AJP - GI Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 284: G175-G179, 2003; doi:10.1152/ajpgi.00409.2002
0193-1857/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wolkoff, A. W.
Right arrow Articles by Cohen, D. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wolkoff, A. W.
Right arrow Articles by Cohen, D. E.
Vol. 284, Issue 2, G175-G179, February 2003

THEME
Bile Acid Regulation of Hepatic Physiology
I. Hepatocyte transport of bile acids

Allan W. Wolkoff and David E. Cohen

Marion Bessin Liver Research Center, Albert Einstein College of Medicine, Bronx, New York 10461


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
PHYSIOLOGY OF HEPATOCYTE BILE...
IDENTIFICATION AND...
PHYSIOLOGY OF HEPATOCYTE BILE...
REGULATION OF TRANSPORTER...
FUTURE PERSPECTIVES
REFERENCES

Bile acids are cholesterol derivatives that serve as detergents in bile and the small intestine. Approximately 95% of bile acids secreted by hepatocytes into bile are absorbed from the distal ileum into the portal venous system. Extraction from the portal circulation by the hepatocyte followed by reexcretion into the bile canaliculus completes the enterohepatic circulation of these compounds. Over the past few years, candidate bile acid transport proteins of the sinusoidal and canalicular plasma membranes of the hepatocyte have been identified. The physiology of hepatocyte bile acid transport and its relationship to these transport proteins is the subject of this Themes article.

organic anion transporting protein; Na+-taurocholate cotransporting polypeptide; bile salt export pump


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
PHYSIOLOGY OF HEPATOCYTE BILE...
IDENTIFICATION AND...
PHYSIOLOGY OF HEPATOCYTE BILE...
REGULATION OF TRANSPORTER...
FUTURE PERSPECTIVES
REFERENCES

BILE ACIDS ARE A FAMILY OF cholesterol derivatives that serve important roles as detergents in bile and the small intestine. In humans, bile acid secretion by the hepatocyte approximates 1 g/h, 95% of which is recovered following absorption from the distal ileum into the portal venous system. Extraction from the portal circulation by the hepatocyte followed by reexcretion into the bile canaliculus completes the enterohepatic circulation of bile acids. This Themes article examines mechanisms for hepatocyte uptake and excretion of bile acids.


    PHYSIOLOGY OF HEPATOCYTE BILE ACID UPTAKE
TOP
ABSTRACT
INTRODUCTION
PHYSIOLOGY OF HEPATOCYTE BILE...
IDENTIFICATION AND...
PHYSIOLOGY OF HEPATOCYTE BILE...
REGULATION OF TRANSPORTER...
FUTURE PERSPECTIVES
REFERENCES

Bile acids circulate in plasma bound with relatively high affinity to albumin (26). There is also significant binding of bile acids to lipoproteins, especially HDL (28). Despite their low free concentrations, bile acids are extracted from the circulation quickly by the liver with single-pass extraction rates as high as 80% (25). Initial studies in isolated rat hepatocytes performed by Schwarz et al. (29) showed saturable uptake of taurocholate was decreased by 75% following replacement of extracellular Na+ by K+ or by sucrose. Similar Na+ dependence of taurocholate uptake was subsequently demonstrated in the isolated perfused rat liver (25). Although limited availability of radiolabeled compounds restricted studies of hepatocyte transport, several groups were able to demonstrate efficient, Na+-dependent uptake of a variety of conjugated bile acids (31). The mechanistic dependence of bile acid transport on Na+ has been the subject of a number of studies in hepatocytes and basolateral plasma membrane vesicles. These studies (17) revealed Na+-bile acid cotransport with a Na+/bile acid stoichiometry of >1:1.


    IDENTIFICATION AND CHARACTERIZATION OF HEPATOCYTE BASOLATERAL PLASMA MEMBRANE BILE ACID TRANSPORTERS
TOP
ABSTRACT
INTRODUCTION
PHYSIOLOGY OF HEPATOCYTE BILE...
IDENTIFICATION AND...
PHYSIOLOGY OF HEPATOCYTE BILE...
REGULATION OF TRANSPORTER...
FUTURE PERSPECTIVES
REFERENCES

The characteristics of bile acid transport by hepatocytes strongly suggest carrier mediation (Fig. 1). Considerable effort has been focused on defining a basolateral plasma membrane bile acid transporter(s). Initial studies utilized a photoaffinity approach to covalently attach radiolabeled bile acids to transporters contained in liver cell plasma membrane preparations as well as hepatocytes. Candidate transport proteins with apparent molecular mass of 48,000 and 54,000 Da were identified (33, 36). Interestingly, radiation inactivation analysis indicated that the minimal functional molecular mass of the Na+-dependent taurocholate transporter in rat liver basolateral plasma membrane vesicles was 170,000 Da (3).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 1.   Activities and short-term regulation of major known hepatocellular bile acid transport proteins. Solid arrows indicate transport of the indicated substrate. Dotted arrows denote regulatory pathways of vesicular transport and phosphorylation. * indicates ATP-dependent transport. bsep, Bile salt export pump; GSH, glutathione; mEH, microsomal epoxide hydrolase; mrp2/mrp3, multidrug resistance-associated protein 2/3; ntcp, Na+-taurocholate cotransporting polypeptide; oatp, organic anion transporting protein; TC, taurocholate; P, phosphorylated transporter.

The advent of expression cloning techniques resulted in the identification of a Na+-dependent bile acid transporter that has been termed the Na+-taurocholate-cotransporting polypeptide (ntcp) (18). This cloned cDNA encodes a protein with a predicted molecular mass of 39,000 Da that migrates at 49,000 Da on SDS-PAGE due to glycosylation. Expression of ntcp is restricted to the hepatocyte, where it resides on the basolateral (sinusoidal) plasma membrane.

The possibility that ntcp represents "the" Na+-dependent bile acid transporter of the hepatocyte has been asserted (18) but not proven. Evidence supportive of a major role for ntcp in bile acid transport includes similar Km values for bile acid transport by hepatocytes compared with ntcp-transfected cells as well as parallel decreases of Na+-dependent taurocholate transport and ntcp expression in cultured rat hepatocytes and during rat liver regeneration (18). It is important to point out, however, that these correlations do not establish cause and effect. The function of other potential transporters could also be altered when hepatocytes are cultured or during regrowth of the liver. The strongest functional evidence that has been used to imply a major transport role for ntcp is a 95% reduction of Na+-dependent taurocholate uptake following inhibition of ntcp expression in rat liver cRNA-injected Xenopus laevis oocytes by antisense nucleotides (8, 18). Whereas this experimental strategy offers a direct test of ntcp function, current database searching reveals that the antisense oligonucleotide that was used to inhibit ntcp translation (TAACCCATCAGAAAGCCAGA) (8) is not actually specific for ntcp. It is also antisense for a number of other rat liver proteins, including alpha II-spectrin and alpha -fodrin, as well as X. laevis proteins including MAPK kinase 7 and Ca2+/calmodulin-dependent kinase. Thus it is possible that expression or trafficking of other rat liver mRNA-encoded transport proteins could have been altered in these studies. Conclusive evidence of the role of ntcp may have to await preparation of a knockout mouse model. As of this time, spontaneously occurring disorders in experimental animals or humans in which altered bile acid uptake is attributable to mutations in ntcp have yet to be described.

Microsomal epoxide hydrolase (mEH) has been proposed as another candidate Na+-dependent bile acid transporter (32). This 49,000-Da protein was first implicated as a transporter based on its ability to reconstitute Na+-dependent taurocholate uptake in proteoliposomes. Subsequent analysis revealed that this protein was identical to mEH. To explain its presence on the plasma membrane, evidence was presented that insertion into the endoplasmic reticulum membrane occurs in two distinct topological orientations, one of which is targeted to the plasma membrane (37). Although expression of mEH in X. laevis oocytes and in a Syrian hamster kidney fibroblast cell line was not associated with development of Na+-dependent taurocholate uptake (12), expression of this protein in Madin-Darby canine kidney cells was sufficient to produce Na+-dependent taurocholate transport (32). Targeted disruption of the mEH gene in the mouse has been reported (20). Because serum bile acid levels and hepatocyte transport were not among those parameters included in the phenotypic characterization of this mouse, a potential physiological role of mEH in bile acid transport remains to be elucidated.

Although ~75% of bile acid uptake by the hepatocyte appears to be Na+-dependent, a substantial amount of uptake occurs by a Na+-independent mechanism(s). The organic anion transporting proteins (oatps) are candidate Na+-independent bile acid transporters (18). The oatp family of proteins has greatly expanded over the past few years as additional members have been described in humans, mice, rats, skates, and cows. Identity among these proteins ranges from 40 to 95%. In general, the oatps have wide and overlapping substrate specificities. Several are present in the liver, where they reside on the basolateral plasma membrane of the hepatocyte. When transfected into cultured cells, these proteins mediate Na+-independent transport of various bile acids with affinities similar to that of ntcp-mediated transport. Moreover, oatps are the targets of nuclear hormone receptors, which regulate bile acid metabolism and transport (30). Notwithstanding these suggestive data, the physiological roles of oatps in bile acid transport remain to be established.


    PHYSIOLOGY OF HEPATOCYTE BILE ACID EXCRETION
TOP
ABSTRACT
INTRODUCTION
PHYSIOLOGY OF HEPATOCYTE BILE...
IDENTIFICATION AND...
PHYSIOLOGY OF HEPATOCYTE BILE...
REGULATION OF TRANSPORTER...
FUTURE PERSPECTIVES
REFERENCES

The concentration gradient of bile acids between the hepatocyte and the bile canaliculus is large. Studies performed in canalicular membrane vesicle preparations revealed ATP-dependent transport of taurocholate (22, 23) that could provide the energy necessary for this concentrative process. On the basis of reconstitution of transport activity in proteoliposomes, a 110,000-Da glycoprotein was designated as the ATP-dependent canalicular transporter (22, 27). However, more recent studies have shown that the 160,000-Da protein initially named the sister of P-glycoprotein (spgp) was able to mediate ATP-dependent taurocholate transport in cRNA-injected X. laevis oocytes and in vesicles isolated from spgp-transfected Sf9 cells (6). This protein has been renamed bile salt export pump (bsep), and the gene has been formally designated as Abcb11. Most convincingly, it was found that the human counterpart, ABCB11, is mutated in the group of patients with progressive familial intrahepatic cholestasis type 2 (PFIC2), a disorder associated with markedly elevated serum bile acid levels and low content of bile acids in bile (15). Interestingly, targeted inactivation of Abcb11 in mice is associated with a less-severe phenotype. These mice have mild intrahepatic cholestasis with biliary bile acid excretion ~30% of that in wild-type mice (34). There was little excretion of hydrophobic bile acids in bile of these knockout mice. In contrast, biliary excretion of the more hydrophilic derivatives of muricholic acid was intact, suggesting that there may be an alternative canalicular transporter that can mediate excretion of hydrophilic bile acids (34).

Multidrug resistance-associated protein 2 (mrp2; ABCC2), a member of the ATP-binding cassette (ABC) family of proteins, serves as a canalicular exporter of bilirubin glucuronides and is mutated in the Dubin-Johnson syndrome (24), an inheritable disorder characterized by chronic conjugated hyperbilirubinemia. It is also a candidate to be an alternative canalicular bile acid transporter. Mrp2 can mediate excretion into bile of 3-sulfate and 3-glucuronide dianionic bile salts as well as ester sulfates of lithocholic acid (1). Although mrp2 does not transport taurocholic acid, mrp3, a closely related protein that resides on the basolateral plasma membrane of the hepatocyte, does transport this common bile acid (11). Upregulation of mrp3 in mrp2-deficient rat liver correlates with higher rates of taurocholic acid efflux (2), suggesting a compensatory mechanism for bile acid elimination from the hepatocyte. Also of note is the observation that substitution of the positively charged amino acid arginine with the neutral amino acid leucine at position 586 or position 1096 of mrp2 is sufficient to enable this protein to transport taurocholic acid (13). This intriguing finding should stimulate more-detailed studies regarding structure-function relationships of all of these transport proteins.


    REGULATION OF TRANSPORTER FUNCTION
TOP
ABSTRACT
INTRODUCTION
PHYSIOLOGY OF HEPATOCYTE BILE...
IDENTIFICATION AND...
PHYSIOLOGY OF HEPATOCYTE BILE...
REGULATION OF TRANSPORTER...
FUTURE PERSPECTIVES
REFERENCES

Sinusoidal and canalicular bile acid transport are under both long-term and short-term regulation. The mechanism for long-term regulation, such as the downregulation of transport that accompanies cholestasis and liver regeneration, is regulation of protein expression (5, 14). These changes are largely mediated by interactions of bile acids with specific nuclear receptors and transcription factors that will be the subject of another Themes article in this series. In contrast, short-term regulation occurs via changes in protein targeting between plasma membrane and intracellular locations, as well as via posttranslational modifications that result in altered transport activity (Fig. 1). Under normal physiological circumstances, e.g., between fasted and fed states, the hepatocyte is exposed to rapidly fluctuating levels of circulating bile salts. The liver responds in the short term by increasing hepatocellular bile salt transport over a time frame that is too rapid to be controlled by transcriptional mechanisms. Several mechanisms that can be utilized for this response have been described for the bile acid transporters that have been described in the preceding sections.

Studies in rat hepatocytes showed that cAMP pretreatment increased the maximal Na+-dependent taurocholic acid transport rate by ~50% and that this was associated with translocation of ntcp from an intracellular location to the plasma membrane (21). Subsequent studies showed that, within the hepatocyte, ntcp exists in a phosphorylated form and that it undergoes dephosphorylation in response to cAMP and subsequent translocation to the plasma membrane (21). Evidence indicates that cAMP activates protein phosphatase 2B (PP2B) and that PP2B-mediated dephosphorylation of ntcp is required for its trafficking to the cell surface (35). Although the mechanism mediating ntcp trafficking has not been fully elucidated, it appears to be mediated by a phosphatidylinositol-3-kinase-dependent pathway that also may require intact actin filaments (35).

Regulation of Na+-independent transport activity has been examined using sulfobromophthalein (BSP). In rat hepatocytes, maximal uptake of BSP is reduced by 75% following a 10-min exposure to extracellular ATP but not to ADP (7). This effect is rapidly reversible on removal of ATP and has characteristics that suggest a regulatory role for a purinergic receptor. Downregulation of BSP transport is also seen after exposure of hepatocytes to the phosphatase inhibitors okadaic acid or calyculin A (7) and is accompanied by serine phosphorylation (7). In contrast to results with ntcp, studies using a cell-impermeant biotinylation protocol reveal that oatp1 phosphorylation does not result in its removal from the plasma membrane (7). Rather, this transporter remains on the cell surface, apparently in an inactive conformation. Together with studies on ntcp, these findings indicate that the phosphorylation state must be considered when assessing functional expression of transporters in pathophysiological states.

Similar to other canalicular ABC transporters, Abcb11 (bsep) resides in an intracellular compartment from which it can be delivered rapidly to the canalicular membrane under situations of increased physiological functional demand (16). In isolated perfused rat liver, bile secretion is increased by intravenous infusion of cAMP or taurocholic acid (9, 10). Subsequent studies showed that these agents recruit ABC proteins, including bsep, to the canalicular plasma membrane from intracellular stores. This recruitment is inhibited by the microtubule disruptor colchicine (4) and by the phosphatidylinositol 3-kinase inhibitor wortmannin (19). These studies also suggested that the effects of cAMP and taurocholate on recruitment of bsep to the canalicular membrane were independent, suggesting the existence of two intracellular pools of Abcb11 (16). Recent evidence also indicates that Abcb11 transport activity is stimulated by lipid products of phosphatidylinositol 3-kinase (16).


    FUTURE PERSPECTIVES
TOP
ABSTRACT
INTRODUCTION
PHYSIOLOGY OF HEPATOCYTE BILE...
IDENTIFICATION AND...
PHYSIOLOGY OF HEPATOCYTE BILE...
REGULATION OF TRANSPORTER...
FUTURE PERSPECTIVES
REFERENCES

Whereas considerable progress has been made toward understanding uptake and secretion of bile acids by hepatocytes, important questions remain unanswered. Definition of the relative contributions in vivo of ntcp, oatps, and mEH to clearance of bile acids from portal blood will likely require the creation of mice with targeted disruption of genes encoding one or more of these transporters. Additional structure-function analyses will be essential to establish the molecular mechanisms of transport for both sinusoidal and canalicular transporters. Whether these proteins act in isolation or as multimers that homo- or heteroassociate is similarly unknown. Finally, continued efforts to elucidate both the transcriptional control and trafficking of bile acid transporters will no doubt lead to fundamental insights into important aspects of the cellular biology of the hepatocyte.


    ACKNOWLEDGEMENTS

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-23026, DK-41296, DK-48873, and DK-56626.


    FOOTNOTES

Address for reprint requests and other correspondence: A. W. Wolkoff, Marion Bessin Liver Research Center, 625 Ullmann Bldg., Albert Einstein College of Medicine, 1300 Morris Park Ave., Bronx, NY 10461 (E-mail: wolkoff{at}aecom.yu.edu).

10.1152/ajpgi.00409.2002


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
PHYSIOLOGY OF HEPATOCYTE BILE...
IDENTIFICATION AND...
PHYSIOLOGY OF HEPATOCYTE BILE...
REGULATION OF TRANSPORTER...
FUTURE PERSPECTIVES
REFERENCES

1.   Akita, H, Suzuki H, Ito K, Kinoshita S, Sato N, Takikawa H, and Sugiyama Y. Characterization of bile acid transport mediated by multidrug resistance associated protein 2 and bile salt export pump. Biochim Biophys Acta 1511: 7-16, 2001[Medline].

2.   Akita, H, Suzuki H, and Sugiyama Y. Sinusoidal efflux of taurocholate is enhanced in Mrp2-deficient rat liver. Pharm Res 18: 1119-1125, 2001[Web of Science][Medline].

3.   Elsner, R, and Ziegler K. Determination of the apparent functional molecular mass of the hepatocellular sodium-dependent taurocholate transporter by radiation inactivation. Biochim Biophys Acta 983: 113-117, 1989[Medline].

4.   Gatmaitan, ZC, Nies AT, and Arias IM. Regulation and translocation of ATP-dependent apical membrane proteins in rat liver. Am J Physiol Gastrointest Liver Physiol 272: G1041-G1049, 1997[Abstract/Free Full Text].

5.   Gerloff, T, Geier A, Stieger B, Hagenbuch B, Meier PJ, Matern S, and Gartung C. Differential expression of basolateral and canalicular organic anion transporters during regeneration of rat liver. Gastroenterology 117: 1408-1415, 1999[Web of Science][Medline].

6.   Gerloff, T, Stieger B, Hagenbuch B, Madon J, Landmann L, Roth J, Hofmann AF, and Meier PJ. The sister of P-glycoprotein represents the canalicular bile salt export pump of mammalian liver. J Biol Chem 273: 10046-10050, 1998[Abstract/Free Full Text].

7.   Glavy, JS, Wu SM, Wang PJ, Orr GA, and Wolkoff AW. Down-regulation by extracellular ATP of rat hepatocyte organic anion transport is mediated by serine phosphorylation of oatp1. J Biol Chem 275: 1479-1484, 2000[Abstract/Free Full Text].

8.   Hagenbuch, B, Scharschmidt BF, and Meier PJ. Effect of antisense oligonucleotides on the expression of hepatocellular bile acid and organic anion uptake systems in Xenopus laevis oocytes. Biochem J 316: 901-904, 1996[Medline].

9.   Hayakawa, T, Bruck R, Ng OC, and Boyer JL. DBcAMP stimulates vesicle transport and HRP excretion in isolated perfused rat liver. Am J Physiol Gastrointest Liver Physiol 259: G727-G735, 1990[Abstract/Free Full Text].

10.   Hayakawa, T, Ng OC, Ma A, Boyer JL, and Cheng O. Taurocholate stimulates transcytotic vesicular pathways labeled by horseradish peroxidase in the isolated perfused rat liver. Gastroenterology 99: 216-228, 1990[Web of Science][Medline].

11.   Hirohashi, T, Suzuki H, Takikawa H, and Sugiyama Y. ATP-dependent transport of bile salts by rat multidrug resistance-associated protein 3 (Mrp3). J Biol Chem 275: 2905-2910, 2000[Abstract/Free Full Text].

12.   Honscha, W, Platte HD, Oesch F, and Friedberg T. Relationship between the microsomal epoxide hydrolase and the hepatocellular transport of bile acids and xenobiotics. Biochem J 311: 975-979, 1995[Medline].

13.   Ito, K, Suzuki H, and Sugiyama Y. Single amino acid substitution of rat MRP2 results in acquired transport activity for taurocholate. Am J Physiol Gastrointest Liver Physiol 281: G1034-G1043, 2001[Abstract/Free Full Text].

14.   Jansen, PLM, Muller M, and Sturm E. Genes and cholestasis. Hepatology 34: 1067-1074, 2001[Web of Science][Medline].

15.   Jansen, PLM, Strautnieks SS, Jacquemin E, Hadchouel M, Sokal EM, Hooiveld GJEJ, Koning JH, Jager-Krikken AD, Kuipers F, Stellaard F, Bijleveld CMA, Gouw A, van Goor H, Thompson RJ, and Müller M. Hepatocanalicular bile salt export pump deficiency in patients with progressive familial intrahepatic cholestasis. Gastroenterology 117: 1370-1379, 1999[Web of Science][Medline].

16.   Kipp, H, and Arias IM. Trafficking of canalicular ABC transporters in hepatocytes. Annu Rev Physiol 64: 595-608, 2002[Web of Science][Medline].

17.   Lidofsky, SD, Fitz JG, Weisiger RA, and Scharschmidt BF. Hepatic taurocholate uptake is electrogenic and influenced by transmembrane potential difference. Am J Physiol Gastrointest Liver Physiol 264: G478-G485, 1993[Abstract/Free Full Text].

18.   Meier, PJ, and Stieger B. Bile salt transporters. Annu Rev Physiol 64: 635-661, 2002[Web of Science][Medline].

19.   Misra, S, Gatmaitan Z, Varticovski L, and Arias IM. The role of phosphoinositide 3-kinase in taurocholate-induced trafficking of ATP-dependent canalicular transporters in rat liver. J Biol Chem 273: 26638-26644, 1998[Abstract/Free Full Text].

20.   Miyata, M, Kudo G, Lee YH, Yang TJ, Gelboin HV, Fernandez-Salguero P, Kimura S, and Gonzalez FJ. Targeted disruption of the microsomal epoxide hydrolase gene. Microsomal epoxide hydrolase is required for the carcinogenic activity of 7,12-dimethylbenz[a]anthracene. J Biol Chem 274: 23963-23968, 1999[Abstract/Free Full Text].

21.   Mukhopadhyay, S, Ananthanarayanan M, Stieger B, Meier PJ, Suchy FJ, and Anwer MS. Sodium taurocholate cotransporting polypeptide is a serine, threonine phosphoprotein and is dephosphorylated by cyclic adenosine monophosphate. Hepatology 28: 1629-1636, 1998[Web of Science][Medline].

22.   Muller, M, Ishikawa T, Berger U, Klunemann C, Lucka L, Schreyer A, Kannicht C, Reutter W, Kurz G, and Keppler D. ATP-dependent transport of taurocholate across the hepatocyte canalicular membrane mediated by a 110-kDa glycoprotein binding ATP and bile salt. J Biol Chem 266: 18920-18926, 1991[Abstract/Free Full Text].

23.   Nishida, T, Gatmaitan Z, Che M, and Arias IM. Rat liver canalicular membrane vesicles contain an ATP-dependent bile acid transport system. Proc Natl Acad Sci USA 88: 6590-6594, 1991[Abstract/Free Full Text].

24.   Paulusma, CC, Kool M, Bosma PJ, Scheffer GL, ter Borg F, Scheper RJ, Tytgat GN, Borst P, Baas F, and Oude Elferink RP. A mutation in the human canalicular multispecific organic anion transporter gene causes the Dubin-Johnson syndrome. Hepatology 25: 1539-1542, 1997[Web of Science][Medline].

25.   Reichen, J, and Paumgartner G. Uptake of bile acids by perfused rat liver. Am J Physiol 231: 734-742, 1976[Abstract/Free Full Text].

26.   Roda, A, Cappelleri G, Aldini R, Roda E, and Barbara L. Quantitative aspects of the interaction of bile acids with human serum albumin. J Lipid Res 23: 490-495, 1982[Abstract].

27.   Ruetz, S, Hugentobler G, and Meier PJ. Functional reconstitution of the canalicular bile salt transport system of rat liver. Proc Natl Acad Sci USA 85: 6147-6151, 1988[Abstract/Free Full Text].

28.   Salvioli, G, Lugli R, Pradelli JM, and Gigliotti G. Bile acid binding in plasma: the importance of lipoproteins. FEBS Lett 187: 272-276, 1985[Web of Science][Medline].

29.   Schwarz, LR, Burr R, Schwenk M, Pfaff E, and Greim H. Uptake of taurocholic acid into isolated rat-liver cells. Eur J Biochem 55: 617-623, 1975[Web of Science][Medline].

30.   Shih, DQ, Bussen M, Sehayek E, Ananthanarayanan M, Shneider BL, Suchy FJ, Shefer S, Bollileni JS, Gonzalez FJ, Breslow JL, and Stoffel M. Hepatocyte nuclear factor-1alpha is an essential regulator of bile acid and plasma cholesterol metabolism. Nat Genet 27: 375-382, 2001[Web of Science][Medline].

31.   Van Dyke, RW, Stephens JE, and Scharschmidt BF. Bile acid transport in cultured rat hepatocytes. Am J Physiol Gastrointest Liver Physiol 243: G484-G492, 1982[Abstract/Free Full Text].

32.   Von Dippe, P, Amoui M, Stellwagen RH, and Levy D. The functional expression of sodium-dependent bile acid transport in Madin-Darby canine kidney cells transfected with the cDNA for microsomal epoxide hydrolase. J Biol Chem 271: 18176-18180, 1996[Abstract/Free Full Text].

33.   Von Dippe, P, Drain P, and Levy D. Synthesis and transport characteristics of photoaffinity probes for the hepatocyte bile acid transport system. J Biol Chem 258: 8890-8895, 1983[Abstract/Free Full Text].

34.   Wang, R, Salem M, Yousef IM, Tuchweber B, Lam P, Childs SJ, Helgason CD, Ackerley C, Phillips MJ, and Ling V. Targeted inactivation of sister of P-glycoprotein gene (spgp) in mice results in nonprogressive but persistent intrahepatic cholestasis. Proc Natl Acad Sci USA 98: 2011-2016, 2001[Abstract/Free Full Text].

35.   Webster, CRL, Blanch C, and Anwer MS. Role of PP2B in cAMP-induced dephosphorylation and translocation of NTCP. Am J Physiol Gastrointest Liver Physiol 283: G44-G50, 2002[Abstract/Free Full Text].

36.   Wieland, T, Nassal M, Kramer W, Fricker G, Bickel U, and Kurz G. Identity of hepatic membrane transport systems for bile salts, phalloidin, and antamanide by photoaffinity labeling. Proc Natl Acad Sci USA 81: 5232-5236, 1984[Abstract/Free Full Text].

37.   Zhu, Q, von Dippe P, Xing W, and Levy D. Membrane topology and cell surface targeting of microsomal epoxide hydrolase. Evidence for multiple topological orientations. J Biol Chem 274: 27898-27904, 1999[Abstract/Free Full Text].


Am J Physiol Gastrointest Liver Physiol 284(2):G175-G179
0193-1857/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
S. Imai, R. Kikuchi, H. Kusuhara, S. Yagi, K. Shiota, and Y. Sugiyama
Analysis of DNA Methylation and Histone Modification Profiles of Liver-Specific Transporters
Mol. Pharmacol., March 1, 2009; 75(3): 568 - 576.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
L. Fouassier, M. Beaussier, E. Schiffer, C. Rey, V. Barbu, M. Mergey, D. Wendum, P. Callard, J.-Y. Scoazec, E. Lasnier, et al.
Hypoxia-induced changes in the expression of rat hepatobiliary transporter genes
Am J Physiol Gastrointest Liver Physiol, July 1, 2007; 293(1): G25 - G35.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. Mita, H. Suzuki, H. Akita, H. Hayashi, R. Onuki, A. F. Hofmann, and Y. Sugiyama
Vectorial transport of unconjugated and conjugated bile salts by monolayers of LLC-PK1 cells doubly transfected with human NTCP and BSEP or with rat Ntcp and Bsep
Am J Physiol Gastrointest Liver Physiol, March 1, 2006; 290(3): G550 - G556.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wolkoff, A. W.
Right arrow Articles by Cohen, D. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wolkoff, A. W.
Right arrow Articles by Cohen, D. E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online