|
|
||||||||
1 Surgical Oncology Research Laboratories, Department of Surgery and 2 Pediatric Endocrinology, Massachusetts General Hospital and Harvard Medical School, Boston, Massachusetts 02114; and 3 Department of Biology, Saint Louis University, St. Louis, Missouri 63103 - 2010
| |
ABSTRACT |
|---|
|
|
|---|
Human hepatoma cells take up glutamine at rates severalfold faster than the system N-mediated transport rates observed in normal human hepatocytes. Amino acid inhibition, kinetic, Northern blotting, RT-PCR, and restriction enzyme analyses collectively identified the transporter responsible in six human hepatoma cell lines as amino acid transporter B0 (ATB0), the human ortholog of rodent ASCT2. The majority of glutamine uptake in liver fibroblasts and an immortalized human liver epithelial cell line (THLE-5B) was also mediated by ATB0. The 2.9-kb ATB0 mRNA was equally expressed in all cell lines, whereas expression of the system A transporters ATA2 and ATA3 was variable. In contrast, the system N isoforms (SN1 and SN2) were expressed only in well-differentiated hepatomas. ATB0 mRNA was also expressed in cirrhotic liver and adult and pediatric liver cancer biopsies but was not detectable in isolated human hepatocytes or fetal liver. Although the growth of all hepatomas was glutamine dependent, competitive inhibition of ATB0-mediated glutamine uptake blocked proliferation only in poorly differentiated cells lacking SN1 or SN2 expression and exhibiting low glutamine synthetase mRNA levels.
amino acid transporter B0; ASCT2; SN1; SN2; hepatocellular carcinoma; transport; system A
| |
INTRODUCTION |
|---|
|
|
|---|
WHETHER OBSERVED CLINICALLY or experimentally, the transformation of cells to a cancerous phenotype is often associated with cognate changes in the transport and metabolism of nutrients such as glucose and glutamine (4, 37). Glutamine serves as the primary ammonia shuttle between tissues and as a major carbon and nitrogen source for many tumors (39), whereas the liver serves as the major regulatory center for whole body ammonia detoxification and glutamine homeostasis (26, 40). This regulatory role is subverted on hepatocellular transformation when glutamine consumption often prevails (8), an observation underscored clinically by lower plasma levels of this amino acid in liver cancer patients (29). Similarly, depressed glutamine synthetase rates with concomitantly augmented glutamine oxidation and glutaminase rates have been reported in human hepatomas compared with normal livers (9, 36, 37). Indeed, the observation that many tumor cells exhibit enhanced rates of glutamine metabolism has led to the testing of glutamine analogs as anticancer agents (2).
It has been recognized that the transport of glutamine across the plasma membrane of liver cells may represent a rate-limiting step in its metabolism, especially when intracellular catabolism is accelerated (27, 33). In normal rat and human hepatocytes, glutamine transport is predominantly mediated by an Na+-dependent transporter with narrow substrate specificity (glutamine, histidine, and asparagine) termed system N (6, 32). Two separate genes encoding for this activity, termed SN1 and SN2, have recently been isolated (19, 42). Previously, the initial-rate transport of glutamine in three human hepatoma cell lines (SK-Hep, HepG2, and Huh-7) was functionally examined and found to exceed rates in normal human hepatocytes by 10- to 30-fold, due to the expression of a distinct higher affinity Na+-dependent carrier with characteristics of system ASC (6, 9). A cDNA was subsequently isolated that encodes for a broad specificity Na+-dependent glutamine transporter, termed amino acid transporter B0 (ATB0) (30, 31), whose properties match those previously reported for the system ASC-like hepatoma activity. Recent studies suggested that this system ASC activity may govern glutamine-dependent growth in the SK-Hep human hepatoma cell line (7). On the basis of these results, the hypothesis evolved that system ASC expression may be an integral event in human hepatocellular transformation. The studies presented here were therefore designed to determine the ubiquity of system ASC-mediated glutamine transport in proliferating liver cells, to identify the gene responsible for this activity, and to determine its utility in hepatocellular growth.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Cell Lines. The human hepatoma cell lines used in these studies were PLC/PRF/5 (34), SK-Hep (20), Hep3B (ATCC, Rockville, MD) (1), Huh-7 [from Dr. J. Liang, Massachusetts General Hospital (MGH)] (41), FOCUS (from Molecular Hepatology Laboratories, MGH Cancer Center) (28), and the hepatoblastoma HepG2 (1), also from ATCC. A nontumorigenic human liver epithelial cell line termed THLE-5B was generated by immortalization with SV40 virus and was kindly provided by Dr. C. Harris at the National Cancer Institute (45). The JAR-1 human choriocarcinoma cell line, from which the ATB0 cDNA was originally isolated, was obtained from ATCC. All cells were maintained in DMEM (4.5 mg/ml D-glucose) + 2 mM L-glutamine, 100 units/ml penicillin G, 100 µg/ml streptomycin, and 10% FBS (all from Gibco-BRL, Gaithersburg, MD).
Human liver tissue. The normal, cirrhotic, and cancerous human liver tissue used for RNA analysis in these studies was from archived cryopreserved biopsies previously obtained from patients undergoing gastrointestinal surgery, as per the guidelines approved by the MGH Human Studies Committee and Institutional Review Board. Primary human hepatocytes were isolated as previously described in detail from freshly discarded pathological specimens (6). Primary human adult and fetal liver fibroblasts were isolated from primary cultures of liver cells after maintenance in the presence of 10% FBS. After 7-10 days, the fibroblasts overgrew the culture and were serially passaged by trypsinization. The fibroblasts were used between passages 3 and 10 in these studies. The primary hepatoblastoma sample was obtained from the MGH tumor bank. The fetal human liver RNA blot was kindly provided by Dr. D. Rhoads. A commercially available human liver cancer RNA blot (Northern Territory) was obtained from Invitrogen (Carlsbad, CA).
Glutamine transport assays. Measurement of initial-rate glutamine uptake was carried out via the cluster-tray method originally described by Gazzola et al. (21) as reported previously (6, 9). Briefly, after trypsinization, hepatoma cells were plated at a density of 1 × 105 cells/well in 24-well culture plates (Costar, Cambridge, MA) and allowed to grow to >80% confluence, typically 1-2 days later. For initial-rate measurements, the radiotracer used was L-[G-3H]glutamine (Amersham, Arlington Heights, IL) at 4 µCi/ml in the presence of unlabeled L-glutamine at 50 µM. For kinetic studies, the amount of unlabeled glutamine in the transport buffer varied from 10 µM to 10 mM. All transport measurements were carried out at 37°C and were terminated after 30 s by three rapid washes with an ice-cold phosphate-buffered saline solution. Intracellular radiolabeled glutamine was extracted with 0.2 ml/well of 0.2% SDS and 0.2 N NaOH; after 1 h, 0.1 ml of the lysate was neutralized with 10 µl 2 N HCl and subjected to scintillation spectrophotometry in a Packard TopCount (Packard Instruments, Meriden, CT). The remaining lysate was used for the determination of cellular protein by the bicinchoninic acid method (Pierce Chemical, Rockford, IL). Rates of glutamine transport were calculated from the counts per minute (cpm) per sample, the specific activity of the uptake mix (in cpm/nmol), and normalized to cellular protein content in a Microsoft Excel spreadsheet program. Transport values obtained in the absence of extracellular Na+ (diffusion and Na+-independent uptake) were subtracted from those in the presence of Na+ (total uptake) to yield Na+-dependent rates that are reported in units of nanomoles per milligram protein per 30 s. All transport values depicted are the average ± SD of four separate determinations. Kinetic analysis of Eadie-Hofstee linearized transport data (V vs. V/[L-GLN]) was performed by regression analysis (Cricket Graph, Computer Associates, Islandia, NY). Nonlinear regression analysis was performed with DataDesk (Data Description, Ithaca, NY) and Excel for two component Michaelis-Menten kinetics: V = [(Vmax1 × S)/(Km1 + S) + (Vmax2 × S)/(Km2 + S)], where V is velocity, Vmax is maximum velocity, and S is glutamine concentration (in mM).
Glutamine-dependent growth. Cells were plated in 96-well tissue culture plates (Falcon Labware, Franklin Lakes, NJ) at a density of 2 × 103 cells/cm2. The following day, the cells were rinsed once and repleted with DMEM + 10% dialyzed FBS (dFBS)+ 0, 0.05, 0.10, 0.15, 0.2, 0.4, 0.6, 0.8, 1.0, or 2.0 mM L-glutamine, with media changes every 48 h thereafter. In a subset of experiments designed to test the role of system ASC/B0-mediated glutamine uptake in cellular proliferation, cells were grown in DMEM + 10% dFBS containing 0, 0.5, or 2.0 mM L-glutamine ± a collective 20 mM excess of system ASC substrates alanine, serine, and threonine (6.7 mM each). At specific times over 7 days, the relative cell number per well was determined by the 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide colorimetric assay (Sigma, St. Louis, MO) on a platereader (Anthos Labtec, Frederick, MD) at a wavelength of 550 nm with a 650-nm reference filter. Relative growth rates were evaluated graphically with optical density as a function of time (days).
RNA isolation and Northern blot procedure. Total cellular RNA was isolated from cultured cells or frozen tissue by the one-step acid-phenol guanidinium procedure (13) using Trisolve reagent (Biotecx, Houston, TX), subsequent treatment with RQ1 RNase-free DNase-I (Promega, Madison, WI), followed by an additional acid-phenol, phenol/chloroform/isoamyl alcohol, chloroform extraction, and ethanol precipitation in the presence of sodium acetate. Equal amounts of total RNA (20 µg), as determined both spectrophotometrically and through ethidium bromide staining, were fractionated by electrophoresis through denaturing 1% agarose gels containing 0.2 M formaldehyde, transferred to nylon membranes by capillary action and ultraviolet cross-linked to the membrane.
The DNA templates used in this study were full-length human ATB0 [hATB0, 2.9-kb EcoR I insert (30)]; human SN1, 2.4-kb insert (19); and human ATA2, 4.5-kb insert (25); all in pSPORT1 and kindly provided by Dr. V. Ganapathy. Human albumin [pILMALB, 1.8-kb EcoR I/Hind III fragment;
-fetoprotein (AFP;
pHAF7), 492-bp Pst I fragment; IGF-II (phins311), 8.6-kb
EcoR I genomic DNA insert; and glutamine synthetase (GS)
HIBBA40, 2.7-kb Hind III/Not I insert] were also
used and were all obtained from ATCC. The inserts containing primarily
coding sequence were excised from the plasmids with appropriate
restriction enzymes, separated on agarose gels, excised, eluted, and
used as templates to generate
-[32P]dCTP-labeled
probes using a random primer labeling kit (Megaprime, Amersham)
according to the manufacturer's protocol. Hybridization with random
hexamer-generated radiolabeled DNA probes was performed overnight at
65°C in 5× sodium chloride-sodium phosphate-EDTA (SSPE) with 7.5×
Denhardt's reagent +0.5% SDS and 0.1 mg/ml sheared herring sperm DNA,
after incubating the membrane for 2 h under the same conditions.
Two of the DNA templates used in this study, human SN2
(42) and human ATA3 (23), were generated by
RT-PCR from human liver RNA and engineered to contain SP6 sites
(5'AATTTAGGTGACACTATAGA3') in the 3' termini for generation of
riboprobe as described below. A 302-bp human SN2 cDNA representing
bases 3-304 of the coding sequence was generated using a sense
primer (5'GGAACTGCAGGATCCAAAGA3') and antisense primer
(5'AGGTCAGCAGGAGGTGGATG3'). Likewise, a 303-bp human ATA3 cDNA
representing bases 1-303 of the coding sequence was generated
using sense (5'ATGGATCCCATGGAACTGAG3') and antisense (5'GGCCATGGCATAGGACAAGC3') primers. Products of the expected size were
obtained and verified by restriction endonuclease analysis. Riboprobes
from PCR-generated and full-length cDNAs were generated using the
Maxiscript SP6 kit from Ambion (Austin, TX) and
-[32P]UTP (Amersham). Ultra-Hyb (Ambion) at 72°C was
used in blots hybridized with riboprobe.
In all experiments, blots were washed under high stringency conditions
(0.1× SSPE + 0.5% SDS at hybridization temperature), and
autoradiographic detection of the hybridization was achieved by
exposure of Fuji Medical X-ray film at
80°C. In some experiments, the hybridized probe was stripped off the membrane by boiling in 0.1%
SDS and the blots reutilized for the Northern analyses of other genes.
Where indicated, band intensities were quantified using the Kodak EDAS
290 system with one-dimensional image analysis software (Eastman Kodak,
New Haven, CT).
RT-PCR and restriction enzyme analyses. ATB0 expression in individual cells and tissues was confirmed by RT-PCR and subsequent digestion with Sal I or Rsa I as described by Kekuda et al. (31). The Perkin-Elmer GeneAmp kit was used according to the manufacturer's instructions. The upstream primer was 5'CCGCTGATGATGAAGTCG3', and the downstream primer was 5'CCCCCGATAGTGTTTGAG3', which encompass nucleotides 1691-2197 of the hATB0 cDNA, yielding an expected amplification product of 507 bp. The RT-PCR reaction was carried out on RNA samples previously treated with RQ1 RNase-free DNase according to the manufacturer's instructions (Promega). RNA (1 µg) was primed with oligo(dT), reverse transcribed, and subjected to 25 rounds of amplification (94°C/30 s, 60°C/30 s, 68°C/30 s for denaturation, annealing, and extension steps, respectively). The RT-PCR products were isolated from the reaction by QIAquick PCR purification kits (Qiagen, Santa Clarita, CA) before analytical endonuclease digestion. The expected Sal I digestion products were 277, 191, and 39 bp, and those for Rsa I are 330, 114, and 63 bp. All restriction enzymes were from Promega. The absence of RT in the reaction served as a negative control for all samples.
Statistical analysis. Differences in specific measured parameters were evaluated for statistical significance by paired t-test (Microsoft Excel) and were considered significant when P < 0.050.
| |
RESULTS |
|---|
|
|
|---|
Glutamine transport.
In all cell lines examined, 90% or greater of glutamine uptake was
Na+ dependent: Hep3B, 90%; FOCUS, 92%; PLC/PRF/5, 95%;
THLE-5B, 99%. Initial rate Na+-dependent transport
velocities for 50 µM L-glutamine was determined in the
three additional human hepatoma cell lines, and the results are shown
in Fig. 1. Markedly enhanced rates
(0.77-1.01 nmol · mg protein
1 · 30 s
1) were again observed compared with values for normal
adult and fetal human hepatocytes [0.075-0.15 and 0.36-0.44
nmol · mg protein
1 · 30 s
1,
respectively (6)]. Transport velocities were higher
(P < 0.010) in the nontumorigenic SV40-immortalized
human liver epithelial THLE-5B cell line (3.33 ± 0.16) vs. the
FOCUS (0.83 ± 0.13), Hep3B (1.01 ± 0.22), and PLC/PRF/5
(0.77 ± 0.10 nmol · mg
protein
1 · 30 s
1). The glutamine
concentration used in these assays not only allowed the measurement of
initial-rate transport values but also tested the ability of each line
to take up low extracellular levels of this amino acid. When the
transport of glutamine at physiological levels (500 µM) was measured
in each of the lines, the results were qualitatively similar (data not
shown).
|
-(methylamino)isobutyric acid (MeAIB), which failed to
significantly inhibit glutamine uptake in all cell lines except the
THLE-5B, in which it diminished uptake by 29% (P < 0.050). It should be noted that extensive depletion of intracellular
amino acid pools was not performed before transport measurements in these studies, because we sought to assess glutamine uptake under more
physiological conditions. As a result, low-affinity transinhibitable systems, such as system A, may not be operative or detectable under
these conditions even when expressed (see molecular analyses below).
Subsequent molecular studies (described in Northern analysis of
GS and other glutamine transporters) revealed that more
than one potential glutamine transporter was expressed in most cell lines however. Therefore, two-component nonlinear regression analyses were performed on the Na+-dependent transport kinetic data,
where they were adequately resolved into high- and low-affinity
components in all cell lines under study. The results are graphically
depicted in Fig. 1, insets. The Hep3B low-affinity system
exhibited a calculated Km of 1.0 mM and
Vmax of 4.5 nmol · mg
protein
1 · 30 s
1, whereas the
high-affinity system had a derived Km of 90 µM
and a Vmax of 3.0 nmol · mg
protein
1 · 30 s
1 (Fig.
1B). The PLC/PRF/5 low-affinity system was determined to possess a Km of 775 µM and
Vmax of 3.9 nmol · mg
1
protein · 30 s
1, while the high affinity system
exhibited a derived Km of 23 µM and a
Vmax of 0.82 nmol · mg
protein
1 · 30 s
1 (Fig.
1D). For FOCUS, the low-affinity system had a
Km of 1.2 mM and a Vmax
of 2.7 nmol · mg protein
1 · 30 s
1, and the high-affinity component possessed a
Km of 122 µM with a
Vmax of 2.2 nmol · mg
protein
1 · 30 s
1 (Fig.
1C). For THLE-5B, the low-affinity component exhibited a
Km of 1.3 mM and a Vmax
of 32.6 nmol · mg protein
1 · 30 s
1, whereas the high-affinity component had a
Km of 135 µM and a Vmax
of 30.8 nmol · mg protein
1 · 30 s
1 (Fig. 1A). Previous studies showed that the
Huh-7 cell line took up glutamine primarily by system ASC based on
amino acid inhibition profiles (9), so those results are
not shown again. However, the kinetic analysis here revealed two
resolvable components in this cell line with Kms
of 50 and 861 µM and Vmax values of 7.3 and
11.7 nmol · mg protein
1 · 30 s
1 for the high- and low-affinity components,
respectively. The high-affinity component in all cases is assumed to be
system ASC based on the amino acid inhibition data and previously
reported kinetic constants for this transporter (6, 9, 14, 15, 30, 31), whereas the low-affinity components are more difficult to distinguish given that the system A and N isoforms isolated and
characterized to date all possess similar affinities for glutamine in
the high micromolar and low millimolar ranges (19, 23, 25,
42). Possibilities for each cell line will be offered discussion
based on the molecular analyses described below.
Finally, on the basis of the derived kinetic constants listed above, it
was calculated that the high-affinity component (system ASC) mediates
>80% of glutamine uptake at initial-rate concentrations (50 µM) and
60-70% of uptake at physiological concentrations (600 µM) for
all of the cell lines under study.
Northern blot analysis of ATB0.
A cDNA encoding for a transporter with nearly identical characteristics
as the system ASC activity described here was previously isolated from
a human placental choriocarcinoma library (30). This gene
was termed ATB0, for the transport activity
designated as system B0, originally described in intestinal
epithelial cells (49) and in renal epithelia
(16) and otherwise identical to what has been termed
system ASC in other cells and tissues (6, 9, 14, 15).
Northern blot analysis with the human ATB0 cDNA-generated
probe corroborated the results obtained in the amino acid inhibition
profiles and kinetic studies (Fig. 2). A single mRNA species at ~2.9 kb was detected in all six human hepatoma lines under study and in THLE-5B but not in normal human hepatocytes. The 2.9-kb mRNA size and lack of detectable expression in the liver are
consistent with results obtained in the original isolation of this cDNA
(30). Also illustrated in Fig. 2 is the independence of
ATB0 expression from the differentiation state of the cell
line, as both AFP- or albumin-positive and -negative cells express this transporter gene. Moreover, this transporter gene was expressed independent of IGF-II, an oncofetal hormone hypothesized to play a role
in hepatocarcinogenesis (46).
|
RT-PCR analysis of ATB0 expression.
The RT-PCR analysis shown in Fig. 3
confirms that the 2.8-kb mRNA species obtained in Northern blot
analysis was indeed ATB0. RNA isolated from the six
hepatoma cell lines, THLE-5B, and JAR-1 [the choriocarcinoma cell line
from which the ATB0 cDNA was isolated (30)]
yielded the expected 507-bp RT-PCR product, which, in turn, produced
the anticipated 277-, 191-, and 39-bp products on digestion with
Sal I and 330-, 114-, and 63-bp products on digestion with
Rsa I (not shown). When combined with the Northern blot
analyses, the data indicate that the ATB0 gene
product probably underlies the relatively high system ASC glutamine
uptake rates in human hepatoma and immortalized liver epithelial cells
compared with adult and fetal hepatocytes. Accordingly, we will
hereafter refer to the cognate activity as
"ASC/B0"-mediated transport.
|
Expression of ATB0 in clinical liver and liver tumor
biopsies.
All studies to this point had been carried out in human liver cancer
cell lines, but we wanted to assess whether the
ATB0 gene was expressed in human liver tumors in
vivo. To this end, Northern blot analysis was performed on total RNA
from human liver and liver tumor biopsies. In a commercially available
human liver tumor blot (Northern Territory, Invitrogen),
ATB0 mRNA was detectable in human hepatocellular carcinoma
(HCC) samples but not normal liver from the same patient in two of
three samples (Fig. 4A). To
determine the relative level of ATB0 mRNA in HCC, a direct
comparison was made with SK-Hep in a Northern analysis. The expression
levels of ATB0 mRNA in HCC were not as high as in SK-Hep
cells (Fig. 4B), but in a hepatoblastoma biopsy, this
transporter gene was expressed at levels severalfold higher than in the
hepatoblastoma cell line HepG2 (Fig. 4C). Expression of this
glutamine transporter in the nontumorigenic SV40-immortalized THLE-5B
liver epithelial cell line (Figs. 1 and 2) raised the possibility that
human liver cell growth alone may be sufficient for its transcriptional
activation. However, ATB0 mRNA was undetectable in human
fetal liver (Fig. 4D), corroborating previous results that
showed fetal hepatocytes primarily use system N for glutamine uptake
(6). Collectively, these results suggest that
ATB0 mRNA is expressed at variable levels in adult and
pediatric primary liver cancers, but the growth-related signals that
elicit its expression require further investigation.
|
Expression of ATB0 in fibroblasts and cirrhotic liver.
Previously, it was believed that ATB0 expression was
restricted to epithelial cells (16, 30). When glutamine
uptake was characterized in human fetal liver-derived fibroblasts
(HFLF), a profile nearly identical to that in the human hepatoma cells was observed (Fig. 5A),
including 94% Na+ dependence, with marked inhibition by
alanine, serine, and cysteine but not by MeAIB. Despite the
well-established expression of system A in human fibroblasts
(22), the contribution of this transporter(s) to glutamine
uptake does not become appreciable until extensive depletion of
intracellular amino acids is performed (15); conditions not used in this study. Nonlinear regression analysis of the
Na+-dependent transport data yielded high
(Km = 163 µM,
Vmax = 5.3 nmol · mg
protein
1 · 30 s
1)- and low-affinity
(Km = 1.2 mM,
Vmax = 3.1 nmol · mg
protein
1 · 30 s
1) components (Fig.
5A, inset). The high-affinity component, when combined with the amino acid inhibition data, is consistent with what
has been described as system ASC, whereas the low-affinity component is
assumed to be system A based on past studies with human fibroblasts
(15, 17).
|
Role of ATB0 in hepatoma cell proliferation.
The essential role of glutamine in supporting the growth of cells in
culture has been well accepted since the pioneering work of Eagle
(18). Previously, competitive inhibition of
ASC/B0-mediated glutamine uptake in SK-Hep cells with
excess alanine, serine, and threonine in the culture media was shown to
arrest growth (7). To assess the role of the
ATB0 transporter in mediating glutamine-dependent growth in
the additional five hepatoma cell lines, each was maintained in
media containing specific concentrations of L-glutamine in
the absence or presence of excess alanine, threonine, and serine,
(6.7 mM each, 20 mM collectively). While these amino acids are
also system A substrates, there is no evidence for any
MeAIB-inhibitable glutamine transport in these cell lines under the
amino acid-rich conditions used in this study (Fig. 1). The results
shown in Fig. 6 revealed that two of the
hepatoma cell lines (PLC/PRF/5 and FOCUS) were likewise sensitive to
substrate-dependent ASC/B0 inhibition in the presence of
physiological levels (0.5 mM) of L-glutamine, whereas the
Hep3B, HepG2, and Huh-7 were not. When the ambient
L-glutamine concentration was raised to normal tissue culture levels of 2 mM, the negative effects of the three
ASC/B0 substrates on growth were alleviated.
|
Northern analysis of GS and other glutamine transporters.
A basis for the differential reliance on the ASC/ATB0
transporter for growth in the hepatoma cell lines was provided by
Northern blot analysis of other glutamine transporters and GS. The
expression of these potential compensatory genes was investigated
because they might circumvent the effects of blunted glutamine uptake via ATB0 employed in the growth study. Despite relatively
equal ATB0 mRNA expression, the hepatoma cells under study
displayed a wide range of GS, system N (SN1 and SN2) and system A (ATA2
and ATA3) isoform mRNA levels (Fig. 7).
|
| |
DISCUSSION |
|---|
|
|
|---|
Given the potentially important role of glutamine in oncogenesis (39), the role of the liver and plasma membrane transport in glutamine homeostasis (27), and the observed depression of plasma glutamine levels in patients with liver cancer (29), the studies presented here were undertaken to determine whether a switch from system N to system ASC for glutamine uptake (6, 9) is a global or consistent feature of transformed human liver cells and to identify the gene responsible for this accelerated activity. The results demonstrate that relatively high rates of system ASC-mediated glutamine transport are a consistent feature of all six human hepatoma lines studied to date and that the product of the ATB0 gene, whose functional characteristics match those described for ASC-mediated glutamine uptake (6, 12, 30), is probably responsible for this activity. This conclusion is based on marked inhibition of glutamine uptake by alanine, cysteine, and serine relative to the other amino acids tested, including the system A-specific substrate MeAIB (Fig. 1) and the confirmed expression of this transporter via Northern blot and RT-PCR (Figs. 2 and 3). Although other transporters are expressed in some of the cell lines (Fig. 7), on the basis of the kinetic analyses, the high-affinity component (ATB0) mediates >80% of glutamine uptake at initial-rate concentrations (50 µM), and 60-70% of uptake at physiological concentrations (600 µM) in the hepatomas and THLE-5B. An additional finding from these studies is that ATB0 is largely responsible for glutamine uptake in fibroblasts (Fig. 5). This is significant in that it was previously thought that ATB0 expression was restricted to epithelial cells (16, 31). Thus the "system ASC" activity described in human fibroblasts for the past 20 years (12, 15, 22) is probably ATB0. The deduced amino acid sequence of human ATB0 gene is highly homologous (79-85% amino acid identity) to that encoded by rabbit ATB0 and mouse and rat ASCT2 (10, 31, 51). On the basis of cross-species cDNA library screenings and nearly identical functional characteristics, it has been concluded that ASCT2 and ATB0 represent interspecies orthologous isoforms of the same transporter (5, 11). Thus investigators might consider referring to this transporter as ASCT2 in all mammalian species. ATB0/ASCT2 is a member of the excitatory amino acid transporter family, which includes the glutamate transporters and another system ASC isoform (ASCT1) that does not transport the amides asparagine or glutamine (3, 48).
Although it is clear that ATB0/ASCT2 mediates the majority of glutamine uptake in proliferating human liver-derived cells in vitro, signals for its transcriptional activation are poorly understood. Results in the immortalized nontumorigenic human liver epithelial cell line THLE-5B (45) suggest that its expression is not limited to tumor-derived liver cells (Figs. 1-3). In the original cloning and characterization paper, ATB0 was expressed in a number of normal human tissues, but its mRNA was not detectable in liver by Northern blot analysis (30). The results in the present study corroborate those findings, because ATB0 mRNA is undetectable by Northern blotting in isolated human hepatocytes and adult and fetal human liver (Figs. 2 and 4), cells and tissues that primarily use system N rather than system ASC/B0 for glutamine transport (6, 35). The lack of detectable mRNA and activity in fetal human liver (Fig. 4D and Ref. 6) also indicates that liver cell growth per se is not alone sufficient to elicit ATB0 expression. Analysis of its expression in regenerating human liver would provide a better assessment of its activation as a result of hepatocyte cell cycle activation, but unfortunately, no good source of regenerating human liver was available, with the possible exception of the cirrhotic liver sample in Fig. 5. In fact, no cellular system has yet been identified whereby ATB0 expression can be elicited from a previously dormant background, but previous work from our laboratory has shown a relationship between relative rates of ASC/B0-mediated glutamine transport activity and growth or growth-related processes. For example, chemically arrested hepatoma cells exhibit diminished glutamine uptake rates (9), whereas ASC/B0-mediated glutamine transport regulates DNA and protein synthetic rates in tumor cells (52). ASC/B0 activity has also been shown to fluctuate in a cell cycle-dependent manner in SK-Hep cells, ~40% higher in G1/S relative to G2/M (43). Recent work also showed that ASC/B0-mediated glutamine uptake increases threefold when SK-Hep cells are grown as large multicellular spheroids (44) and that chronic downregulation of ASC/B0 activity with phorbol esters arrests the growth of this cell line (7). Despite these links between growth and glutamine transport activity, identification and study of the promoter region of the ATB0 gene will be required to address the mechanism of its activation in hepatoma and immortalized liver cells vs. lack of expression in fetal liver.
To test the clinical relevance of our results obtained in human liver tumor cell lines, Northern blot analysis showed that hepatocellular carcinomas expressed ATB0 mRNA, albeit at levels less than the HCC cell line SK-Hep (Fig. 4B). This could be the result of "dilution" of hepatoma RNA by normal hepatocyte RNA in the biopsy. It should be noted that the HCC samples shown in Figs. 4B and 5D are from two separate patients and contain approximately equal ATB0 mRNA levels. In contrast to HCC, the hepatoblastoma biopsy contained dramatically more ATB0 mRNA than the hepatoblastoma cell line HepG2 (Fig. 4C). However, it is difficult to assess whether relative mRNA levels directly correlate to ASC-mediated glutamine uptake rates. Clearly, a direct correlation between ATB0 mRNA levels and transport velocities was not apparent in the cell lines under study, as evidenced by the marked transport velocities in the THLE-5B cell line relative to the others (Figs. 1 and 2). Such disparate activities in the face of comparable ATB0 mRNA levels further implicate significant translational and established posttranslational mechanisms [membrane potentials, intracellular amino acid levels (11, 31, 50)] in determining the measured rates of glutamine uptake via this carrier. Antibodies against the ATB0 protein, currently in development in our laboratory, will help to resolve this issue in future studies and will aid in the identification of ATB0-positive cells within tumor biopsies. Nonetheless, our results indicate that the ATB0 gene is expressed in liver tumors as well as liver tumor-derived cell lines.
With respect to the main finding in these studies of the ubiquity of ATB0 expression in hepatoma cells, why might a glutamine transporter switch from system N to system ASC/B0 be advantageous? The data presented in Fig. 6 suggest that some of the hepatoma cells rely more heavily on this transporter to drive glutamine-dependent growth than others with a greater capacity to produce glutamine endogenously or the ability to take it up by alternative routes such as SN1 or SN2 (Fig. 7). This finding may be significant given the low GS activity observed in human liver tumors (37, 38). One practical consequence of ATB0 gene expression is that it allows cells to take up glutamine more efficiently than system N or A at relatively low ambient concentrations because of its higher affinity for this substrate (Fig. 1). A lower Km may prove effective in a poorly vascularized environment such as a tumor mass or connective tissue where glutamine concentrations may be diminished. Ultimately, different transport mechanisms between systems N and ASC/B0 may underlie the heightened activity and preferential expression of the latter in human hepatoma cells. System ASC activity is known to be enhanced by "transstimulation," a mechanism whereby increased levels of intracellular amino acid substrates accelerate the observed inward transport velocity of others (12, 22). ATB0 has recently been characterized by electrophysiological techniques and found to mediate Na+-dependent amino acid exchange rather than net uptake (50). Na+-dependent amino acid exchange allows cells to equilibrate pools of most zwitterionic amino acids via a "trade" of relatively abundant intracellular substrates for more coveted extracellular ones. Through this mechanism, ATB0 would indeed support growth and mediate the net uptake of glutamine, because faster growing hepatomas tend to have proportionally lower intracellular glutamine levels, at least in rodents (47), although no data are currently available on intracellular glutamine concentrations in the human hepatoma cell lines. Such an equilibrating mechanism may better lend itself to hepatoma growth than a narrow specificity carrier such as system N, whose properties are geared more toward systemic glutamine economy (5, 19). However, the mechanistic and cell-specific basis for ATB0 gene activation must be elucidated before the teleological aspects of this problem can be soundly addressed.
To date, three isoforms of system A and two isoforms of system N have been identified, and all belong to the same transporter family (5). We examined the expression of both system N isoforms and two of the three system A isoforms (ATA2 and ATA3) that are most liver specific (23, 25). The ATA1 isoform appears to exhibit more brain-specific expression, although its mRNA has been detected in HepG2 cells (24), so its potential contribution to glutamine uptake in the cell lines under study here cannot be discounted. When the kinetic data are compared with the results with Northern blots (Fig. 7), the low-affinity component is probably ATA2 in the cell lines sensitive to ATB0-competitive growth inhibition [SK-Hep, PLC/PRF/5, and FOCUS (Fig. 6)], because no SN1, SN2, or ATA3 mRNA was detectable in these cells. Under the conditions used in the growth inhibition studies, ATA2 would be both transinhibited and competitively inhibited from taking up glutamine due to excess alanine, serine, and threonine in the media and would therefore serve little compensatory role in relieving the attenuated glutamine supply. In contrast, the cell lines resistant to ATB0 competitive growth inhibition [HepG2, Hep3B, and Huh-7 (Fig. 6)] express both system N isoforms as well as ATA2 and ATA3 in the Hep3B and Huh-7. The low-affinity component for Na+-dependent glutamine uptake is probably a collective contribution of the system A and N isoforms, because all exhibit deduced Km values of 1-3 mM for glutamine (19, 23, 25, 42). Alanine has recently been shown to be a marginal SN1 substrate (19), whereas serine has been shown to be a strong SN2 substrate (42), but neither amino acid has the capacity to completely block system N-mediated glutamine uptake. Moreover, the resistant cell lines grow at reduced rates for a brief period in the total absence of glutamine (Fig. 6); two of these three cell lines (Hep3B and Huh-7) also exhibited the lowest glutamine requirements for growth (ED50 = 0.1 mM), suggesting a marginal glutamine metabolic economy in these cells. Under glutamine deprivation, intracellular glutamine could be provided by GS, whose mRNA is 2- to 50-fold more abundant in these cell lines relative to the three lines sensitive to ATB0 inhibition (Figs. 6 and 7).
In summary, this study demonstrates that the ATB0 gene product largely mediates the accelerated rates of hepatoma cell line glutamine uptake reported here and previously (6, 9) as well as in human fibroblasts. The data also suggest that ASCT2/ATB0 may govern the growth of poorly differentiated human liver tumor-derived cells lacking system N expression and a limited capacity to produce glutamine endogenously, similar to HCC in vivo (37, 38). On the basis of the differential expression of ATB0 mRNA in the hepatocellular carcinoma samples and hepatoblastoma, it is possible that this transporter plays a role in the development and growth of certain liver tumors. Targeted molecular inhibition of ATB0 expression, work that is currently in progress in our laboratory, will provide further insights into the role of this glutamine transporter in hepatoma cell growth and survival.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Dr. V. Ganapathy (Medical College of Georgia) for providing the human ATB0, SN1, and ATA2 cDNAs as well as Drs. D. Rhoads and K. Tanabe (both at MGH) for the fetal liver RNA blot and surgically discarded human tissue, respectively. We also express gratitude to Dr. F. Haluska and the MGH tumor bank for the hepatoblastoma sample, the Molecular Hepatology Laboratory at the MGH Cancer Center for the Focus cell line, Dr. J. Liang (MGH) for the Huh-7 cell line, and Dr. C. Harris at the National Cancer Institute for the THLE-5B cell line used in this study. Thanks also to Dr. S. Yoon at MGH for providing some of the isolated human hepatocytes.
| |
FOOTNOTES |
|---|
This study was funded by research Grant #1 R29 CA69505 to Dr. B. P. Bode from the National Cancer Institute and, in part, by the Beaumont Faculty Development Fund at Saint Louis Univ.
Address for reprint requests and other correspondence: B. P. Bode, Saint Louis Univ., Dept. of Biology, 3507 Laclede Ave., St. Louis, MO 63103-2010 (E-mail: bodebp{at}slu.edu).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
July 3, 2002;10.1152/ajpgi.00031.2002
Received 23 January 2002; accepted in final form 2 July 2002.
| |
REFERENCES |
|---|
|
|
|---|
1.
Aden, D,
Fogel A,
Plotkin S,
Damjanov I,
and
Knowles B.
Controlled synthesis of HBsAg in a differentiated human liver carcinoma-derived cell line.
Nature
282:
615-616,
1979[Medline].
2.
Ahluwalia, GS,
Grem JL,
Hao Z,
and
Cooney DA.
Metabolism and action of amino acid analog anti-cancer agents.
Pharmacol Ther
46:
243-271,
1990[Web of Science][Medline].
3.
Arriza, JL,
Kavanaugh MP,
Fairman WA,
Wu YN,
Murdoch GH,
North RA,
and
Amara SG.
Cloning and expression of a human neutral amino acid transporter with structural similarity to the glutamate transporter gene family.
J Biol Chem
268:
15329-15332,
1993
4.
Baggetto, LG.
Deviant energetic metabolism of glycolytic cancer cells.
Biochimie
74:
959-974,
1992[Medline].
5.
Bode, BP.
Recent molecular advances in mammalian glutamine transport.
J Nutr
131, Suppl. 4S:
2475S-2487S,
2001
6.
Bode, BP,
Kaminski DL,
Souba WW,
and
Li AP.
Glutamine transport in isolated human hepatocytes and transformed liver cells.
Hepatology
21:
511-520,
1995[Web of Science][Medline].
7.
Bode, BP,
Reuter N,
Conroy JL,
and
Souba WW.
Protein kinase C regulates nutrient uptake and growth in hepatoma cells.
Surgery
124:
260-268,
1998[Web of Science][Medline].
8.
Bode, BP,
and
Souba WW.
Glutamine transport and human hepatocellular transformation.
J Parent Enteral Nutr
23:
S33-37,
1999.
9.
Bode, BP,
and
Souba WW.
Modulation of cellular proliferation alters glutamine transport and metabolism in human hepatoma cells.
Ann Surg
220:
411-424,
1994[Web of Science][Medline].
10.
Broer, A,
Brookes N,
Ganapathy V,
Dimmer KS,
Wagner CA,
Lang F,
and
Broer S.
The astroglial ASCT2 amino acid transporter as a mediator of glutamine efflux.
J Neurochem
73:
2184-2194,
1999[Web of Science][Medline].
11.
Broer, A,
Wagner C,
Lang F,
and
Broer S.
Neutral amino acid transporter ASCT2 displays substrate-induced Na+ exchange and a substrate-gated anion conductance.
Biochem J
346:
705-710,
2000[Web of Science][Medline].
12.
Bussolati, O,
Laris PC,
Rotoli BM,
Dall'Asta V,
and
Gazzola GC.
Transport system ASC for neutral amino acids. An electroneutral sodium/amino acid cotransport sensitive to the membrane potential.
J Biol Chem
267:
8330-8335,
1992
13.
Chomcynski, P,
and
Sacchi N.
Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem
162:
156-159,
1987[Web of Science][Medline].
14.
Collins, CL,
Wasa M,
Souba WW,
and
Abcouwer SF.
Determinants of glutamine dependence and utilization by normal and tumor-derived breast cell lines.
J Cell Physiol
176:
166-178,
1998[Web of Science][Medline].
15.
Dall'Asta, V,
Rossi PA,
Bussolati O,
Guidotti GG,
and
Gazzola GC.
The transport of L-glutamine into cultured human fibroblasts.
Biochim Biophys Acta
1052:
106-112,
1990[Medline].
16.
Doyle, FA,
and
McGivan JD.
The bovine renal epithelial cell line NBL-1 expresses a broad-specificity Na+-dependent amino acid transport system (system B0) similar to that in bovine renal brush border membrane vesicles.
Biochim Biophys Acta
1104:
55-62,
1992[Medline].
17.
Dudrick, PS,
Bland KI,
and
Souba WW.
Effects of tumor necrosis factor on system ASC-mediated glutamine transport by human fibroblasts.
J Surg Res
52:
347-352,
1992[Web of Science][Medline].
18.
Eagle, H.
Nutritional needs of mammalian cells in tissue culture.
Science
122:
501-504,
1955
19.
Fei, YJ,
Sugawara M,
Nakanishi T,
Huang W,
Wang H,
Prasad PD,
Leibach FH,
and
Ganapathy V.
Primary structure, genomic organization, and functional and electrogenic characteristics of human system N 1, a Na+- and H+-coupled glutamine transporter.
J Biol Chem
275:
23707-23717,
2000
20.
Fogh, J,
and
Trempe G.
New human tumor cell lines.
In: Human Tumor Cells in Vitro, edited by Fogh J.. New York: Plenum, 1975, p. 115-159.
21.
Gazzola, GC,
Dall'Asta V,
Franchi-Gazzola R,
and
White MF.
The cluster-tray method for rapid measurement of solute fluxes in adherent cultured cells.
Anal Biochem
115:
368-374,
1981[Web of Science][Medline].
22.
Gazzola, GC,
Dall'Asta V,
and
Guidotti GG.
The transport of neutral amino acids in cultured human fibroblasts.
J Biol Chem
255:
929-936,
1980
23.
Hatanaka, T,
Huang W,
Ling R,
Prasad PD,
Sugawara M,
Leibach FH,
and
Ganapathy V.
Evidence for the transport of neutral as well as cationic amino acids by ATA3, a novel and liver-specific subtype of amino acid transport system A.
Biochim Biophys Acta
1510:
10-17,
2001[Medline].
24.
Hatanaka, T,
Huang W,
Martindale RG,
and
Ganapathy V.
Differential influence of cAMP on the expression of the three subtypes (ATA1, ATA2, and ATA3) of the amino acid transport system A.
FEBS Lett
505:
317-320,
2001[Web of Science][Medline].
25.
Hatanaka, T,
Huang W,
Wang H,
Sugawara M,
Prasad PD,
Leibach FH,
and
Ganapathy V.
Primary structure, functional characteristics and tissue expression pattern of human ATA2, a subtype of amino acid transport system A.
Biochim Biophys Acta
1467:
1-6,
2000[Medline].
26.
Haussinger, D,
Lamers WH,
and
Moorman AF.
Hepatocyte heterogeneity in the metabolism of amino acids and ammonia.
Enzyme (Basel)
46:
72-93,
1992.
27.
Haussinger, D,
Soboll S,
Meijer AJ,
Gerok W,
Tager JM,
and
Sies H.
Role of plasma membrane transport in hepatic glutamine metabolism.
Eur J Biochem
152:
597-603,
1985[Web of Science][Medline].
28.
He, L,
Isselbacher KJ,
Wands JR,
Goodman HM,
Shih C,
and
Quaroni A.
Establishment and characterization of a new human hepatocellular carcinoma cell line.
In Vitro
20:
493-504,
1984[Web of Science][Medline].
29.
Hirayama, C,
Suyama K,
Horie Y,
Tanimoto K,
and
Kato S.
Plasma amino acid patterns in hepatocellular carcinoma.
Biochem Med Metab Biol
38:
127-133,
1987[Web of Science][Medline].
30.
Kekuda, R,
Prasad PD,
Fei YJ,
Torres-Zamorano V,
Sinha S,
Yang-Feng TL,
Leibach FH,
and
Ganapathy V.
Cloning of the sodium-dependent, broad-scope, neutral amino acid transporter B0 from a human placental choriocarcinoma cell line.
J Biol Chem
271:
18657-18661,
1996
31.
Kekuda, R,
Torres-Zamorano V,
Fei YJ,
Prasad PD,
Li HW,
Mader LD,
Leibach FH,
and
Ganapathy V.
Molecular and functional characterization of intestinal Na+-dependent neutral amino acid transporter B0.
Am J Physiol Gastrointest Liver Physiol
272:
G1463-G1472,
1997
32.
Kilberg, MS,
Handlogten ME,
and
Christensen HN.
Characteristics of an amino acid transport system in rat liver for glutamine, asparagine, histidine, and closely related analogs.
J Biol Chem
255:
4011-4019,
1980
33.
Low, SY,
Salter M,
Knowles RG,
Pogson CI,
and
Rennie MJ.
A quantitative analysis of the control of glutamine catabolism in rat liver cells. Use of selective inhibitors.
Biochem J
295:
617-624,
1993[Medline].
34.
MacNab, GM,
Alexander JJ,
Lecatsas G,
Bey EM,
and
Urbanowicz JM.
Hepatitis B surface antigen produced by a human hepatoma cell line.
Br J Cancer
34:
509-515,
1976[Web of Science][Medline].
35.
Mailliard, ME,
and
Kilberg MS.
Sodium-dependent neutral amino acid transport by human liver plasma membrane vesicles.
J Biol Chem
265:
14321-14326,
1990
36.
Matsuno, T.
Pathway of glutamate oxidation and its regulation in the HuH13 line of human hepatoma cells.
J Cell Physiol
148:
290-294,
1991[Web of Science][Medline].
37.
Matsuno, T,
and
Goto I.
Glutaminase and glutamine synthetase activities in human cirrhotic liver and hepatocellular carcinoma.
Cancer Res
52:
1192-1194,
1992
38.
Matsuno, T,
and
Hirai H.
Glutamine synthetase and glutaminase activities in various hepatoma cells.
Biochem Int
19:
219-225,
1989[Web of Science][Medline].
39.
Medina, MA,
Sanchez-Jimenez F,
Marquez J,
Rodriguez Quesada A,
and
Nunez de Castro I.
Relevance of glutamine metabolism to tumor cell growth.
Mol Cell Biochem
113:
1-15,
1992[Web of Science][Medline].
40.
Meijer, AJ,
Lamers WH,
and
Chamuleau RAFM
Nitrogen metabolism and ornithine cycle function.
Physiol Rev
70:
701-748,
1990
41.
Nakabayashi, H,
Taketa K,
Yamane T,
Miyazaki M,
Miyano K,
and
Sato J.
Phenotypical stability of a human hepatoma cell line, Huh-7, in long-term culture with chemically defined medium.
GANN
75:
151-158,
1984[Web of Science][Medline].
42.
Nakanishi, T,
Sugawara M,
Huang W,
Martindale RG,
Leibach FH,
Ganapathy ME,
Prasad PD,
and
Ganapathy V.
Structure, function, and tissue expression pattern of human SN2, a subtype of the amino acid transport system N.
Biochem Biophys Res Commun
281:
1343-1348,
2001[Web of Science][Medline].
43.
Pawlik, TM,
Rubin AI,
Souba WW,
and
Bode BP.
Liver tumor cell nutrient uptake as a function of the cell cycle.
Surg. Forum
L:
23-25,
1999.
44.
Pawlik, TM,
Souba WW,
Sweeney TJ,
and
Bode BP.
Amino acid uptake and regulation in multicellular hepatoma spheroids.
J Surg Res
91:
15-25,
2000[Web of Science][Medline].
45.
Pfeifer, AM,
Cole KE,
Smoot DT,
Weston A,
Groopman JD,
Shields PG,
Vignaud JM,
Juillerat M,
Lipsky MM,
Trump BF,
Lechner JF,
and
Harris CC.
Simian virus 40 large tumor antigen-immortalized normal human liver epithelial cells express hepatocyte characteristics and metabolize chemical carcinogens.
Proc Natl Acad Sci USA
90:
5123-5127,
1993
46.
Scharf, JG,
Dombrowski F,
and
Ramadori G.
The IGF axis and hepatocarcinogenesis.
Mol Pathol
54:
138-144,
2001
47.
Sebolt, JS,
and
Weber G.
Negative correlation of L-glutamine concentration with proliferation rate in rat hepatomas.
Life Sci
34:
301-306,
1984[Web of Science][Medline].
48.
Shafqat, S,
Tamarappoo BK,
Kilberg MS,
Puranam RS,
McNamara JO,
Guadano-Ferraz A,
and
Fremeau RT, Jr.
Cloning and expression of a novel Na+-dependent neutral amino acid transporter structurally related to mammalian Na+/glutamate cotransporters.
J Biol Chem
268:
15351-15355,
1993
49.
Stevens, B.
Amino acid transport in intestine.
In: Mammalian Amino Acid Transport, edited by Kilberg M,
and Haussinger D.. New York: Plenum, 1992, p. 149-163.
50.
Torres-Zamorano, V,
Leibach FH,
and
Ganapathy V.
Sodium-dependent homo- and hetero-exchange of neutral amino acids mediated by the amino acid transporter ATB0.
Biochem Biophys Res Commun
245:
824-829,
1998[Web of Science][Medline].
51.
Utsunomiya-Tate, N,
Endou H,
and
Kanai Y.
Cloning and functional characterization of a system ASC-like Na+-dependent neutral amino acid transporter.
J Biol Chem
271:
14883-14890,
1996
52.
Wasa, M,
Bode BP,
Abcouwer SF,
Collins CL,
Tanabe KK,
and
Souba WW.
Glutamine as a regulator of DNA and protein biosynthesis in human solid tumor cell lines.
Ann Surg
224:
189-197,
1996[Web of Science][Medline].
This article has been cited by other articles:
![]() |
H. Gao, G. Wu, T. E. Spencer, G. A. Johnson, and F. W. Bazer Select Nutrients in the Ovine Uterine Lumen. IV. Expression of Neutral and Acidic Amino Acid Transporters in Ovine Uteri and Peri-Implantation Conceptuses Biol Reprod, June 1, 2009; 80(6): 1196 - 1208. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Talukder, R. Kekuda, P. Saha, P. D. Prasad, V. Ganapathy, and U. Sundaram Functional characterization, localization, and molecular identification of rabbit intestinal N-amino acid transporter Am J Physiol Gastrointest Liver Physiol, June 1, 2008; 294(6): G1301 - G1310. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Yuneva, N. Zamboni, P. Oefner, R. Sachidanandam, and Y. Lazebnik Deficiency in glutamine but not glucose induces MYC-dependent apoptosis in human cells J. Cell Biol., October 3, 2007; 178(1): 93 - 105. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Fuchs, R. E. Finger, M. C. Onan, and B. P. Bode ASCT2 silencing regulates mammalian target-of-rapamycin growth and survival signaling in human hepatoma cells Am J Physiol Cell Physiol, July 1, 2007; 293(1): C55 - C63. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Lee, W. I. Yang, Y. N. Park, K. S. Kim, J. S. Choi, M. Yun, D. Ko, T.-S. Kim, A. E.H. Cho, H. M. Kim, et al. Different Glucose Uptake and Glycolytic Mechanisms Between Hepatocellular Carcinoma and Intrahepatic Mass-Forming Cholangiocarcinoma with Increased 18F-FDG Uptake J. Nucl. Med., October 1, 2005; 46(10): 1753 - 1759. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Fuchs, J. C. Perez, J. E. Suetterlin, S. B. Chaudhry, and B. P. Bode Inducible antisense RNA targeting amino acid transporter ATB0/ASCT2 elicits apoptosis in human hepatoma cells Am J Physiol Gastrointest Liver Physiol, March 1, 2004; 286(3): G467 - G478. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |