AJP - GI Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 284: G269-G279, 2003. First published October 9, 2002; doi:10.1152/ajpgi.00226.2002
0193-1857/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/2/G269    most recent
00226.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (15)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tessner, T. G.
Right arrow Articles by Stenson, W. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tessner, T. G.
Right arrow Articles by Stenson, W. F.
Vol. 284, Issue 2, G269-G279, February 2003

Basic fibroblast growth factor upregulates cyclooxygenase-2 in I407 cells through p38 MAP kinase

Teresa G. Tessner1, Filipe Muhale1, Suzanne Schloemann1, Steven M. Cohn2, Aubrey Morrison3, and William F. Stenson1

1 Division of Gastroenterology, 3 Department of Medicine and Molecular Biology and Pharmacology, Washington University, St. Louis, Missouri 63110; and 2 Division of Gastroenterology and Hepatology, University of Virginia, Charlottesville, Virginia 22904


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The intestinal cell line I407 responds to basic fibroblast growth factor (bFGF) by upregulating cyclooxygenase-2 (COX-2) mRNA and protein expression and increasing PGE2 production. bFGF treatment of I407 cells results in phosphorylation of p38, and the p38 inhibitor SB-203580 abrogates bFGF-induced PGE2 synthesis. Wild-type p38alpha (p38alpha WT) and dominant-negative p38alpha (p38alpha DN) stable transfectant clones of I407 cells were used to examine the role of the p38 MAP kinase pathway in the events controlling PGE2 synthesis after treatment with bFGF. Treatment of p38alpha WT clones with bFGF resulted in increased COX-2 protein levels and PGE2 synthesis similar to those seen in bFGF-treated control-transfected cells. In contrast, the p38alpha DN clones failed to upregulate COX-2 protein or increase PGE2 synthesis when treated with bFGF. Exogenous arachidonate did not restore PGE2 synthesis by p38alpha DN cells. bFGF treatment increased COX-2 mRNA stability, and the p38 inhibitor SB-203580 attenuated COX-2 mRNA stability in bFGF-treated I407 cells. These data demonstrate a crucial role for p38alpha in growth factor-induced PGE2 synthesis by intestinal cells. Furthermore, they indicate that p38 activity is required at a step distal to arachidonate release, most likely COX-2 upregulation, because exogenous arachidonate did not restore PGE2 synthesis.

intestinal epithelial cells; intestinal injury and repair; arachidonic acid metabolism; mRNA stability.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

THE FIBROBLAST GROWTH FACTOR (FGF) family affects the proliferation, differentiation, and migration of intestinal epithelial cells in vitro (3, 5, 22, 45). In addition, members of this family are known to be associated with intestinal pathology, including inflammatory bowel disease and cancer (3, 5, 10, 22, 44, 45). The effect of FGFs on biological events involved in repair as well as the broad range of cell types that respond to these growth factors make them prime candidates as mediators of the intestinal response to injury (3, 4, 22, 27, 45). Indeed, one member of the FGF family, basic FGF (bFGF), has been shown to increase intestinal stem cell survival in the mouse after radiation injury, as measured by the number of regenerative crypts (18). The signaling events initiated by bFGF and how these downstream targets ultimately converge to affect stem cell survival remains unclear.

Prostaglandins are known modulators of the intestinal response to radiation injury. bFGF induces prostaglandin synthesis in a variety of cell types, often in the context of angiogenesis or tissue remodeling/healing (23, 26, 30). When a stable analog of PGE2, dimethyl PGE2, is given to mice before radiation, the number of surviving crypts is increased (15). Although dimethyl PGE2 given alone after radiation does not change crypt survival, it does reverse the ability of indomethacin to suppress the number of crypts surviving radiation injury (6). Similarly, irradiated cyclooxygenase (COX)-1-/- mice show a reduced number of surviving crypts and an increased number of apoptotic cells compared with their wild-type littermates (19). Together, these data raise the possibility that bFGF modulates radiation injury through the induction of prostaglandins.

Much of the work regarding FGF signal transduction has centered on the proliferative effects of these growth factors and has emphasized the ERK signal-transduction module. Less is known regarding the ability of FGFs to interact with other signal-transduction modules such as p38 MAPK, Src, protein kinase C, phospholipase Cgamma , and phosphatidylinositol 3' kinase. The relative contributions of activation of these different signaling pathways to the biological effects of bFGF are unknown. At least two FGF-induced effects, proliferation and migration, are activated through different signaling pathways (Src and p38, respectively) (4, 27). Most studies regarding the ability of bFGF to activate p38 have concentrated on endothelial cells and the role of p38 in migration and angiogenesis. Whether bFGF stimulation of intestinal epithelial cells results in activation of p38 and the downstream consequences of this activation has not been explored previously.

The COX-2 gene is commonly upregulated by two general classes of mediators: growth factors and inflammatory cytokines. Depending on the stimulus and cell target, the NF-kappa B signaling pathway and/or any one of the MAPK modules may be involved in activating COX-2 expression (40). The COX-2 promoter contains a number of potential regulatory elements; one of these elements, the ATF/CRE site, binds transcription factor complexes whose formation can be modulated by activation of p38 (40). Although small molecule inhibitors of p38 have been used to demonstrate a requirement for p38 in upregulated COX-2 expression (8, 11, 12, 14, 21, 37, 41), the contribution of p38-dependent transcriptional activation to the observed increase in COX-2 expression has been explored less extensively. Posttranscriptional regulation also plays a significant role in induced COX-2 expression (7, 9, 16). Run-on experiments indicate that increased transcription accounts for only a small component of the observed increase in COX-2 mRNA in some cell types treated with inflammatory stimuli. For stimuli such as IL-1beta , LPS, and TNF-alpha , message stabilization appears to be the primary mechanism in COX-2 induction (2, 20). Not surprisingly, the stress-activated MAPK, p38, appears to be required for this enhanced stability (8, 11, 12, 21, 29, 35). Message stabilization also contributes to the induced levels of COX-2 observed in "growth-stimulated" cells such as colonic carcinomas (37), transforming growth factor (TGF)-beta -stimulated (39), or ceramide and bile acid-treated ras-transformed rat intestinal cells (47), IFN-gamma -stimulated keratinocytes (31), and nucleotide-stimulated (46) or angiotensin II (33)-treated smooth muscle cells. In most but not all of these instances, p38 also appears to play a role in COX-2 mRNA stability (31, 33, 47). The ability of bFGF to upregulate COX-2 through a p38-dependent mechanism has not previously been evaluated.


    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Cell culture and transfected cell lines. The human intestinal cell line I407 (American Type Culture Collection; Manassas, VA) was maintained in basal medium Eagle with Earl's salts (GIBCO-BRL; Grand Island, NY) supplemented with 6 mM glutamine, 10% heat-inactivated fetal calf serum, and antibiotics (penicillin 50 U/ml and streptomycin 50 µg/ml). Control-transfected, p38alpha wild-type (p38alpha WT), and p38alpha dominant-negative (p38alpha DN) stable transfectant cell lines were maintained in the above media supplemented with G-418 as the antibiotic, but were cultured for 1 wk in the absence of G-418 before use in experiments. Briefly, 50-80% confluent cultures of I407 cells seeded in six-well tissue culture plates were transfected with FuGENE 6 reagent (Roche; Indianapolis, IN) according to the manufacturer's guidelines at a ratio of 3:2 FuGENE/DNA and 2 µg DNA/well. pCMV-p38alpha wild-type and pCMV-p38alpha dominant-negative (Thr180 and Tyr182 replaced with Ala and Phe, respectively) expression plasmids used for transfection were obtained from Dr. R. Davis, Howard Hughes Medical Institute. pcDNA 3.1 (Invitrogen; Carlsbad, CA) was used as the empty vector for control transfections. After overnight exposure to the DNA/FuGENE complex, the media was changed, and two days later, cultures were placed into media containing 1.2 mg/ml G-418 for selection of stable transfectant clones.

The human adenocarcinoma cell lines HT-29 and Caco-2 were grown in Dulbecco's modified Eagle's medium (BioWhittaker; Walkersville, MD) supplemented with 10% heat-inactivated fetal calf serum, antibiotics (as above), 10 mM nonessential amino acids, and an additional 200 mM glutamine.

COX mRNA and protein levels. The ability of bFGF to regulate COX-2 was determined by stimulating subconfluent I407 cells with bFGF (Scios-Nova; Mountainview, CA) at 10 ng/ml plus heparin at 10 µg/ml. Subconfluent HT-29 or Caco-2 cells were serum starved (0.1% fetal calf serum) overnight and then stimulated with bFGF (as for I407 cells) in media containing 0.1% fetal calf serum with or without the p38 inhibitor SB-203580 (10 µM). At the indicated times, cells were lysed with Laemmli buffer for subsequent detection of COX-2 protein by Western analysis or lysed with a guanidine thiocyanate-based solution (Ambion Direct Protect kit) for subsequent ribonuclease protection assays.

For Western analysis, lysates were separated by SDS-PAGE, blotted to Immobilon-P membrane (Millipore; Bedford, MA), and COX-2 protein detected using an anti-COX-2 antibody from Santa Cruz Biotechnology (Santa Cruz, CA) according to the protocol suggested by the supplier. Immunoreactive protein was detected by enhanced chemiluminescence (ECL) reagent (Amersham, Piscataway, NJ) and corrected to actin determined by reprobing the same blot (antibody from Santa Cruz). COX-1 protein expression was determined in the same manner using a COX-1 antibody from Santa Cruz.

COX-2 mRNA levels were evaluated using the Direct Protect ribonuclease protection kit from Ambion (Austin, TX). The 400-nucleotide antisense human COX-2 32P-labeled probe was generated using SalI linearized plasmid (gift of Dr. J. Masferrer, Pharmacia) and T7 polymerase (Maxiscript kit, Ambion). The 32P-labeled cyclophilin probe was generated using a template from Ambion. After gel purification of the probes, they were combined with the cell lysate, and the ribonuclease protection assay was performed as directed in the kit instructions. Protected fragments were separated by electrophoresis, and radioactivity was detected using autoradiography on Kodak Biomax MR film or using the PhosphorImager SI (Molecular Dynamics; Sunnyvale, CA). The COX-2 signal was corrected to cyclophilin. COX-1 mRNA levels were determined in a similar manner. For COX-1 RPAs, a 240-nucleotide antisense COX-1 32P-labeled probe was generated from an EcoRV-linearized plasmid from Dr. J. Masferrer (Pharmacia) using T7 polymerase.

COX-2 mRNA stability. For experiments determining the stability of COX-2 mRNA, COX-2 mRNA levels were evaluated using real-time RT-PCR. Cells were stimulated for 1 h with bFGF followed by the addition of dichlorobenzimidazole riboside (DRB; 100 µM) or DRB and the p38 inhibitor SB-203580 (10 µM) for the indicated times. RNA was isolated using TriZOL (Invitrogen) and reverse transcribed using Superscript II RT (Invitrogen) with random hexamers according to the manufacturer's instructions. Real-time PCR was performed in an iCycler (Bio-Rad; Hercules, CA) using SYBR Green PCR master mix (Applied Biosystems). COX-2 primers (0.2 µM each) were forward: 5'-ATC CTG AAT GGG GTG ATG AG-3'; reverse: 5'-GCC ACT CAA GTG TTG CAC AT-3'. GAPDH primers (0.3 µM each) were forward: 5'-GAA GGT GAA GGT CGC AGT C-3'; reverse: 5'-GAA GGT GAT GGG ATT TC-3'. Reaction conditions were as follows: 10 min at 95°C, then 40 cycles of 95°C (15 s) and 60°C (60 s), with data acquisition during the 1-min 60°C step. Melt analysis was used to confirm PCR products.

Transcriptional activation of the COX-2 promoter by bFGF. I407 cells were transfected with a human COX-2 promoter/luciferase reporter plasmid containing the region -1432/+59 of the human COX-2 promoter in the pGL3 reporter plasmid (generously supplied by Dr. T. Tanabe, National Cardiovascular Research Institute, Japan). Control vectors for promoter activity were pGL3-basic (negative control; Promega) and pGL3-control (positive control; Promega). pSV-beta -galactosidase vector (Promega) was cotransfected as a transfection control. Subconfluent cells in 12-well plates were transfected using FuGENE 6 as suggested by the manufacturer at a ratio of 3:1 FuGENE 6 to DNA. Each well of cells received a total of 0.3 ug DNA (0.2 ug of the promoter reporter plasmid and 0.1 ug of the transfection control plasmid). Twenty-four hours later, the transfected cells were placed into fresh media with or without bFGF as described above. For experiments using the p38 MAPK inhibitor, SB-203580 (10 µM) was added 1 h before the media change and was included during the treatment period. At the indicated times after stimulation, cells were lysed and luciferase and beta -galactosidase activity was assayed using kits from Promega.

As a positive control for the promoter activity of the human COX (hCOX)-2 plasmid, I407 cells were transfected as above with the pSV-beta -galactosidase and hCOX-2 promoter/luciferase plasmids. Approximately 30 h after the start of transfection, cells were serum-starved overnight (media containing 0.1% fetal calf serum) and then incubated with various stimuli for the indicated times. Luciferase and beta -galactosidase activities were then assayed as described above.

p38 Activation. To determine the time course of p38 activation, equivalent amounts of protein from bFGF-stimulated I407 cells were separated by SDS-PAGE, blotted to Immobilon-P, and probed with an antibody specific for the dually phosphorylated form of p38 (Cell Signaling Technology; Beverly, MA) using the protocol suggested by the supplier.

PGE2 enzyme immunoassay. PGE2 levels were determined by analyzing the media from cells stimulated with bFGF using a kit from Cayman (Ann Arbor, MI) as described above. For time course experiments, media were collected every 12 h and replaced with fresh media. Inhibitors were added at the time of stimulation and at the time of media replacement. In experiments testing the effect of exogenous arachidonate on PGE2 synthesis, cells were stimulated for either 2 or 24 h with bFGF; the media was then replaced with fresh media containing vehicle or 10 µM arachidonate and collected after 15 min.

FGF receptor expression. Whole cell lysates were prepared from I407 cells grown to various cell densities in 25-ml flasks. The monolayers were washed with PBS, 1 ml lysate buffer [N-Tris-(hydroxymethyl)methyl-2-aminoethane sulfonic acid (TES); 20 mM], pH 7.4, 2 mM DTT, 10% glycerol, 25 µg/ml each antipain, aprotinin, leupeptin, and chymostatin, 50 µM phenanthrolene, 10 ug/ml pepstatin A, 10 mM sodium pyrophosphate, 100 mM sodium fluoride, 200 µM sodium orthovanadate, 0.1 mM PMSF, and 1% Triton X-100 was pipetted onto each. The flasks were incubated for 30 min at 4°C, and lysates were collected into 1.5-ml tubes and cleared by spinning 15 min at 10,000 g at 4°C. The supernatants were transferred to a clean tube, then aliquotted and frozen at -20°C. Protein concentration was determined by the Bradford protein assay (Bio-Rad).

Proteins were resolved on polyacrylamide gels (4-15% gradient Ready Gels; Bio-Rad) and transferred to polyvinylidene difluoride membranes by electrophoretic transfer. The proteins were fixed and stained with 0.1% Coommassie blue in 10% acetic acid, 40% methanol to confirm that the proteins had transferred. They were rewet with methanol, reequilibrated with H2O, and blocked overnight in 10 mM Tris-Cl, pH 8.0, 150 mM NaCl, 0.05% Triton X-100 (TBST) with 5% dry milk at 4°C. The primary antibodies used to identify the receptor proteins were the anti-FGF receptors anti-FR-1 (C15; Santa Cruz), anti-FR-2 (C17; Santa Cruz), anti-FR-3 (C15; Santa Cruz), and anti-FR-4 (C16; Santa Cruz). The membranes were incubated for 1-1.5 h with primary antibody at 1 µg/ml in TBST, washed in TBST, and then incubated for 1 h at room temperature or overnight at 4°C with anti-rabbit IgG conjugated to horseradish peroxidase at the manufacturer's recommended concentration. Bound antibodies were detected using ECL (Amersham).

FGF receptor (FGFR) expression was confirmed using RT-PCR. Total RNA was isolated from subconfluent, growing cultures of I407 as well as Caco-2 cells using the RNeasy miniprep (Qiagen) and reverse transcribed using Superscript II RT (Invitrogen) with random hexamers according to the manufacturer's instructions. Real-time PCR was performed with the SD-S7000 (Applied Biosystems; Foster City, CA) using SYBR Green PCR master mix (Applied Biosystems). Primer pairs for each of the four receptors were designed using Primer Express software (Applied Biosystems) and were as follows: 1) FGFR1, forward: 5'-CACGGGACATTCACCACATC-3', reverse: 5'- GGGTGCCATCCACTTCACA-3'; 2) FGFR2, forward: 5'-AACGTTCAAGCAGTTGGTAGAAGAC-3', reverse: 5'-CAGGGTAACTAGGTGAATACTGTTCGA-3'; 3) FGFR3, forward: 5'-ACGGCACACCCTACGTTACC-3', reverse: TGTGCAAGGAGAGAACCTCTAG CT-3'; 4) FGFR4, forward: 5'-TGGCTGAAGCACATCGTCAT-3', reverse: 5'- TCCACCTCTGAGCTATTGATGTCT-3'. Primers were used each at 0.25 µM. Reaction conditions were as follows: 2 min at 50°C, then 1 cycle of 95°C (10 min) and 34 cycles of 95°C (15 s), then 60°C (60 s) with data acquisition during the 1-min 60°C step. Melt analysis was used to confirm PCR products. Subsequently, PCR products were resolved by electrophoresis in a 1% agarose gel and visualized by photographing under ultraviolet light using Polapan 667 film (Polaroid).


    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In our study of the regulation of COX-2 expression by bFGF, we first examined the expression of FGFRs in I407 cells by Western blot analysis (Fig. 1). Each of the FGFR antibodies used was directed toward an epitope on the COOH terminus of the receptor. FR-3 was easily detectable by Western blotting in both preconfluent (50%) and confluent cultures of I407 cells. Low levels of FR-1, -2, and -4 could also be detected on prolonged exposures of Western blots from both preconfluent and confluent cultures. There was no change in expression of any of the FGFRs with the degree of confluence of the cell cultures. RT-PCR indicated the presence of FR-1, -3, and -4 in I407 cells (Fig. 1E)


View larger version (61K):
[in this window]
[in a new window]
 
Fig. 1.   Fibroblast growth factor (FGF) receptor expression. The expression of FGF receptors by preconfluent (Pre) and confluent (Conf) I407 cells was investigated by Western blot analysis as described in MATERIALS AND METHODS. A: FGF receptor antibody (FR)-1, FGF receptor 1; B: FR-2, FGF receptor 2; C: FR-3, FGF receptor 3; D: FR-4, FGF receptor 4. E: expression of FGF receptor mRNA in I407 and Caco-2 cultures. RNA was prepared from preconfluent I407 (I) or Caco-2 (C) cells. RT-PCR was performed for each of the FGF receptors as described in the MATERIALS AND METHODS, and the resulting amplified fragments were resolved by agarose gel electrophoresis. Samples omitting the reverse transcriptase (-RT) were included as a control for contaminating genomic DNA.

I407 cells stimulated with bFGF began synthesizing PGE2 within 12 h (Fig. 2). PGE2 production remained elevated for 36 h and was inhibited by both indomethacin, a nonselective COX inhibitor, and by NS-398, a selective COX-2 inhibitor (Fig. 2). Concomitant with increased PGE2 synthesis, bFGF-stimulated cells also rapidly upregulated COX-2 mRNA (Fig. 3A) and COX-2 protein (Fig. 3B). Neither COX-1 mRNA, nor protein levels were increased with bFGF treatment (data not shown). These data indicate that bFGF upregulates PGE2 synthesis in I407 cells through a COX-2-dependent mechanism.


View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2.   Time course of PGE2 production by I407 cells stimulated with basic FGF (bFGF). Cells were treated with media alone, bFGF, bFGF + 10 µM indomethacin, or bFGF + 10 µM NS-398. Media were collected every 12 h and replaced with fresh media containing the appropriate inhibitor. PGE2 in the media was determined as indicated in MATERIALS AND METHODS. Data are the means ± SE of replicate wells assayed in duplicate and are representative of at least 2 separate experiments.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 3.   Cyclooxygenase (COX)-2 induction in bFGF-stimulated I407 cells. A: bFGF increases COX-2 mRNA. At the indicated times, control and bFGF-stimulated cells were lysed and ribonuclease protection assays were performed as described in MATERIALS AND METHODS. Data are the means ± SE of duplicate samples corrected to cyclophilin and are representative of at least 2 independent experiments. B: bFGF increases COX-2 protein levels. At the indicated time, control and bFGF-stimulated cells were lysed, separated by SDS-PAGE, and COX-2 protein levels were determined by Western analysis as described in MATERIALS AND METHODS. Data are the means ± SE of duplicate samples corrected to actin and are representative of at least 2 independent experiments.

Treatment of I407 cells with bFGF induced phosphorylation of p38 MAPK within 5 min; p38 remained phosphorylated for 3 h. This time course is consistent with a role for p38 activation in bFGF-stimulated PGE2 synthesis (Fig. 4). We, therefore, examined the role of p38 activation in the events controlling PGE2 production by stimulated cells. The p38 inhibitor SB-203580 completely abrogated PGE2 synthesis in bFGF-treated cells (Fig. 5). The role of p38 in the events leading to PGE2 production by bFGF-stimulated cells was established using I407 cells stably transfected with either p38alpha WT, p38alpha DN, or empty vector (control transfected). Transfection with p38alpha WT did not increase basal PGE2 synthesis nor did it further enhance the ability of I407 cells to synthesize PGE2 after bFGF stimulation (Fig. 6A). However, I407 cells expressing p38alpha DN were unable to increase PGE2 synthesis in response to bFGF (Fig. 6A).


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4.   Time course of p38 phosphorylation following bFGF treatment. p38 phosphorylation was monitored by Western analysis using a phosphospecific antibody as described in MATERIALS AND METHODS. Cell lysates (equivalent amounts of protein) from duplicate wells were combined and analyzed. The time course is representative of at least 2 separate experiments.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 5.   Inhibition of p38 attenuates bFGF-stimulated PGE2 production. I407 cells were stimulated for 24 h with media or bFGF in the presence or absence of 10 µM SB-203580. At the end of this period, media were collected and analyzed for PGE2 as described in MATERIALS AND METHODS. Data are presented as the means ± SE of replicate wells assayed in duplicate and are representative of at least 2 separate experiments.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 6.   I407 cells stably transfected with p38alpha dominant-negative (DN) construct do not produce PGE2 or upregulate COX-2 after bFGF treatment. A: PGE2 levels were determined 24 h after addition of media or bFGF to nontransfected (NT), control-transfected (CT), p38alpha DN-transfected, or p38alpha wild-type (WT)-transfected I407 cells. Data are presented as the means ± SE of replicate wells assayed in duplicate and are representative of at least 2 separate experiments. B: COX-2 protein levels in similarly treated cells were analyzed by Western analysis. Data are the means ± SE of duplicate samples and are representative of at least 2 independent experiments.

Western blot analysis of cell lysates revealed that in contrast to nontransfected, control-transfected, and p38alpha WT-transfected cells, cells transfected with p38alpha DN did not upregulate COX-2 protein expression following bFGF treatment (Fig. 6B). Thus induction of COX-2 by bFGF appears to require the alpha -isoform of p38.

The failure of p38alpha DN cells to produce PGE2 and to upregulate COX-2 synthesis in response to bFGF suggests that bFGF-stimulated PGE2 synthesis requires COX-2 induction. However, it is possible that the observed levels of COX-2 are sufficient and that the defect in bFGF-induced PGE2 synthesis is at the level of arachidonate release. cPLA2 can be phosphorylated by p38, and phosphorylation is a critical event in cPLA2 activation (40). To investigate the possibility that the defect in bFGF-induced PGE2 synthesis in p38alpha DN cells was due to diminished PLA2 activation, we examined the effect of exogenous arachidonate on PGE2 synthesis in bFGF-stimulated cells. In resting control-transfected, nontransfected, p38alpha DN, and p38alpha WT cells, PGE2 synthesis was ~8 pg/ml (data not shown). All cell types showed an approximate fourfold increase in PGE2 production (~33 pg/ml) when supplied with exogenous arachidonate (data not shown). Two time points following bFGF stimulation were examined, an early (2 h) time point at which time COX-2 protein levels are just beginning to increase (and therefore might be limiting) and a late (24 h) time point at which COX-2 protein levels have plateaued (and arachidonate release may be limiting). Exogenous arachidonate did not further increase PGE2 synthesis in any of the cells stimulated for 2 h with bFGF, indicating that at this time, the amount of PGE2 produced is limited by COX-2 protein (Fig. 7). However, exogenous arachidonate resulted in increased PGE2 synthesis by nontransfected, control-transfected, and p38alpha WT-transfected cells stimulated for 24 h with bFGF (Fig. 7). These data indicate that late after bFGF stimulation, the induced level of COX-2 enzyme activity is sufficient to metabolize all the available endogenous substrate; thus arachidonate release is the limiting factor in PGE2 synthesis 24 h after bFGF stimulation. At neither time point was exogenous arachidonate able to overcome the defect in PGE2 synthesis in p38alpha DN cells. Thus, in I407 cells, bFGF stimulates PGE2 synthesis through a p38alpha -dependent mechanism that requires upregulation of COX-2 protein.


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 7.   Exogenous arachidonate does not restore PGE2 synthesis by bFGF-treated p38alpha DN stable transfectants. NT, CT, p38alpha DN-transfected, or p38alpha WT-transfected I407 cells were stimulated 2 or 24 h with bFGF. Fresh media containing either vehicle or 10 µM arachidonate was then placed on the cells and collected 15 min later for analysis of PGE2. Duplicate wells were assayed. Data are the means ± SE and are representative of at least 2 separate experiments.

COX-2 protein levels may be regulated by both transcriptional and posttranscriptional mechanisms. We investigated the effect of bFGF on COX-2 transcription using a COX-2 promoter/luciferase reporter construct containing the region -1432/+59 of the human COX-2 promoter. I407 cells transfected with the luciferase vector without a promoter (pGL3-basic) averaged 3.8 × 104 relative light units (RLU) at the end of transfection, and cells transfected with the luciferase vector under the control of the SV40 promoter (pGL3-control) averaged 4.6 × 107 RLU (data not shown). We found that the COX-2 promoter is active in unstimulated I407 cells (3.1 × 106 RLU) and that promoter activity is not further increased by bFGF treatment (Fig. 8A). Treatment of transfected cells with SB-203580 (1 h before and during stimulation) did not alter COX-2 promoter activity (Fig. 8B). We confirmed our ability to detect changes in activity of the transfected hCOX-2 promoter/luciferase plasmid using various stimuli. As shown in Fig. 9, activity of the hCOX-2 promoter was increased when serum-starved cells were incubated with media containing 10% fetal calf serum. Similarly, serum-starved cells stimulated with 20 ng/ml IL-1beta showed a detectable increase in promoter activity (Fig. 9). C2-ceramide (10 µM) did not stimulate promoter activity (data not shown).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 8.   COX-2 promoter activity in bFGF-treated I407 cells. I407 cells were transfected with a human COX-2 promoter/luciferase reporter plasmid containing the region -1432/+59 of the human COX-2 promoter in the pGL3 reporter plasmid along with the pSV-beta -galactosidase vector as a transfection control. A: 24 h later, the transfected cells were placed into fresh media with or without bFGF. B: after transfection, cells were pretreated for 1 h with SB-203580 (10 µM) and then placed into fresh media with or without bFGF containing 10 µM SB-203580. At the indicated times after stimulation, cells were lysed and luciferase and beta -galactosidase activity was assayed. Data are the means of replicate wells ± SE and are representative of duplicate experiments.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 9.   COX-2 promoter activity by serum-starved I407 cells. I407 cells were transfected with a human COX-2 promoter/luciferase reporter plasmid containing the region -1432/+59 of the human COX-2 promoter in the pGL3 reporter plasmid along with the pSV-beta -galactosidase vector. Thirty hours after transfection, cells were serum starved overnight and then stimulated with fresh serum-starved media (starved), media containing 10% serum (serum), or IL-1beta (20 ng/ml) in serum-starved media (IL-1beta ). At the indicated times after stimulation, cells were lysed and luciferase and beta -galactosidase activity assayed. Data are the means of replicate wells ± SE and are representative of duplicate experiments.

We next assessed whether the observed p38-dependent net increase in COX-2 mRNA following bFGF stimulation was due to message stabilization. For these experiments, I407 cells were treated for 1 h with or without bFGF and then incubated with DRB with and without the p38 inhibitor SB-203580. In untreated I407 cells, COX-2 mRNA rapidly decayed, with a half-life (t1/2) of ~15 min and a 90% loss within the first 30 min after DRB addition (Fig. 10). In cells treated with bFGF, COX-2 mRNA stability was increased to a t1/2 of 60 min (Fig. 10). Inhibition of p38 with SB-203580 reduced the t1/2 of the COX-2 message from 60 min observed in bFGF-stimulated cells to 30 min (Fig. 10). Thus the major mechanism responsible for increased COX-2 mRNA levels in bFGF-stimulated I407 cells is message stabilization, and p38 plays an important role in this stabilization.


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 10.   COX-2 mRNA stability is increased in bFGF-stimulated I407 cells and is attenuated by inhibition of p38. Cells were stimulated for 1 h with or without bFGF followed by addition of dichlorobenzimidazole riboside (DRB) or DRB + 10 µM SB203580 for the indicated times. The amount of COX-2 mRNA at each time point was determined by real-time PCR. Data are presented as the means of samples done in triplicate and are representative of at least 2 separate experiments done in duplicate.

bFGF-stimulated p38 MAPK-dependent COX-2 expression appears to be a general phenomenon in gastrointestinal epithelial cell lines, because bFGF also upregulated COX-2 expression in the colonic epithelial cell lines HT-29 and Caco-2 (Fig. 11). Both cell lines are reported to express receptors for bFGF (24, 32). bFGF increased COX-2 protein expression in both serum-starved HT-29 (Fig. 11A) and serum-starved Caco-2 (Fig. 11B) approximately twofold. These cell lines express high levels of COX-2 protein under normal growth conditions (10% fetal calf serum); therefore, the cells had to be serum-starved overnight to detect bFGF-induced upregulation. The p38 MAPK inhibitor SB-203580 attenuated bFGF-induced COX-2 protein expression by both cell lines (Fig. 11).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 11.   HT-29 and Caco-2 intestinal epithelial cell lines upregulate COX-2 in response to bFGF. HT-29 cells (A) or Caco-2 cells (B) were serum starved overnight and then incubated in serum-starved media (control), 10 µM SB203580, bFGF in serum-starved media, or serum-starved media containing bFGF and 10 µM SB-203580. HT-29 cells were harvested at 9 h posttreatment. Caco-2 cells were harvested at 24 h posttreatment. Equal amounts of total protein were separated by SDS-PAGE, and COX-2 protein levels were determined by Western analysis as described in MATERIALS AND METHODS. Densitometry is the mean of replicate samples ± SE.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

In this study, we have demonstrated that bFGF stimulates PGE2 synthesis in a human intestinal epithelial cell line via a p38alpha -dependent increase in COX-2 mRNA stability. In the absence of COX-2 upregulation, bFGF was unable to stimulate PGE2 synthesis in a p38alpha DN cell line even in the presence of exogenous arachidonate. Although bFGF has been demonstrated to affect epithelial stem cell survival in vivo after radiation injury (18), this is the first demonstration of a direct effect of bFGF on intestinal epithelial cells. Both HT-29 and Caco-2 cells have been reported to express receptors for bFGF (24, 32). Similar to I407 cells, we found that both of these cell lines increased COX-2 expression in response to bFGF and that the p38 MAPK inhibitor SB-203580 abrogated bFGF-induced COX-2 expression. These findings support the suggestion that the effects of bFGF on intestinal stem cell survival after radiation are direct effects on epithelial stem cells rather than being mediated by other cell types (34, 38).

COX-2 mRNA peaked within 1 h after bFGF treatment of I407 cells, with a subsequent decline to approximately threefold over basal at 24 h. COX-2 protein expression lagged slightly, with a maximal increase observed 3 h after bFGF. However, after the initial increase, COX-2 protein levels remained essentially stable up to 24 h. The relatively high levels of COX-2 protein at 24 h compared with the level of COX-2 mRNA may reflect the differences in COX-2 protein stability vs. COX-2 mRNA stability. Zhang et al. (47) observed a similar pattern in which COX-2 mRNA was near baseline 24 h after chenodeoxycholate treatment of rat intestinal epithelial cells, whereas COX-2 protein was still elevated. In an extensive comparison of COX-2 expression in colon carcinoma cell lines, Shao et al. (37) observed a good correlation between COX-2 mRNA and protein for some cell lines (e.g., HCA-7, Moser), whereas others appeared to have relatively low levels of message while expressing easily detectable protein (LS-174) or vice versa (HT-29). They also observed significant cell line-to-cell line variation in COX-2 protein stability (37).

The biological responses of bFGF are mediated through specific cell surface receptors that possess tyrosine kinase activity (3, 27). Binding of bFGF to its receptor activates a number of signaling pathways including phospholipase C, ERK-1, ERK-2, Src, and p38, which ultimately converge to elicit a particular biological effect (4, 27). Here, we demonstrate that the induction of COX-2 expression by bFGF in I407 cells is mediated through the alpha -isoform of p38. Although signaling through p38 has been associated with bFGF binding, this is the first association of bFGF with a specific p38 isoform. The induction of COX-2 expression by bFGF suggests the presence of one or more FGFRs on these cells. Western analysis indicated that I407 cells express FR-1, -2, -3, and -4, although FR-3 appeared to be most prominent. RT-PCR indicated the expression of FR-1, -3, and -4. This is consistent with previous reports of FR-3 expression in other intestinal epithelial cell lines including HT-29 and Caco-2 (24, 32).

Transcriptional regulation of COX-2 is mediated by a variety of cytokines and growth factors including transforming growth factor-alpha (TGF-alpha ) (40). bFGF has been demonstrated to induce COX-2 expression in gastric epithelial cells (36), Syrian hamster embryo cells (1), osteoblasts (26), endothelial cells derived from bone (23), and aortic smooth muscle cells (25). In these studies, the only attempt to define the intracellular signaling involved in bFGF induction of COX-2 expression was the demonstration that PD-98059, an ERK-pathway inhibitor, inhibited bFGF-induced COX-2 expression in aortic smooth muscle cells (25). Here, we demonstrate that in intestinal epithelial cells, COX-2 induction is mediated through p38alpha , because I407 cells transfected with p38alpha DN failed to upregulate PGE2 or COX-2 expression following bFGF treatment. However, I407 cells transfected with p38alpha WT did not exhibit elevated basal levels of COX-2 or PGE2, nor did they exhibit any further increase in COX-2 expression or PGE2 synthesis following bFGF compared with nontransfected or control-transfected cells. These data are similar to the findings of Guan et al. (13), with rat primary mesangial cells stably transfected with similar constructs. However, transient transfection of a mammary epithelial cell line (41), human synovial fibroblasts (11), immortalized human articular chondrocytes (43), and the liver parenchymal-like cell line RL34 (28) with p38alpha WT did increase basal COX-2 promoter activity or protein expression. This difference in response may simply reflect experimental differences (i.e., different cell types, transient vs. stable transfection) or may reflect differences in the basal activity of upstream modulators of p38 activity.

PGE2 synthesis is dependent not only on the expression of COX, but also on the availability of arachidonic acid, the substrate for COX. bFGF is known to affect both COX-2 expression and arachidonate availability. In pancreatic acini, bFGF stimulates arachidonate release through sequential activation of tyrosine kinase, phospholipase C, protein kinase C, and diacylglycerol lipase (17). Unstimulated I407 cells produce ~8 pg/ml PGE2. When supplied with exogenous arachidonate PGE2, synthesis increases approximately fourfold for nontransfected, control-transfected, p38alpha WT, and p38alpha DN cells, most likely reflecting metabolism by COX-1. Within 2 h after bFGF stimulation, control-transfected and nontransfected I407 cells exhibited an approximate 10-fold increase in the ability to synthesize PGE2, which was not further increased by exogenous arachidonately. These data suggest that bFGF-stimulated PGE2 synthesis occurs via increased metabolism by COX-2 and that endogenous levels of arachidonate are sufficient to saturate the cyclooxygenase present. After 24 h, exogenous arachidonate does increase PGE2 synthesis by nontransfected, control-transfected, and p38alpha WT cells, indicating that, at this time, the ability to metabolize arachidonate is greater than the amount of endogenous substrate. In p38alpha DN I407 cells, bFGF does not stimulate PGE2 production, even in the presence of exogenous arachidonate. This demonstrates that the p38alpha -mediated increase in PGE2 synthesis induced by bFGF requires COX-2 synthesis and is not mediated solely via arachidonate availability.

COX-2 mRNA levels are regulated both by the rate of transcription and by mRNA stability (16, 40). Which mechanism is dominant is a function of the stimulus; IL-1, for example, increases COX-2 mRNA levels primarily by enhancing mRNA stability (11, 20, 35). p38 Activation can affect mRNA levels either by increasing transcription or by stabilizing mRNA. In human mammary epithelial cells, taxol induces COX-2 through a p38-dependent mechanism; in this system, p38 increases COX-2 mRNA by enhancing transcription rather than by stabilizing mRNA (42). Our study demonstrates that bFGF increases COX-2 mRNA levels predominantly by increasing COX-2 mRNA stability. In resting I407 cells, ~90% of the COX-2 message decays within 30 min. Similarly, Sheng et al. (39) found that COX-2 mRNA is short lived in rat intestinal epithelial cells (t1/2 = ~13 min). When ras expression in these cells was induced or when these cells were treated with TGF-beta , COX-2 mRNA message was stabilized (t1/2 = ~30 min). When cells were induced to express ras and concomitantly treated with TGF-beta , COX-2 mRNA t1/2 increased to ~1 h. In two colonic carcinoma cell lines with high basal COX-2 expression, LS-174 and HCA-7, COX-2 mRNA t1/2 was ~80 and >120 min, respectively (37). The t1/2 of COX-2 mRNA in bFGF-stimulated cells is ~60 min and is reduced to ~30 min in the presence of the p38 inhibitor SB-203580. In HeLa cells treated with IL-1, COX-2 mRNA, t1/2 is ~60 min and is reduced to ~30 min in the presence of SB-203580 (35). Using a COX-2 promoter/luciferase construct, we found that in resting I407 cells, the COX-2 promoter is quite active and that no further increase in transcription from this promoter following bFGF treatment could be detected. However, stimuli, such as IL-1beta and serum, previously demonstrated to increase COX-2 promoter activity in other cell lines (20, 40), did increase COX-2 promoter activity in serum-starved I407 cells. In I407 cells, IL-1beta moderately increased COX-2 transcriptional activity similar to the effect of IL-1beta on COX-2 transcription in human macrophages (20). The increase in COX-2 message stability appears to be mediated through a p38alpha -dependent mechanism, because in the absence of p38alpha activation, bFGF fails to increase COX-2 expression and mRNA stability in bFGF-stimulated cells is attenuated by an inhibitor of p38.

bFGF mediates a variety of biological functions in injury repair, including stimulation of epithelial migration (3, 4, 22, 27) and enhanced stem cell survival after radiation (18). Here, we demonstrate that bFGF induces COX-2 in an intestinal epithelial cell line through a p38alpha -dependent mechanism. The ability of bFGF to induce COX-2 expression in a p38-dependent manner was not confined to I407 cells. Both the HT-29 and Caco-2 gastrointestinal cell lines showed bFGF-induced increases in COX-2 protein expression were abrogated by the p38 inhibitor SB-203580. These data raise the possibility that the effects of bFGF observed in vivo, in the gut, may be due to a direct effect on the epithelial cells and that other biological effects of bFGF on the epithelium may also be mediated through p38alpha activation.


    ACKNOWLEDGEMENTS

We thank J. M. Buzan for expert technical assistance.


    FOOTNOTES

This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants R01-DK-33165 and R01-DK-55753 (to W. F. Stenson), RO1-DK-50924 (to S. M. Cohn), and DK-52574 (to the Washington Univ. Digestive Disease Center).

Address for reprint requests and other correspondence: T. G. Tessner, Gastroenterology, Campus Box 8124, Washington Univ. School of Medicine, 660 S. Euclid Ave., St. Louis, MO 63110 (E-mail: stensnlb{at}im.wustl.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published October 9, 2002;10.1152/ajpgi.00226.2002

Received 11 June 2002; accepted in final form 2 October 2002.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Angerman-Stewart, JA, Eling TE, and Glasgow WC. Prostaglandin H synthase-2 induced in Syrian hamster embryo cells in response to basic fibroblast growth factor. Arch Biochem Biophys 318: 378-386, 1995[Web of Science][Medline].

2.   Barrios-Rodiles, M, Tiraloche G, and Chadee K. Lipopolysaccharide modulates cyclooxygenase-2 transcriptionally and posttranscriptionally in human macrophages independently from endogenous IL-1beta and TNF-alpha . J Immunol 163: 963-969, 1999[Abstract/Free Full Text].

3.   Bikfalvi, A, Klein S, Pintucci G, and Rifkin DB. Biological roles of fibroblast growth factor-2. Endocr Rev 18: 26-45, 1997[Abstract/Free Full Text].

4.   Boilly, B, Vercoutter-Edouart AS, Hondermarck H, Nurcombe V, and Le Bourhis X. FGF signals for cell proliferation and migration through different pathways. Cytokine Growth Factor Rev 11: 295-302, 2000[Web of Science][Medline].

5.   Burgess, AW. Growth control mechanisms in normal and transformed intestinal cells. Philos Trans R Soc Lond B Biol Sci 353: 903-909, 1998[Abstract/Free Full Text].

6.   Cohn, SM, Schloemann S, Tessner T, Seibert K, and Stenson WF. Crypt stem cell survival in the mouse intestinal epithelium is regulated by prostaglandins synthesized through cyclooxygenase-1. J Clin Invest 99: 1367-1379, 1997[Web of Science][Medline].

7.   Cok, SJ, and Morrison AR. The 3'-untranslated region of murine cyclooxygenase-2 contains multiple regulatory elements that alter message stability and translational efficiency. J Biol Chem 276: 23179-23185, 2001[Abstract/Free Full Text].

8.   Dean, JLE, Brook M, Clark AR, and Saklatvala J. p38 Mitogen-activated protein kinase regulates cyclooxygenase-2 mRNA stability and transcription in lipopolysaccharide-treated human monocytes. J Biol Chem 274: 264-269, 1999[Abstract/Free Full Text].

9.   Dixon, DA, Kaplan CD, McIntyre TM, Zimmerman GA, and Prescott SM. Post-transcriptional control of cyclooxygenase-2 gene expression. J Biol Chem 275: 11750-11757, 2000[Abstract/Free Full Text].

10.   El-Hariry, I, Pignatelli M, and Lemoine N. Fibroblast growth factor 1 and fibroblast growth factor 2 immunoreactivity in gastrointestinal tumours. J Pathol 181: 39-45, 1997[Web of Science][Medline].

11.   Faour, WH, He Y, He QW, de Ladurantaye M, Quintero M, Mancini A, and Di Battista JA. Prostaglandin E2 regulates the level and stability of cyclooxygenase-2 mRNA through activation of p38 mitogen-activated protein kinase in interleukin-1beta -treated human synovial fibroblasts. J Biol Chem 276: 31720-31731, 2001[Abstract/Free Full Text].

12.   Fiebich, BL, Mueksch B, Boehringer M, and Hull M. Interleukin-1beta induces cyclooxygenase-2 and prostaglandin E2 synthesis in human neuroblastoma cells: involvement of p38 mitogen-activated protein kinase and nuclear factor-kappa B. J Neurochem 75: 2020-2028, 2000[Web of Science][Medline].

13.   Guan, Z, Buckman SY, Miller BW, Springer LD, and Morrison AR. Interleukin-1beta -induced cyclooxygenase-2 expression requires activation of both c-jun NH2-terminal kinase and p38 MAPK signal pathways in rat renal mesangial cells. J Biol Chem 273: 28670-28676, 1998[Abstract/Free Full Text].

14.   Guo, YS, Hellmich MR, Wen XD, and Townsend CM. Activator protein-1 transcription factor mediates bombesin-stimulated cyclooxygenase-2 expression in intestinal epithelial cells. J Biol Chem 276: 22941-22947, 2001[Abstract/Free Full Text].

15.   Hanson, WR, and Thomas C. 16,16-Dimethyl prostaglandin E2 increases survival of murine intestinal stem cells when given before photoradiation. Radiat Res 96: 393-398, 1983[Web of Science][Medline].

16.   Hla, T, Bishop-Bailey D, Liu CH, Schaefers HJ, and Trifan OC Cyclooxygenase-1, and -2 isoenzymes. Int J Biochem Cell Biol 31: 551-557, 1999[Web of Science][Medline].

17.   Hou, W, Arita Y, and Morisset J. Basic fibroblast growth factor-stimulated arachidonic acid release in rat pancreatic acini: sequential action of tyrosine kinase, phospholipase C, protein kinase C and diacylglycerol lipase. Cell Signal 8: 487-496, 1996[Web of Science][Medline].

18.   Houchen, CW, George RJ, Sturmoski MA, and Cohn SM. FGF-2 enhances intestinal stem cell survival and its expression is induced after radiation injury. Am J Physiol Gastrointest Liver Physiol 276: G249-G258, 1999[Abstract/Free Full Text].

19.   Houchen, CW, Stenson WF, and Cohn SM. Disruption of cyclooxygenase-1 gene results in an impaired response to radiation injury. Am J Physiol Gastrointest Liver Physiol 279: G858-G865, 2000[Abstract/Free Full Text].

20.   Huang, ZF, Massey JB, and Via DP. Differential regulation of cyclooxygenase-2 (COX-2) mRNA stability by interleukin-1beta (IL-1beta ) and tumor necrosis factor-alpha (TNF-alpha ) in human in vitro differentiated macrophages. Biochem Pharmacol 59: 187-194, 2000[Web of Science][Medline].

21.   Jang, BC, Sanchez T, Schaefers HJ, Trifan OC, Liu CH, Creminon C, Huang CK, and Hla T. Serum withdrawal-induced post-transciptional stabilization of cyclooxygenase-2 mRNA in MDA-MB-231 mammary carcinoma cells requires the activity of the p38 stress-activated protein kinase. J Biol Chem 275: 39507-39515, 2000[Abstract/Free Full Text].

22.   Jones, MK, Tomikawa M, Mohajer B, and Tarnawski AS. Gastrointestinal mucosal regeneration: role of growth factors. Front Biosci 4: 303-309, 1999.

23.   Kage, K, Fujita N, Oh-hara T, Ogata E, Fujita T, and Tsuruo T. Basic fibroblast growth factor induces cyclooxygenase-2 expression in endothelial cells derived from bone. Biochem Biophys Res Commun 254: 259-263, 1999[Web of Science][Medline].

24.   Kanai, M, Rosenberg I, and Podolsky DK. Cytokine regulation of fibroblast growth factor receptor 3 IIIb in intestinal epithelial cells. Am J Physiol Gastrointest Liver Physiol 272: G885-G893, 1997[Abstract/Free Full Text].

25.   Karim, S, Berrou E, Levy-Toledano S, Bryckaert M, and Maclouf J. Regulatory role of prostaglandin E2 in induction of cyclo-oxygenase-2 by a thromboxane A2 analogue (U46619) and basic fibroblast growth factor in porcine aortic smooth-muscle cells. Biochem J 326: 593-599, 1997[Web of Science][Medline].

26.   Kawaguchi, H, Pilbeam CC, Gronowicz G, Abreu C, Fletcher BS, Herschman HR, Raisz LG, and Hurley MM. Transcriptional induction of prostaglandin G/H synthase-2 by basic fibroblast growth factor. J Clin Invest 96: 923-930, 1995[Web of Science][Medline].

27.   Klint, P, and Claesson-Welsh L. Signal transduction by fibroblast growth factor receptors. Front Biosci 4: 165-177, 1999.

28.   Kumagai, T, Nakamura Y, Osawa T, and Uchida K. Role of p38 mitogen-activated protein kinase in the 4-hydroxy-2-nonenal-induced cyclooxygenase-2 expression. Arch Biochem Biophys 397: 240-245, 2002[Web of Science][Medline].

29.   Lasa, M, Mahtani KR, Finch A, Brewer G, Saklatvala J, and Clark AR. Regulation of cyclooxygenase-2 mRNA stability by the mitogen-activated protein kinase p38 signaling cascade. Mol Cell Biol 20: 4265-4274, 2000[Abstract/Free Full Text].

30.   Majima, M, Hayashi I, Muramatsu M, Katada J, Yamashina S, and Katori M. Cyclo-oxygenase-2 enhances basic fibroblast growth factor-induced angiogenesis through induction of vascular endothelial growth factor in rat sponge implants. Br J Pharmacol 130: 641-649, 2000[Web of Science][Medline].

31.   Matsuura, H, Sakaue M, Subbaramaiah K, Kamitani H, Eling TE, Dannenberg AJ, Tanabe T, Inoue H, Arata J, and Jetten AM. Regulation of cyclooxygenase-2 by interferon gamma  and transforming growth factor alpha  in normal human epidermal keratinocytes and squamous carcinoma cells. J Biol Chem 274: 29138-29148, 1999[Abstract/Free Full Text].

32.   Murgue, B, Tsunekawa S, Rosenberg I, deBeaumont M, and Podolsky DK. Identification of a novel variant form of fibroblast growth factor receptor 3 (FGFR3 IIIb) in human colonic epithelium. Cancer Res 54: 5206-5211, 1994[Abstract/Free Full Text].

33.   Ohnaka, K, Numaguchi K, Yamakawa T, and Inagami T. Induction of cyclooxygenase-2 by angiotensin II in cultured rat vascular smooth muscle cells. Hypertension 35: 68-75, 2000[Abstract/Free Full Text].

34.   Paris, F, Fuks Z, Kang A, Capodieci P, Juan G, Ehleiter D, Haimovitz-Friedman A, Cordon-Cardo C, and Kolesnick R. Endothelial apoptosis as the primary lesion initiating intestinal radiation damage in mice. Science 293: 293-297, 2001[Abstract/Free Full Text].

35.   Ridley, SH, Dean JLE, Sarsfield SJ, Brook M, Clark AR, and Saklatvala J. A p38 MAP kinase inhibitor regulates stability of interleukin-1-induced cyclooxygenase-2 mRNA. FEBS Lett 439: 75-80, 1998[Web of Science][Medline].

36.   Sasaki, E, Pai R, Halter F, Komurasaki T, Arakawa T, Kobayashi K, Kuroki T, and Tarnawski A. Induction of cyclooxygeanse-2 in a rat gastric epithelial cell line by epiregulin and basic fibroblast growth factor. J Clin Gastroenterol 27, Suppl 1: S21-S27, 1998[Web of Science][Medline].

37.   Shao, J, Sheng H, Inoue H, Morrow JD, and DuBois RN. Regulation of constitutive cyclooxygenase-2 expression in colon carcinoma cells. J Biol Chem 275: 33951-33956, 2000[Abstract/Free Full Text].

38.   Shaulian, E, Resnitzky D, Shifman O, Blandino G, Amsterdam A, Yayon A, and Oren M. Induction of Mdm2 and enhancement of cell survival by bFGF. Oncogene 15: 2717-2725, 1997[Web of Science][Medline].

39.   Sheng, H, Shao J, Dixon DA, Williams CS, Prescott SM, DuBois RN, and Beauchamp RD. Transforming growth factor-beta 1 enhances HA-ras-induced expression of cyclooxygenase-2 in intestinal epithelial cells via stabilization of mRNA. J Biol Chem 275: 6628-6635, 2000[Abstract/Free Full Text].

40.   Smith, WL, DeWitt DL, and Garavito RM. Cyclooxygenases: structural, cellular, and molecular biology. Annu Rev Biochem 69: 145-182, 2000[Web of Science][Medline].

41.   Subbaramaiah, K, Chung WJ, and Dannenberg AJ. Ceramide regulates the transcription of cyclooxygenase-2. J Biol Chem 273: 32943-32949, 1998[Abstract/Free Full Text].

42.   Subbaramaiah, K, Hart JC, Norton L, and Dannenberg AJ. Microtubule-interfering agents stimulate the transcription of cyclooxygenase-2. J Biol Chem 275: 14838-14845, 2000[Abstract/Free Full Text].

43.   Thomas, B, Thirion S, Humbert L, Tan L, Goldring MB, and Bereziat G. Differentiation regulates interleukin-1beta -induced cyclo-oxygenase-2 in human articular chondrocytes: role of p38 mitogen-activated protein kinase. Biochem J 362: 367-373, 2002[Web of Science][Medline].

44.   Thorn, M, Raab Y, Larsson A, Gerdin B, and Hallgren R. Intestinal mucosal secretion of basic fibroblast growth factor in patients with ulcerative colitis. Scand J Gastroenterol 35: 408-412, 2000[Web of Science][Medline].

45.   Werner, S. Keratinocyte growth factor: a unique player in epithelial repair processes. Cytokine Growth Factor Rev 9: 153-165, 1998[Web of Science][Medline].

46.   Xu, K, Robida AM, and Murphy TJ. Immediate-early MEK-1-dependent stabilization of rat smooth muscle cell cyclooxygenase-2 mRNA by Galpha q-coupled receptor signaling. J Biol Chem 275: 23012-23019, 2000[Abstract/Free Full Text].

47.   Zhang, Z, Sheng H, Shao J, Beauchamp RD, and DuBois RN. Posttranscriptional regulation of cyclooxygenase-2 in rat intestinal epithelial cells. Neoplasma 2: 523-530, 2000.


Am J Physiol Gastrointest Liver Physiol 284(2):G269-G279
0193-1857/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
IOVSHome page
J. G. Lee and E. P. Kay
Common and Distinct Pathways for Cellular Activities in FGF-2 Signaling Induced by IL-1{beta} in Corneal Endothelial Cells
Invest. Ophthalmol. Vis. Sci., May 1, 2009; 50(5): 2067 - 2076.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
R. Tammali, K. V. Ramana, S. S. Singhal, S. Awasthi, and S. K. Srivastava
Aldose Reductase Regulates Growth Factor-Induced Cyclooxygenase-2 Expression and Prostaglandin E2 Production in Human Colon Cancer Cells
Cancer Res., October 1, 2006; 66(19): 9705 - 9713.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
D. E. Shifflett, S. L. Jones, A. J. Moeser, and A. T. Blikslager
Mitogen-activated protein kinases regulate COX-2 and mucosal recovery in ischemic-injured porcine ileum
Am J Physiol Gastrointest Liver Physiol, June 1, 2004; 286(6): G906 - G913.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/2/G269    most recent
00226.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (15)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tessner, T. G.
Right arrow Articles by Stenson, W. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tessner, T. G.
Right arrow Articles by Stenson, W. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online