline].
35.
Yin, M,
Ikejima K,
Arteel GE,
Seabra V,
Bradford BU,
Kono H,
Rusyn I,
and
Thurman RG.
Glycine accelerates recovery from alcohol-induced liver injury.
J Pharmacol Exp Ther
286:
1014-1019,
1998
36.
Yin, M,
Rusyn I,
Schoonhoven R,
Graves LM,
Rusyn EV,
Li X,
Li F,
Cox AD,
Harding TW,
Bunzendahl H,
Swenberg JA,
and
Thurman RG.
Inhibition of chronic rejection of aortic allografts by dietary glycine.
Transplantation
69:
773-780,
2000[ISI][Medline].
37.
Young, AB,
and
Snyder SH.
Strychnine binding associated with glycine receptors of the central nervous system.
Proc Natl Acad Sci USA
70:
2832-2836,
1973
38.
Zhong, Z,
Connor HD,
Yin M,
Moss N,
Mason RP,
Bunzendahl H,
Forman DT,
and
Thurman RG.
Dietary glycine and renal denervation prevents cyclosporin A-induced hydroxyl radical production in rat kidney.
Mol Pharmacol
56:
455-463,
1999
39.
Zhong, Z,
Jones S,
and
Thurman RG.
Glycine minimizes reperfusion injury in a low-flow, reflow liver perfusion model in the rat.
Am J Physiol Gastrointest Liver Physiol
270:
G332-G338,
1996
This article has been cited by other articles:
![]() |
K. Lubick, M. Radke, and M. Jutila Securinine, a GABAA receptor antagonist, enhances macrophage clearance of phase II C. burnetii: comparison with TLR agonists J. Leukoc. Biol., November 1, 2007; 82(5): 1062 - 1069. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Stuckey, D. C. Anthony, J. P. Lowe, J. Miller, W. M. Palm, P. Styles, V. H. Perry, A. M. Blamire, and N. R. Sibson Detection of the inhibitory neurotransmitter GABA in macrophages by magnetic resonance spectroscopy J. Leukoc. Biol., August 1, 2005; 78(2): 393 - 400. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. W. Lynch Molecular Structure and Function of the Glycine Receptor Chloride Channel Physiol Rev, October 1, 2004; 84(4): 1051 - 1095. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |