AJP - GI Information on EB 2010
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 284: G248-G254, 2003. First published October 16, 2002; doi:10.1152/ajpgi.00391.2002
0193-1857/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/2/G248    most recent
00391.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, S.
Right arrow Articles by Black, D. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, S.
Right arrow Articles by Black, D. D.
Vol. 284, Issue 2, G248-G254, February 2003

Regulation of apo A-IV transcription by lipid in newborn swine is associated with a promoter DNA-binding protein

Song Lu, Ying Yao, Heng Wang, Songmei Meng, Xiangying Cheng, and Dennis D. Black

Children's Foundation Research Center of Memphis at Le Bonheur Children's Medical Center, University of Tennessee Health Science Center, Memphis, Tennessee 38103


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Dietary lipid acutely upregulates apolipoprotein (apo) A-IV expression by sevenfold at the pretranslational level in neonatal swine jejunum. To determine the mechanism of this regulation, two-day-old female swine received intraduodenal infusions of low- and high-triacylglycerol (TG) isocaloric diets for 24 h. Nuclear runoff assay confirmed apo A-IV gene transcriptional regulation by the high-TG diet. Footprinting analysis using the swine apo A-IV proximal promoter sequence (+14 to -246 bp) demonstrated three regions protected by the low-TG extracts. Of these three motifs, only ACCTTC showed 100% homology to the human sequence and was further studied. EMSA was performed using probes containing wild-type (WT) and mutant (M) motifs. A shift was noted with the low-TG nuclear extracts with the WT probe but not with the M probe. Excess unlabeled free WT probe competed out the shift, whereas the M probe did not. No significant shift occurred with either probe using high-TG extracts. These results suggest that a repressor protein binds to the ACCTTC motif and becomes unbound during lipid absorption, allowing transcriptional activation of the apo A-IV gene in newborn swine small intestine.

DNAse I DNA protection assay; electrophoretic mobility shift assay; gene transcription; nuclear runoff assay; small intestine


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

LIPID IS AN ESPECIALLY IMPORTANT nutrient in the neonatal period and is a major component of breast milk. Important events in the absorption of dietary lipid are uptake and reesterification of the products of lipid digestion, packaging of these complex lipids with apolipoproteins into nascent chylomicrons in the endoplasmic reticulum, trafficking of the prechylomicron to the Golgi apparatus, and finally the basolateral secretion of the chylomicron for entry into the systemic circulation (28). Regulation of small intestinal apolipoprotein expression during this process is especially important, because these lipid-binding peptides play important roles in the assembly, secretion, and peripheral metabolism of lipoprotein particles.

Apolipoprotein (apo) A-IV is an abundant apolipoprotein synthesized by both the liver and small intestine in rodents and by intestine only in humans and swine (4, 7, 13-15, 19). Apo A-IV is a component of nascent intestinal lipoproteins, including chylomicrons and HDL, and becomes dissociated from chylomicrons soon after secretion. Several studies have suggested roles for apo A-IV in the activation of lecithin-cholesterol acyltransferase (10, 33), in reverse cholesterol transport by promoting cellular cholesterol efflux (32), as a ligand for HDL binding to hepatocytes (12), and in activation of lipoprotein lipase by the augmentation of apo C-II transfer from HDL (18). Recent work suggests a role for apo A-IV as a postprandial satiety factor and as an inhibitor of gastric acid secretion in the adult rat, with these effects mediated at the level of the central nervous system (16, 17, 29). Apo A-IV also appears to function as an endogenous lipoprotein antioxidant (30). We (27) recently published evidence that apo A-IV may enhance lipid transport in the newborn enterocyte.

Genes for apo A-IV, C-III, and A-I form a cluster on chromosome 11 in the human (24). The apo C-III gene is located downstream from the apo A-I gene and upstream from the apo A-IV gene. The apo C-III gene is transcribed in the opposite direction to that of the apo A-I and A-IV genes. Tissue-specific and basal regulation of apo A-I, C-III, and A-IV gene transcription has been the focus of extensive study, and relevant cis- and trans-acting factors have been identified (5, 25).

We have previously demonstrated that dietary lipid acutely (24 h) upregulates apo A-IV expression by sevenfold at the pretranslational level in newborn swine proximal small intestine (7, 8). By 2-3 wk of age, the magnitude of this upregulation is reduced to about twofold, which is comparable with that observed in the adult rat (2, 7). The present studies were undertaken to determine the molecular mechanism of this enhanced regulation of apo A-IV expression in newborn intestine by dietary lipid.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Animals. To study the short-term (24 h) physiological regulation of apo A-IV expression by dietary lipid in newborn swine small intestine, 2-day-old female swine (Tyson Farms, Plummerville, AR) were surgically fitted with duodenal catheters exiting through dorsal swivel tethers as previously described (6). Animals were allowed to recover for 24 h while receiving a glucose-saline (5% glucose in 45 mM NaCl and 20 mM KCl) duodenal infusion at 100 ml · kg-1 · 24 h-1, followed by the infusion of either dilute Vivonex (Norwich Eaton Pharmaceuticals, Norwich, NY), a low-fat elemental formula, or Intralipid (Cutter, Berkeley, CA), a lipid emulsion containing primarily 18-carbon unsaturated fatty acids. Infusions were isocaloric and at a rate of 50 kcal · kg-1 · 24 h-1. At the end of the 24-h infusion, animals were anesthetized and the abdominal cavity was quickly opened for harvest of the intestine. Sections of jejunum were taken 5 cm distal to the ligament of Treitz for preparation of nuclei and nuclear extracts, as well as total RNA. Animals were then euthanized by intracardiac pentobarbital overdose. All procedures were approved by the University of Tennessee Health Science Center Animal Care and Use Committee.

Materials. All radioisotopes were purchased from DuPont New England Nuclear (Boston, MA). PMSF and DTT were purchased from Sigma (St. Louis, MO). Unless otherwise specified, all other chemicals were molecular biology grade and were purchased from Sigma.

Cloning and sequencing of the swine apo A-IV proximal promoter. The swine apo A-IV gene proximal promoter was PCR-amplified from swine genomic DNA using primers 5'-TGTCA/TGCTTCCACGTA/TGTCT-3' and 5'-ACNGCCTTCAGGAACATCCTG-3' derived from the corresponding human sequence. A 261-bp PCR product was amplified and cloned into the TOPO TA cloning vector (Invitrogen, Carlsbad, CA) for automated sequencing.

Isolation of RNA. Swine jejunal enterocytes were scraped and dissolved in TRI reagent (Molecular Research Center, Cincinnati, OH) at a concentration of 50-70 mg/ml, followed by extraction of total RNA.

RT-PCR. Aliquots of RNA (2-10 µg) were treated with 0.5 units of DNAse RQ1 (Promega, Madison, WI) at 37°C for 60 min in 50 µl of the following (in mM): 40 Tris · HCl, pH 7.5, 6 MgCl2, 10 NaCl, 10 DTT, and 20 units RNAse inhibitor (RNAsin; Promega). The RNA was then sequentially extracted with phenol-chloroform and chloroform, precipitated with ethanol, washed once (with 70% ethanol), and resuspended in 20-40 µl H2O. For reverse transcription, 5-µg total RNA was used. Reverse transcription was performed at 42°C for 60 min in a final volume of 50 µl in buffer containing 10 mM Tris · HCl, pH 8.3, 90 mM KCl, 1 mM MnCl2, 200 µM of each dNTP, 0.5 µg oligo(dT)15 as primer, and 10 units Moloney murine leukemia virus (MMLV) reverse transcriptase (GIBCO-BRL, Grand Island, NY). After reverse transcription, the single-strand cDNA was amplified using the Qiagen Taq PCR core kit (Qiagen, Santa Clarita, CA) with 1 µl cDNA and 100 pmol of each specific primer in a total volume of 50 µl. After incubation for 60 s at 94°C, PCR was performed for 23 cycles for beta -actin and 25 cycles for apo A-IV in a thermal cycler (PerkinElmer, Boston, MA) as follows: 10 s at 94°C, 10 s at 62°C for apo A-IV and 61°C for beta -actin, and 60 s at 72°C ending with 5 min at 72°C. For each RNA sample a negative control was run to check for DNA contamination using AmpliTaq (PerkinElmer), leaving the sample on ice during reverse transcription. Additionally, each reaction contained a tube with all of the above buffers and enzymes but without RNA to exclude PCR product contamination. The optimal number of PCR cycles for each set of primers was established by constructing curves of the number of cycles vs. PCR product band density in agarose gels. Cycle numbers were selected in the linear portion of the curves. After RT-PCR, 2/5 of the reaction products were subjected to 1.5% agarose gel electrophoresis. Expected product sizes were confirmed as follows: beta -actin, 410 bp and apo A-IV, 492 bp. Agarose gels containing PCR products were stained with ethidium bromide and imaged on the Gel-Doc 2000 (Bio-Rad, Hercules, CA).

Oligonucleotides for PCR. Oligonucleotides were as follows: beta -actin forward, 5'-TGGCATTGTCATGGACTCTG-3' (sense, nt 81-100) and reverse, 5'-CGCACTTCATGATCGAGTTG-3' (antisense, nt 471-490); swine apo A-IV forward, 5'-GAACGCCTGACCAAGGACTG-3' (sense, nt 265-284) and reverse, 5'-CAGCTCCTCTGCCTGCTTCT-3' (antisense, nt 737-756).

Isolation of nuclei and nuclear runoff assay. Nuclear runoff analysis of apo A-IV and beta -actin gene transcription were performed as described (20). Two-day-old newborn swine received 24-h intraduodenal isocaloric infusions of either low-triacylglycerol (low-TG) or high-TG diets, followed by harvest of the proximal half of the small intestine from which nuclei were prepared. Nuclear runoff assay was performed by incubating 5 × 107 nuclei per preparation with [alpha -32P]UTP plus unlabeled nucleotides. Newly transcribed RNA was extracted from the reaction mixture, and 3 × 106 dpm from each group was hybridized with nitrocellulose filters with slots containing 5 µg each of bound linearized plasmids containing swine apo A-IV and beta -actin cDNA inserts. Filters were washed at high stringency and subjected to autoradiography followed by digital densitometry.

Isolation of nuclear extracts. Nuclear extracts were prepared from newborn swine enterocytes and hepatocytes as described (1). Briefly, enterocytes were scraped from newborn piglet proximal jejunum and washed with cold PBS and cold hypotonic buffer (in mM: 10 HEPES, pH 7.9, 1.5 MgCl2, 10 KCl, 0.2 PMSF, and 0.5 DTT). Hepatocytes were similarly isolated and washed. The pellet was resuspended in 3 volumes of hypotonic buffer and incubated on ice for 5 min. After homogenization, the pellet containing the nuclei was collected by centrifugation for 15 min at 3,300 g. Nuclear extract was prepared by incubation with low (0.02 M KCl) and high (1.2 M KCl) salt buffer. The extract was dialyzed against 50 volumes of dialysis buffer (in mM: 20 HEPES, pH 7.9, 100 KCl, 0.2 EDTA, 0.2 PMSF, and 0.5 DTT and 20% glycerol) at 4°C.

DNAse I DNA protection assay. DNAse I DNA protection assays were conducted using the Promega Core Footprinting System (Madison, WI). Each assay used 2.5 and 5 µg of nuclear extract protein, 15,000 counts/min of radiolabeled DNA probe, and binding buffer in a total volume of 50 µl. After incubation for 10 min at room temperature, 0.05 µg of RQ1 was added to the mix, followed by incubation at 37°C for 2 min. Digested DNA probes were purified and loaded onto a 6% polyacrylamide gel. Gels were electrophoresed at 1,500 V/60 watts in 1× Tris-borate-EDTA (TBE) buffer. Gels were then dried and subjected to autoradiography at -80°C overnight. Nuclear extract from HeLa cells was provided in the Promega kit.

EMSA. EMSAs were performed using the Stratagene GelShift Assay Kit (Stratagene, La Jolla, CA) according to the manufacturer's protocol. Assays used 2.5 and 5 µg of nuclear extracts and 15,000 counts/min of the radiolabeled DNA probe per sample with binding buffer. Incubations were carried at room temperature for 10 min. Ten microliters of the 20-µl reaction mixture were electrophoresed on 10% acylamide/bisacylamide (20:1) gels with 0.5× TBE. Gels were dried and subjected to autoradiography at -80°C overnight.

Oligonucleotides for EMSA assays. The following sequences were used to produce double-stranded oligonucleotide probes for the EMSA assays: wild type: 5'-GAATGTGTCACCTTCCAGCGTGGAG-3'; mutant: 5'-GAATGTGTCAACTGCCA- GCGTGGAG-3'

Protein measurement. Nuclear extract protein was determined by the Bradford method (9).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Regulation of apo A-IV proximal intestinal mRNA levels by a high-TG diet. RT-PCR analysis confirmed a striking increase in jejunal apo A-IV mRNA levels induced by the high-TG diet, compared with the low-TG diet (Fig. 1). These results are consistent with those previously reported (7, 8).


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1.   Semiquantitative apolipoprotein (apo) A-IV and beta -actin RT-PCR products from RNA isolated from proximal jejunal enterocytes from newborn swine receiving 24-h intraduodenal infusions of either a high-triacylglycerol (high-TG) or low-TG formulas. This figure is representative of results obtained from jejunal RNA from the animals used to prepare nuclear extracts for DNAse I DNA protection assays and electrophoretic mobility shift assays.

Nuclear runoff assay of apo A-IV transcription. Nuclear runoff assays confirmed that the pretranslational regulation of apo A-IV and C-III mRNA levels by dietary lipid in newborn swine jejunum occurred at the transcriptional level (Fig. 2). Digital densitometry revealed a 3.1-fold increase in apo A-IV gene transcription induced by the high-TG diet, compared with the low-TG diet.


View larger version (133K):
[in this window]
[in a new window]
 
Fig. 2.   Nuclear runoff assay analysis of apo A-IV, apo C-III, and beta -actin gene transcription. Two-day-old newborn swine received 24-h intraduodenal isocaloric infusions of either low-TG or high-TG diets, followed by harvest of the proximal half of the small intestine from which intact nuclei were prepared. Nuclear runoff assay was performed as described in the MATERIALS AND METHODS. Results shown are representative of 2 separate experiments.

Apo A-IV proximal promoter. Swine apo A-IV proximal promoter (+14 to -246 bp) was cloned and sequenced. Figure 3 shows swine sequence compared with human sequence.


View larger version (44K):
[in this window]
[in a new window]
 
Fig. 3.   Human (HAIV) and swine (PAIV) apo A-IV proximal gene promoter sequences. Sequences protected by low-TG nuclear extracts from newborn swine proximal jejunum are underlined in bold. The ATG transcription initiation site is indicated in bold.

DNAse I DNA protection assay of the proximal apo A-IV promoter. Footprinting analysis using the swine apo A-IV proximal promoter sequence and high- and low-TG nuclear extracts demonstrated three regions protected by the low-TG extracts: AAGGCCG (-156 to -150 bp), ACCTTC (-186 to -181 bp), and CCTCC (-203 to -199 bp) (Fig. 4). Of these three motifs, only ACCTTC showed 100% homology to the human sequence (Fig. 3) and was further studied. Extracts from a newborn swine intestinal epithelial cell line (IPEC-1), untreated with fatty acid, also protected these regions. Interestingly, nuclear extracts from swine hepatocytes and HeLa cells, which do not express apo A-IV, also exhibited these same protected regions.


View larger version (69K):
[in this window]
[in a new window]
 
Fig. 4.   DNAse I DNA protection assay using the swine apo A-IV proximal promoter as probe incubated with nuclear extracts from jejunal enterocytes of 2-day-old swine receiving high-or low-TG diets with the extracts combined (lanes 1 and 2); 2-day-old swine liver (lanes 3 and 4); HeLa cells (lane 5); IPEC-1 cells cultured without added fatty acid (lanes 6 and 7); jejunal enterocytes of 2-day-old swine receiving a low-TG diet (lanes 8 and 9); jejunal enterocytes of 2-day-old swine receiving a high-TG diet (lanes 10 and 11). Lanes 1, 3, 5, 6, 8, and 10 contain 5 µg nuclear extract protein; lanes 2, 4, 7, 9, and 11 contain 2.5 µg nuclear extract protein. Results shown are representative of 3 separate experiments.

EMSA. When the entire swine apo A-IV proximal promoter sequence was used as a probe in EMSA analysis using low- and high-TG nuclear extracts in progressively increasing equivalent amounts, a progressive shift was noted with the low-TG extracts compared with the high-TG extracts (Fig. 5). This finding suggested that enhanced protein binding occurred under conditions of low-TG absorption compared with conditions of high-TG absorption.


View larger version (66K):
[in this window]
[in a new window]
 
Fig. 5.   EMSA assay using the entire proximal apo A-IV promoter as a double-stranded probe. High-TG (left) and low-TG (right) nuclear extracts were added in progressively increasing equivalent amounts. Results shown are representative of 3 separate experiments.

EMSA was performed using probes containing the wild-type motif (GAATGTGTCACCTTCCAGCGTGGAG) and a mutant motif (GAATGTGTCAACTGCCAGCGTGGAG) (Fig. 6). A shift was noted with the low-TG nuclear extracts. When the labeled probe containing the mutant motif was used, no shift occurred. Also, excess unlabeled free wild-type probe competed out the shift, whereas the mutant probe did not. No significant shift occurred with either probe using extracts from the animals fed the high-TG diet. These results suggest that a repressor protein binds to the ACCTTC motif and becomes unbound during lipid absorption, allowing transcriptional activation of the apo A-IV gene in newborn swine small intestine.


View larger version (85K):
[in this window]
[in a new window]
 
Fig. 6.   EMSA assay using double-stranded oligonucleotide probes containing the wild-type (WT) ACCTTC motif and a mutant (M) AACTGC sequence. Nuclear extracts from jejunal enterocytes from 2-day-old swine receiving a low-TG diet were used (top) and from animals receiving a high-TG diet were used (bottom). Lanes 1-2, labeled WT probe; lanes 3-4, labeled M probe; lanes 5-8, negative controls; lane 9, labeled WT probe + unlabeled WT probe; lane 10, labeled WT probe + unlabeled M probe; lane 11, labeled M probe + unlabeled WT probe; lane 12, labeled M probe + unlabeled M probe. Results shown are representative of 3 separate experiments.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In the present studies, we describe a novel and previously unreported potential mechanism for the transcriptional activation of the apo A-IV gene by dietary lipid in the newborn swine proximal small intestine. Our results suggest that a repressor protein may bind to the ACCTTC motif in the apo A-IV proximal promoter in the absence of dietary lipid flux. This protein appears to dissociate from its binding site on the promoter during lipid absorption, possibly allowing transcriptional activation of the apo A-IV gene in newborn swine small intestine. This regulatory mechanism may be important in the striking induction of jejunal apo A-IV expression by dietary lipid in the neonatal mammal.

Several cis- and trans-acting regulatory elements have been identified for the apo A-I/C-III/A-IV gene cluster (5, 25). Most of these elements have been described through in vitro studies using the HepG2 hepatocyte and Caco-2 enterocyte cell lines and, for the most part, appear to regulate basal and tissue-specific expression of the genes in this cluster. Recently, studies of transgenic mice demonstrated that the upstream -700/-310 fragment of the apo A-IV gene combined with the -890/-500 apo C-III enhancer is sufficient to direct a pattern of reporter gene expression similar to that of the endogenous apo A-IV gene (26). However, responsiveness of reporter gene expression to lipid absorption was not studied in these animals.

In a few instances, fatty acids have been shown to regulate transcription of genes in this cluster, as well as other genes involved in lipid transport and metabolism, through pathways involving specific transcription factors. Peroxisome proliferator-activated receptors (PPARs) are polypeptide nuclear receptors related structurally to members of the steroid/thyroid receptor superfamily. PPARs bind to specific DNA sequences (PPAR response elements) as heterodimers with the retinoid X receptor (RXR) to effect transcriptional regulation of several genes involved in fatty acid oxidation, TG hydrolysis, adipogenesis, cell differentiation, cytokine production, and inflammation (21). Recently, hepatic nuclear factor-4 (HNF-4), another member of the steroid/thyroid receptor superfamily, which functions as a transcription activator, has been shown to be an important regulator of this gene complex. In one report (20a), fatty acyl-CoA thioesters were shown to bind to HNF-4 and modulate transcriptional activation. However, the motif identified in our study does not share similarity with the PPAR or HNF-4 response elements. Other transcription factors involved in the expression of the genes in this cluster, including that of apo A-IV, have not been reported to have any responsiveness to lipid or to bind to elements with similarity to the sequence of the motif identified in the present studies, with the exception of retinoid acid receptor-alpha (RAR-alpha ).

The transcription factor RAR-alpha , which has the binding motif TsTsACCTyy (where s = G or C and y = C or T), is a possible candidate for the protein that binds to the (TGTC)ACCTTC motif in the present studies (3). However, several lines of evidence suggest that this transcription factor is a very unlikely possibility. RAR-alpha is a ligand for 9-cis and all-trans retinoic acid and usually binds as a homodimer to direct repeats, palindrome, or inverted palindrome sequences or as a heterodimer with another nuclear hormone superfamily member, particularly the RXR (3). RAR-alpha is not known to be activated by fatty acids. Furthermore, the ACCTTC motif identified in the swine apo A-IV proximal promoter in the present study does not have any flanking sequences identifiable as binding motifs of any transcription factor known to dimerize with RAR-alpha .

There are several potential mechanisms by which intestinal lipid absorption may interact with the putative repressor described in this report, as well as with other possible regulatory regions in the apo A-IV/C-III intergenic region, to regulate apo A-IV gene transcription. Luminal lipid may initiate the release of gastrointestinal hormones or other factors that serve as the signal for release of the repressor protein from the promoter. Ileal, but not jejunal, infusion of TG in the adult rat was shown to upregulate apo A-IV expression in ileum and segments of jejunum isolated from the nutrient stream in Thiry-Vella fistulas (23). Massive small bowel resection in rats has also been shown to rapidly upregulate apo A-IV mRNA levels severalfold in remnant ileum within 48 h (31). Therefore, it is possible that factors other than direct uptake of fatty acid by the enterocyte may regulate apo A-IV gene transcription.

Fatty acids derived from dietary TG digestion may exert effects at the enterocyte level via several potential pathways (11). The fatty acid may activate a signal transduction pathway that ultimately alters the DNA binding affinity of the putative repressor protein. Alternatively, the fatty acid may bind to a protein that interacts with the putative repressor, or the fatty acid may bind directly to the repressor protein, thereby altering its DNA binding affinity. Contrary to findings in the adult rat (22), dietary triacylglycerols comprised of medium-chain-length fatty acids are as effective as those containing long-chain-length fatty acids in the induction of apo A-IV mRNA expression in newborn swine jejunum (8). This implies that the fatty acid does not have to be reesterifed to TG in the endoplasmic reticulum to exert its regulatory effect, because medium-chain fatty acids are not reesterified or incorporated into chylomicrons. However, these potential regulatory mechanisms are purely speculative at present.

In summary, we have identified a DNA binding protein that attaches to a unique site on the swine apo A-IV gene proximal promoter under conditions of low dietary TG intake. With a high-TG diet, this protein becomes unbound with a concomitant increase in apo A-IV gene transcription. The binding motif for this protein occurs at three additional sites in the swine apo A-IV/C-III intergenic region, which may also play a role in the regulation of the expression of these genes by dietary lipid in the newborn animal. We suspect that this regulatory mechanism may be specific to the newborn, because the induction of apo A-IV expression is markedly less responsive to dietary lipid near weaning in swine jejunum (7). Efforts are currently underway to isolate and further characterize this putative repressor protein that may play a key role in the regulation of apo A-IV gene expression by intestinal lipid absorption in the neonate.


    ACKNOWLEDGEMENTS

This work was supported by National Institute of Child Health and Human Development Grant R01-HD-22551 (to D. D. Black) and by the Children's Foundation Research Center of Memphis at Le Bonheur Children's Medical Center (to D. D. Black).


    FOOTNOTES

Address for reprint requests and other correspondence: D. D. Black, Children's Foundation Research Center of Memphis, Le Bonheur Children's Hospital, Rm. 401, W. Patient Tower, 50 N. Dunlap, Memphis, TN 38103 (E-mail: dblack{at}utmem.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published October 16, 2002;10.1152/ajpgi.00391.2002

Received 11 September 2002; accepted in final form 12 October 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Abmayr, SM, and Workman JL. Preparation of nuclear and cytoplasmic extracts from mammalian cells. In: Current Protocols in Molecular Biology, edited by Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, and Struhl K.. New York: Wiley, 1996, p. 12.12.11-12.11.19.

2.   Apfelbaum, TF, Davidson NO, and Glickman RM. Apolipoprotein A-IV synthesis in the rat small intestine: regulation by dietary triglyceride. Am J Physiol Gastrointest Liver Physiol 252: G662-G666, 1987[Abstract/Free Full Text].

3.   Aranda, A, and Pascual A. Nuclear hormone receptors and gene expression. Physiol Rev 81: 1269-1304, 2001[Abstract/Free Full Text].

4.   Bisgaier, CL, Sachdev OP, Megna L, and Glickman RM. Distribution of apolipoprotein A-IV in human plasma. J Lipid Res 26: 11-25, 1985[Abstract].

5.   Black, DD. Intestinal apolipoprotein gene expression. In: Intestinal Lipid Metabolism, edited by Mansbach CM, Tso P, and Kuksis A.. New York: Kluwer Academic/Plenum, 2001, p. 263-284.

6.   Black, DD, and Rohwer-Nutter PL. Intestinal apolipoprotein synthesis in the newborn piglet. Pediatr Res 29: 32-38, 1991[Web of Science][Medline].

7.   Black, DD, Rohwer-Nutter PL, and Davidson NO. Intestinal apo A-IV gene expression in the piglet. J Lipid Res 31: 497-505, 1990[Abstract].

8.   Black, DD, Wang H, Hunter F, and Zhan R. Intestinal expression of apolipoprotein A-IV and C-III is coordinately regulated by dietary lipid in newborn swine. Biochem Biophys Res Commun 221: 619-624, 1996[Web of Science][Medline].

9.   Bradford, MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248-254, 1978.

10.   Chen, CH, and Albers JJ. Activation of lecithin: cholesterol acyltransferase by apolipoproteins E-2, E-3, and A-IV isolated from human plasma. Biochim Biopys Acta 836: 279-285, 1985[Medline].

11.   Duplus, E, Glorian M, and Forest C. Fatty acid regulation of gene transcription. J Biol Chem 275: 30749-30752, 2000[Free Full Text].

12.   Dvorin, E, Gorder NL, Benson DM, and Gotto J AM. Apolipoprotein A-IV: a determinate for binding and uptake of high density lipoproteins by rat hepatocytes. J Biol Chem 261: 15714-15718, 1986[Abstract/Free Full Text].

13.   Elshourbagy, NA, Walker DW, Boguski MS, Gordon JI, and Taylor JM. The nucleotide and derived amino acid sequence of human apolipoprotein A-IV mRNA and the close linkage of its gene to the genes of apolipoproteins A-I and C-III. J Biol Chem 261: 1998-2002, 1986[Abstract/Free Full Text].

14.   Elshourbagy, NA, Walker DW, Paik YK, Bogusk MS, Freeman M, Gordon JI, and Taylor JM. Structure and expression of the human apolipoprotein A-IV gene. J Biol Chem 262: 7973-7981, 1987[Abstract/Free Full Text].

15.   Fidge, NH. The redistribution and metabolism of iodinated apolipoprotein A-IV in rats. Biochim Biophys Acta 619: 129-141, 1980[Medline].

16.   Fujimoto, K, Cardelli JA, and Tso P. Increased apolipoprotein A-IV in rat mesenteric lymph after lipid meal acts as a physiological signal for satiation. Am J Physiol Gastrointest Liver Physiol 262: G1002-G1006, 1992[Abstract/Free Full Text].

17.   Fujimoto, K, Fukagawa K, Sakata T, and Tso P. Suppression of food intake by apolipoprotein A-IV is mediated through the central nervous system in rats. J Clin Invest 91: 1830-1833, 1993[Web of Science][Medline].

18.   Goldberg, IJ, Scheraldi CA, Yacoub LK, Saxena U, and Bisgaier CL. Apolipoprotein C-II activation of lipoprotein lipase: modulation by apolipoprotein A-IV. J Biol Chem 265: 4266-4272, 1990[Abstract/Free Full Text].

19.   Green, PHR, Glickman RM, Riley JW, and Quinet E. Human apolipoprotein A-IV: intestinal origin and distribution in plasma. J Clin Invest 65: 911-919, 1980[Web of Science][Medline].

20.   Greenberg, ME, and Bender TP. Identification of newly transcribed RNA. In: Current Protocols in Molecular Biology, edited by Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, and Struhl K.. New York: Wiley, 1996, p. 4.10.11-14.10.11.

20a.   Hertz, R, Magenheim J, Berman I, and Bar-Tana J. Fatty acyl-CoA thioesters are ligands of hepatic nuclear factor-4alpha . Nature 392: 512-516, 1998[Medline].

21.   Jump, DB, and Clarke SD. Regulation of gene expression by dietary fat. Annu Rev Nutr 19: 63-90, 1999[Web of Science][Medline].

22.   Kalogeris, TJ, Monroe F, Demichele SJ, and Tso P. Intestinal synthesis and lymphatic secretion of apolipoprotein A-IV vary with chain length of intestinally infused fatty acids in rats. J Nutr 126: 2720-2729, 1996[Abstract/Free Full Text].

23.   Kalogeris, TJ, Tsuchiya T, Fukagawa K, Wolf R, and Tso P. Apolipoprotein A-IV synthesis in proximal jejunum is stimulated by ileal lipid infusion. Am J Physiol Gastrointest Liver Physiol 270: G277-G286, 1996[Abstract/Free Full Text].

24.   Karathanasis, SK. Apolipoprotein multigene family: tandem organization of human apolipoprotein AI, CIII, and AIV genes. Proc Natl Acad Sci USA 82: 6374-6378, 1985[Abstract/Free Full Text].

25.   Kardassis, D, Laccotripe M, Talianidis I, and Zannis V. Transcriptional regulation of the genes involved in lipoprotein transport: the role of proximal promoters and long-range regulatory elements and factors in apolipoprotein gene regulation. Hypertension 27: 980-1008, 1996[Free Full Text].

26.   Le Beyec, J, Chauffeton V, Kan HY, Janvier PL, Cywiner-Golenzer C, Chatelet FP, Kalopissis AD, Zannis V, Chambaz J, Pincon-Raymond M, and Cardot P. The -700/-310 fragment of the apolipoprotein A-IV gene combined with the -890/-500 apolipoprotein C-III enhancer is sufficient to direct a pattern of gene expression similar to that for the endogenous apolipoprotein A-IV gene. J Biol Chem 274: 4954-4961, 1999[Abstract/Free Full Text].

27.   Lu, S, Yao Y, Meng S, Cheng X, and Black DD. Overexpression of apolipoprotein A-IV enhances lipid transport in newborn swine intestinal epithelial cells. J Biol Chem 277: 31929-31937, 2002[Abstract/Free Full Text].

28.   Mansbach, CM. Triacylglycerol movement in enterocytes. In: Intestinal Lipid Metabolism, edited by Mansbach CM, Tso P, and Kuksis A.. New York: Kluwer Academic/Plenum, 2001, p. 215-229.

29.   Okumura, T, Fukagawa K, Tso T, Taylor IL, and Pappas TN. Intracisternal injection of apolipoprotein A-IV inhibits gastric secretion in pylorus-ligated conscious rats. Gastroenterology 107: 1861-1864, 1994[Web of Science][Medline].

30.   Qin, X, Swertfeger DK, Zheng S, Hui DY, and Tso P. Apolipoprotein A-IV: a potent endogenous inhibitor of lipid oxidation. Am J Physiol Heart Circ Physiol 274: H1836-H1840, 1998[Abstract/Free Full Text].

31.   Rubin, DC, Swietlicki EA, Wang JL, Dodson BD, and Levin MS. Enterocytic gene expression in intestinal adaptation: evidence for a specific cellular response. Am J Physiol Gastrointest Liver Physiol 270: G143-G152, 1996[Abstract/Free Full Text].

32.   Stein, O, Stein Y, Lefevre M, and Roheim PS. The role of apolipoprotein A-IV in reverse cholesterol transport studied with cultured cells and liposomes derived from an ether analog of phosphotidylcholine. Biochim Biophys Acta 878: 7-13, 1986[Medline].

33.   Steinmetz, A, and Utermann G. Activation of lecithin: cholesterol acyltransferase by human apolipoprotein A-IV. J Biol Chem 260: 2258-2264, 1985[Abstract/Free Full Text].


Am J Physiol Gastrointest Liver Physiol 284(2):G248-G254
0193-1857/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
S. Leng, S. Lu, Y. Yao, Z. Kan, G. S. Morris, B. R. Stair, M. A. Cherny, and D. D. Black
Hepatocyte nuclear factor-4 mediates apolipoprotein A-IV transcriptional regulation by fatty acid in newborn swine enterocytes
Am J Physiol Gastrointest Liver Physiol, August 1, 2007; 293(2): G475 - G483.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Carriere, R. Vidal, K. Lazou, M. Lacasa, F. Delers, A. Ribeiro, M. Rousset, J. Chambaz, and J. M. Lacorte
HNF-4-dependent Induction of Apolipoprotein A-IV Gene Transcription by an Apical Supply of Lipid Micelles in Intestinal Cells
J. Biol. Chem., February 18, 2005; 280(7): 5406 - 5413.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
P. Tso, W. Sun, and M. Liu
Gastrointestinal Satiety Signals IV. Apolipoprotein A-IV
Am J Physiol Gastrointest Liver Physiol, June 1, 2004; 286(6): G885 - G890.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/2/G248    most recent
00391.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lu, S.
Right arrow Articles by Black, D. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lu, S.
Right arrow Articles by Black, D. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online