AJP - GI Email Content Delivery
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 284: G1053-G1065, 2003. First published February 5, 2003; doi:10.1152/ajpgi.00483.2002
0193-1857/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/6/G1053    most recent
00483.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dusing, M. R.
Right arrow Articles by Wiginton, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dusing, M. R.
Right arrow Articles by Wiginton, D. A.
Vol. 284, Issue 6, G1053-G1065, June 2003

High-level activation by a duodenum-specific enhancer requires functional GATA binding sites

Mary R. Dusing, Elizabeth A. Florence, and Dan A. Wiginton

Division of Developmental Biology, Department of Pediatrics, University of Cincinnati College of Medicine and Cincinnati Children's Hospital Research Foundation, Cincinnati, Ohio 45229


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The purine metabolic gene adenosine deaminase (ADA) is expressed at high levels in a well-defined spatiotemporal pattern in the villous epithelium of proximal small intestine. A duodenum-specific enhancer module responsible for this expression pattern has been identified in the second intron of the human ADA gene. It has previously been shown that binding of the factor PDX-1 is essential for function of this enhancer. The studies presented here examine the proposed roles of GATA factors in the enhancer. Site-directed mutagenesis of the enhancer's GATA binding sites crippled enhancer function in 10 lines of transgenic mice, with 9 of the lines demonstrating <1% of normal activity. Detailed studies along the longitudinal axis of mouse small intestine indicate that GATA-4 and GATA-5 mRNA levels display a reciprocal pattern, with low levels of GATA-6 throughout. Interestingly, gel shift studies with duodenal nuclear extracts showed binding only by GATA-4.

adenosine deaminase; GATA-4; intestine; intestinal epithelium


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

THE MAMMALIAN INTESTINAL EPITHELIUM has a complex, but highly defined, architecture. The primary components of this architecture in the small intestine are the crypt and villus. Within the lower parts of the crypts are anchored stem cells that serve as precursors of all four cell types populating the continuously regenerating epithelium (48, 49). After undergoing cell division and the initiation of differentiation in the crypts, the immature cells undergo a bipolar migration. Enterocytes, goblet cells, and enteroendocrine cells migrate as a linear column up the surface of the villus. Paneth cells migrate in the opposite direction toward the base of the crypt. The function of each of these various differentiated cell types in the intestinal epithelium is defined principally by the set(s) of genes that are expressed in that cell type. Therefore, profiles of expression exist along the crypt-villus axis that are dependent on cell type, differentiation status, and cell migration. In addition, significant variations in gene expression within the same cell type are observed along the cephalocaudal (horizontal) axis of the intestine. These functional variations are established and maintained in the adult even though the intestinal epithelium undergoes a continuous renewal. It is proposed that a discrete regulatory network controls these processes. This interrelated network of transcription factors and cis-acting elements that specify and regulate gene expression along the various physical and temporal axes of the small intestine is just now beginning to be sorted out (13, 53). The analysis of promoters and enhancers that specify the intestinal expression of individual genes can contribute significantly to that process.

The adenosine deaminase (ADA) gene has a complex, highly regulated tissue-specific pattern of expression. It is expressed in all mammalian tissues, but the expression levels vary over a range of several thousand-fold and undergo significant changes in various tissues and cell types in a developmentally specific manner (6). A number of distinct genomic regions (regulatory modules) that control ADA tissue expression in mice and humans have been identified and characterized (2, 9, 15, 50, 57, 60). These modules contain tissue-specific enhancers that bind a variety of transcription factors, which collaborate to control chromatin structure and activate ADA gene transcription in distinct cell types. One cell type that exhibits very high levels of ADA expression is the absorptive enterocyte of the duodenal epithelium in the small intestine. This high-level expression in enterocytes is observed only in the duodenum and only in enterocytes that have migrated past the crypt-villus junction on the villus. Developmentally, this enhancer-dependent high-level activation is first observed in mice at the suckling-weanling transition and continues into adulthood. Gene ablation studies have shown that ADA expression is essential for duodenal integrity and viability (37, 59). Transgenic mouse studies have been used to identify and map an enhancer that activates high-level ADA expression specifically in the duodenum (15-17). The enhancer can activate expression that recapitulates endogenous gene activation exactly along three distinct axes: the cephalocaudal [anterior/posterior (A/P) axis], the crypt-villus differentiation axis, and the axis of developmental time (15, 16). In initial footprinting studies, a number of transcription factors were indirectly implicated in enhancer function (15). Recent studies have shown that the factor PDX-1 is critical for enhancer function (17). The present study examines proposed roles for the GATA family of transcription factors in the enhancer's function.

Each member of the GATA family of transcription factors has a highly conserved DNA-binding domain containing two zinc fingers that recognizes the consensus sequence WGATAR (27, 36). Six GATA factors have been identified in vertebrates, and these can be divided into two subfamilies, GATA-1, -2, and -3 and GATA-4, -5, and -6. The latter subfamily is expressed in various tissues of mesodermal and endodermal origin, including heart, liver, lung, gonad, and gut, where they play critical roles in regulating tissue-specific gene expression (40). Targeted disruption of the GATA-4, -5, and -6 mouse genes have identified roles for these factors in formation of heart, endoderm, lung epithelium, gastric epithelium, and genitourinary tract (25, 28, 30, 41, 42, 46, 51). In adult mice, GATA-4, GATA-5, and GATA-6 are all expressed in epithelium of the small intestine (1, 40, 44). Initial analysis of GATA factor expression in the gastrointestinal epithelium of embryonic chicks and young hatchlings led to the proposal of both distinct (20) and overlapping (31) functions for GATA-4, -5, and -6 in that epithelium. GATA factors have been implicated in the intestine-specific regulation of promoter function for several genes, including sucrase-isomaltase (SI; see Refs. 8, 29, 53), rat and human lactase-phlorizin hydrolase (18, 19, 29, 54), and intestinal fatty acid-binding protein (20). In the studies presented here, transgenic mouse experiments were used to identify a crucial role for GATA binding sites in the in vivo function of the duodenum-specific enhancer of the ADA gene. Additional studies with duodenal nuclear extracts indicate that these sites are bound principally, if not exclusively, by GATA-4.


    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Oligonucleotides. Oligonucleotides were synthesized at the University of Cincinnati DNA core facility and are as shown in Fig. 1B or as described below. Oligonucleotides G2 and PDX-1 have been published previously as oligonucleotides FP 2C and P1, respectively (17). Oligonucleotide consensus sequences for activator protein (AP)-1 CGCTTGATGACTCA- GCCGGAA and GATA CACTTGATAACAGAAAGTGATAACTCT are as indicated in the Santa Cruz Biotechnology catalog. Probe oligonucleotides for EMSA experiments were gel purified as reported (17).


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 1.   Location and sequence of the potential GATA-binding sites in the human adenosine deaminase (ADA) duodenal enhancer. A: relative location of the duodenal enhancer core (open box) is shown within intron 2 of the human ADA gene. The most prominent of several duodenum-specific DNase I hypersensitive sites (HS-D) colocalizes with the enhancer and is indicated by the arrow. Exons are shown as black rectangles and are numbered. Fragments of the human ADA gene used in the creation of a CAT reporter transgene are shown below the gene structure, and their location within the gene is indicated with dashed lines. An enlargement of the enhancer core is shown with footprinted regions (gray rectangles) numbered FP-1, FP-2, etc. Putative transcription factor-binding sites for GATA are shown as white triangles. B: wild-type and mutant oligonucleotide sequences are shown. Oligonucleotides containing the putative GATA (G1, G2, and G3)-binding sites from the human ADA duodenal enhancer core can be seen. Also shown is the GATA consensus binding site. Within each wild-type oligonucleotide, the factor-binding site is shown in bold letters. Base pair changes from the wild type that eliminate factor binding are shown in bold lowercase letters in the mutant (m) oligonucleotides G1m, G2m, and G3m. The sequence shown for G3 represents the lower DNA strand.

Transient transfection. The GATA expression vector plasmids, pcDNA GATA-4, pcDNA GATA-5, and pcDNA GATA-6, were the generous gift of Jeffery Molkentin (Cincinnati Children's Hospital Medical Center). The human adenocarcinoma cell line Caco-2 (no. HTB 37; ATCC) was cultured in DMEM with 10% FBS, 0.05 units penicillin, and 0.05 µg/ml streptomycin. DNA was introduced into cells at 70-80% confluence by Life Technologies (Carlsbad, CA) Lipofectin transfection according to the manufacturer's protocol using 27.7 µl Lipofectin and 2 µg DNA/100-mm dish. Media was replaced 16 and 40 h after transfection. After transfection (64 h), cells were harvested and nuclear extracts were prepared.

Extract preparation. Mouse duodenal nuclear extracts (MDNE) were prepared as previously described (17). Transfected cells were washed with PBS at 37°C and then scraped into 1 ml PBS at 4°C, pelleted, washed again with 1 ml PBS at 4°C, and repelleted. Cells were resuspended in two packed cell volumes of lysis buffer (10 mM HEPES-KOH, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 1.5 mM MgCl2, 0.2% Nonidet P-40, 1 mM DTT, and 0.5 mM PEFABLOC), vortexed for 5 min, and incubated 10 min on ice. Nuclei were pelleted, washed one time with lysis buffer, and pelleted again. The nuclear pellet was resuspended in 100 µl extraction buffer (20 mM HEPES-KOH, pH 7.9, 420 mM NaCl, 0.1 mM EDTA, 1.5 mM MgCl2, 25% glycerol, 1 mM DTT, and 0.5 mM PEFABLOC). Samples were incubated on ice for 20 min and vortexed every 10 s. Samples were spun at 15,000 rpm at 4°C for 20 min in a microcentrifuge. The supernatant was removed and stored at -70°C.

EMSA. MDNE (10 µg)- or Caco-2-transfected nuclear extract (2 µl) was used for each gel shift reaction. Normal rabbit IgG and antibodies to GATA-4, -5, and -6 were purchased from Santa Cruz Biotechnology. Supershift EMSAs were incubated overnight at 4°C.

Site-directed mutagenesis and transgene preparation. All enzymes were from New England Biolabs (Beverly, MA) unless otherwise stated. pALTER 319+ (17) was used as a template for mutagenesis reactions using the Promega Altered Sites protocol (Madison, WI). GATA mutation oligonucleotides were prepared at the University of Cincinnati DNA core facility with the following sequences: GCGTACGTTTGAACCCAGAGTGTCTGCCCCCGAGTCC (G1m-ext), GCTCCATAAATGTCACTTAATGAGTATATTCTTATTAATTGGAGC (G2m-ext), and GGGGTGAAACCTCTTGGCTTAAGTCTGCCTGGCCTTTGC (G3m-ext). Successive rounds of mutagenesis were used to introduce each mutation shown in Fig. 1B into the enhancer core fragment. The mutated BsiWI enhancer fragment containing the GATA site mutations was sequenced in its entirety to ensure fidelity of both the mutated sites and the remaining sequences of the enhancer. The GATA-mutated enhancer fragment was liberated with BsiWI and ligated into BsiWI cut p5'acba L117Delta D (15) to generate the plasmid p5'acba L117 GATA mut.

Transgene fragments, mice, and analysis. The transgene listed as the wild type has been described previously and characterized as such and as Transgene IV (15, 17). The plasmid p5'acba L117 GATA mut was digested with NdeI and PvuI. The resulting 18,471-bp fragment was isolated and purified as described previously (15). Transgenic mice were made by microinjection at both the Cincinnati Children's Hospital Research Foundation and the University of Cincinnati core facilities. Analysis of F1 mice was routinely performed between 4 and 6 wk or at other times as noted. CAT assays, protein determination, and copy number analysis were performed as previously described (15). Tissues assayed included tongue, esophagus, stomach, duodenum, jejunum, ileum, colon, liver, and thymus for each line.

In situ hybridization. In situ hybridization (ISH) experiments were performed using CAT-specific RNA probes on transgenic duodena from wild-type line 10 or GATA mutant line 1, as described previously (15, 16).

RNA isolation and Northern blot analysis. Stomach, small intestine, cecum, colon, liver, and heart were isolated from five 7-wk-old nontransgenic FVB/N mice. The small intestine was subdivided further into 2-cm segments, and equivalent segments were pooled. The poly(A)+ fraction of RNA was isolated as described previously (4). Samples containing 1 µg poly(A)+ RNA were electrophoresed and blotted, and Northern blot analysis was performed using the RNA antisense probes described below. pcDNA GATA-4 was digested with EagI, filled with T4 DNA polymerase, and subsequently digested with EcoRI. The 436-bp fragment was isolated and ligated to SmaI-EcoRI-cut pGEM4Z (Promega). The resulting plasmid pGEM-G4 was linearized with EcoRI and used as a template for antisense RNA probe synthesis using T7 RNA polymerase. pcDNA GATA-5 was digested with NcoI, filled with T4 DNA polymerase, and then digested with HindIII. A 389-bp fragment was isolated and ligated to SmaI-HindIII-digested pGEM-4Z. The resulting plasmid, pGEM-G5.2, was linearized with HindIII and used as a template for radioactive antisense RNA probes synthesized with SP6 RNA polymerase. pcDNA GATA-6 was digested with AccI, filled with T4 DNA polymerase, and then digested with SacI. A 528-bp fragment was isolated and ligated to SmaI- and SacI-digested pGEM-4Z to form pGEM-G6. pGEM-G6 was linearized with HindIII and used as a template for radioactive antisense probe synthesis using SP6 RNA polymerase. Probes were synthesized and stripped as directed in the Ambion Strip-EZ kit (Austin, TX). GATA-4/5/6 mRNA was quantitated using a PhosphorImager (Molecular Dynamics) and normalized to both the background and the specific activity of the probe.

DNase I hypersensitivity. Transgenic mice were bred to homozygosity. Duodena were isolated from four adult mice, and nuclei were prepared, as described previously (17), with the following exceptions. Buffers A and B were supplemented only with 80 µM PMSF and 1.0 mM DTT, and N-acetyl-L-cysteine was omitted. The nuclear pellet was resuspended in 5 ml cold nuclei wash buffer (20 mM HEPES-KOH, pH 7.9, 13.3 mM NaCl, 13.3 mM KCl, 0.133 mM spermidine, 0.5 mM spermine, 2 mM EDTA, 0.5 mM EGTA, and 3 mM MgCl2), and the number of nuclei was estimated using a hemacytometer. DNase I treatment, DNA isolation, and Southern blotting were performed as described previously (16) except that each sample was treated with 9 U of DNase I for 10 min at 30°C.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Duodenum-specific enhancer contains three sites that bind GATA-4. The duodenum-specific enhancer region is located within the second intron of the human ADA gene (Fig. 1A). Two consensus GATA recognition sequences were observed within the footprinted regions of this enhancer. A third consensus match sequence is also present in the enhancer core but was not observed to footprint (perhaps because of its location adjacent to the end of the DNA strand used for these experiments). To assess the binding ability of these sites, oligonucleotides corresponding to these sequences (G1, G2, and G3 in Fig. 1B) were synthesized as well as an oligonucleotide containing a GATA consensus binding sequence. The position of the putative GATA binding site within each oligonucleotide is shown in Fig. 1B. Each oligonucleotide was labeled and used as a probe in EMSA experiments (Fig. 2). As seen in Fig. 2A, an equivalent slowly migrating complex is observed with G1, G2, and G3 oligonucleotides upon addition of 10 µg MDNE (lanes 1, 4, and 8). This shifted complex can be specifically prevented by the addition of 100-fold molar excess unlabeled GATA consensus oligonucleotide to the binding reaction (Fig. 2A, lanes 2, 5, and 9). For each oligonucleotide probe, this complex was observed to be GATA specific, since it was not affected by the addition of the same amount of an unlabeled AP-1 consensus oligonucleotide (Fig. 2A, lane 10). This complex is labeled as GATA in Fig. 2, A-D. The trio of faster-migrating complexes observed with the G2 probe (Fig. 2A, lanes 4 and 5) were all previously identified as complexes that contain the homeodomain factor PDX-1 (17). The addition of both the PDX-1 and the GATA oligonucleotides to the binding reaction effectively prevents formation of all complexes on this probe (Fig. 2A, lane 6).


View larger version (83K):
[in this window]
[in a new window]
 
Fig. 2.   Three GATA sites in the duodenal enhancer bind GATA-4. EMSA using the GATA oligonucleotides as probes are shown in A-D. All lanes in A-C contain 10 µg mouse duodenal nuclear extract (MDNE) except for lanes 3 and 7 in A, which contain no extract. All lanes in D contain 2 µl of extract from transfected Caco-2 cells. A: each wild-type oligonucleotide is used as a probe. G1 is used in lanes 1 and 2, G2 in lanes 3-6, and G3 in lanes 7-10. In A-D, a GATA-specific complex is indicated as GATA. Lanes 2, 5, and 9 contain a 100-fold molar excess of an unlabeled GATA consensus oligonucleotide. Lane 6 contains a similar excess of both the GATA consensus oligonucleotide and a PDX-1-binding oligonucleotide. Lane 10 contains an excess of an unlabeled nonspecific oligonucleotide [activator protein (AP)-1]. B: EMSA using both the wild-type [G1 (lanes 1-2), G2 (lane 4), and G3 (lanes 6 and 7)] and the mutated oligonucleotides [G1m (lane 3), G2m (lane 5), and G3m (lane 8)] as probes. Lanes 2 and 7 contain an excess of unlabeled GATA consensus oligonucleotide as competitor. C: antibody (Ab) supershift EMSA. Lanes 1-5 contain labeled G1, lanes 6-10 contain G2, and lanes 11-15 contain G3 as probe. Lanes 2, 7, and 12 contain an excess of unlabeled GATA consensus oligonucleotide. Lanes 3, 8, and 13 contain anti-GATA-4 antibody. The resulting supershift is labeled as such. Lanes 4, 9, and 14 contain anti-GATA-5 antibody. Lanes 5, 10, and 15 contain anti-GATA-6 antibody. D: labeled GATA consensus oligonucleotide is used as probe. Caco-2 (2 µl) nuclear extract transfected with either a GATA-4 expression vector (lanes 1-4), a GATA-5 expression vector (lanes 5-8), or a GATA-6 expression vector (lanes 9-12) was used. Lanes 2, 6, and 10 also contain an excess of unlabeled GATA consensus oligonucleotide. The GATA-specific complex is labeled. Lanes 3, 7, and 11 each contain nonspecific rabbit IgG. Antibodies directed against GATA-4 (lane 4), GATA-5 (lane 8), and GATA-6 (lane 12) each produced a supershift.

Within the GATA family of transcription factors, three members have been observed in the small intestine [GATA-4 (1), GATA-5 (45), and GATA-6 (44)]. To identify which member(s) might be involved in the formation of the observed complexes, EMSA supershift experiments were performed using antibodies specific to GATA-4, GATA-5, and GATA-6 (Fig. 2C). The same GATA-specific bands are observed as previously with each probe and MDNE (Fig. 2C, lanes 1, 6, and 11). Again formation of the GATA-specific complex was prevented by the addition of excess unlabeled GATA consensus oligonucleotide to the binding reaction (Fig. 2C, lanes 2, 7, and 12). Reactions incubated with anti-GATA-4 antibody (Fig. 2C, lanes 3, 8, and 13), anti-GATA-5 antibody (lanes 4, 9, and 14), or anti-GATA-6 antibody (lanes 5, 10, and 15) indicated that only GATA-4 was present in each GATA complex, as evidenced by the supershifted complex in lanes 3, 8, and 13.

To confirm the integrity of the antibodies used in Fig. 2C, Caco-2 cells were transfected independently with the GATA expression vectors pcDNA-GATA-4, pcDNA-GATA-5, and pcDNA-GATA-6. Nuclear extracts were prepared from transfected cells and used in EMSA experiments (Fig. 2D). Using radiolabeled GATA consensus oligonucleotide as a probe, a shifted band was produced with each GATA-transfected extract (lanes 1, 5, and 9). Addition of an excess of unlabeled GATA consensus oligonucleotide prevented formation of this complex (lanes 2, 6, and 10), thereby confirming that these complexes do contain GATA-binding proteins. Reactions incubated in the presence of the anti-GATA-4 (lane 4), anti-GATA-5 (lane 8), and anti-GATA-6 (lane 12) antibodies were each able to produce the expected supershift, whereas a nonspecific antibody (lanes 3, 7, and 11) did not. Residual GATA complex that does not supershift in lanes 4, 8, and 12 is the result of endogenous GATA-4 and GATA-6 expression in Caco-2 cells (data not shown). The ability of each antibody to recognize its cognate protein allows us to conclude that the duodenal nuclear extracts produced do indeed contain only GATA-4 protein.

GATA-4 complexes do not form on the mutated oligonucletides G1m, G2m, and G3m. Experiments were carried out to identify sequence changes that specifically eliminate GATA binding in vitro. Various base pair changes were introduced into each oligonucleotide sequence and tested in EMSA experiments for loss of GATA binding (data not shown). The optimal mutations are shown in the sequences designated as G1m, G2m, and G3m in Fig. 1B. EMSA experiments using the wild-type and mutated oligonucleotides as probe are shown in Fig. 2B. Once again, the slowly migrating complex, labeled as GATA, is observed in the lanes containing wild-type probe and MDNE (lanes 1, 4, and 6). Addition of excess GATA consensus sequence oligonucleotide to the binding reactions prevented complex formation (lanes 2 and 7). When the GATA-mutated oligonucleotides were used as probes, the GATA complex was not observed (lanes 3, 5, and 8), indicating that GATA binding has been ablated. The mutated probes do retain other identified (PDX-1, lane 5) and unidentified (lane 3) complexes. Loss of GATA binding on the G2m probe results in an apparent increase in PDX-1 binding. A variety of other GATA mutations tested resulted in a similar increase (data not shown). The binding sites for PDX-1 (ACTTAATG) and GATA (TGATAA) overlap considerably in the G2 oligonucleotide (Fig. 1B). A slight increase in GATA binding was previously observed for the PDX-1-specific mutation of this oligonucleotide (17). Increased binding in the mutated oligonucleotides may reflect loss of competition between PDX-1 and GATA-4 for their overlapping binding sites upon the loss of one or the other.

GATA mutant transgenic mice have decreased duodenal CAT activity. The mutations that resulted in loss of GATA binding (G1m, G2m, and G3m) were used in transgenic studies to assess the role these factors play in the enhancer function in vivo. Mutations were introduced into the enhancer core such that all the GATA sites within the enhancer core were ablated. This mutated enhancer core was then used to replace the wild-type enhancer core within a 13-kb intragenic ADA fragment, maintaining the same position and orientation. Wild-type and GATA mutant transgenes each contain analogous DNA fragments (Fig. 1A). These include a 3.8-kb human ADA promoter/5' flanking segment attached to the CAT coding sequence and the 13-kb fragment containing the enhancer and its core. The only relevant sequence differences between these transgenes is the mutations described above. Ten independent transgenic lines were produced and analyzed for the GATA mutant.

A minimum of two adult F1 mice were analyzed for CAT activity in various tissues for each independent transgenic line. Protein concentration and copy number were also assessed. All transgenic CAT activities reported are normalized to both protein concentration and transgene copy number and are expressed in units of picomoles per hour per 100 µg protein/transgene copy (Fig. 3 and Table 1). CAT activities for the wild-type transgene were reported previously (15-17) and are included here for comparison only. As shown in Fig. 3, duodenal CAT activity/copy in mice containing the wild-type 13-kb fragment range from 1,400 to 31,000 units, with a mean activity of 9,100 units. In every line, duodenum is the site of highest transgene activity and is usually 100- to 1,000-fold greater than the next highest tissue (Table 1).


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 3.   Loss of GATA binding results in decreased enhancer activity in vivo. A comparison of duodenal reporter gene activity normalized to transgene copy number for multiple lines of transgenic mice is shown (note the log scale). Results with the wild-type (wt) transgene have been published previously (15, 16). Duodenal CAT activity/copy in mice containing the wt transgene (filled bars) or the GATA mutant enhancer transgene (hatched bars) is shown. * Lines of mice with <1 unit duodenal CAT activity.


                              
View this table:
[in this window]
[in a new window]
 
Table 1.   Tissue-specific CAT activities of wild-type and GATA mutant mice

Loss of GATA binding within the duodenal enhancer in vivo had a dramatic effect on the levels of transgene expression. Duodena from mice containing the GATA-mutated enhancer contained significantly reduced transgene activity compared with wild-type duodena (Fig. 3). Duodenal CAT activity/copy in these mice range from 0.4 to 780 with a mean activity of 90 units. This activity represents 1% of the mean wild-type activity but would be even lower if line 1 values were not included. This single line (GATA mutant line 1) expressed at ~10% of the mean wild-type levels of the transgene at 780 units. However, activities within this line were highly variable from mouse to mouse (8 mice, 780 ± 327 units). Why this line shows much higher and more variable duodenal transgene activation than the other nine lines containing the same transgene is unclear but is likely related to a permissive insertion site. In one-half of the lines, duodenum remains the site of highest activity, but the margin of excess is reduced to threefold or less in some of these lines. In the remaining lines, duodenum is no longer the highest-expressing tissue. These results show that the loss of GATA binding in vivo generally results in drastically diminished enhancer activation within the transgenic duodenum. This diminishment, however, is not as complete as that observed in either the PDX mutant (17) or the transgene completely lacking the enhancer core (15), since a few lines of the GATA mutant mice are able to retain a modicum of duodenal specificity.

A/P CAT distribution is altered in the GATA mutant transgenic duodena. Along the A/P axis of the small intestine, high levels of endogenous mouse ADA are restricted to the region between the pyloric sphincter and a point 4-5 cm distal to it (16). The transgene containing the wild-type enhancer exhibits an identical pattern along the A/P axis, with high-level CAT activity limited to the first 4-5 cm of the small intestine, as shown in Fig. 4A (16). To examine the effects of the GATA site mutations on the expression of the transgene in vivo along the A/P axis, small intestines from GATA mutant line 1 were analyzed segmentally (Fig. 4B). The intestines were cut into 2-cm sections beginning at the pyloric sphincter, and each segment was assayed for transgene activity. In these mice, essentially all of the activity is limited to the first 2 cm of the small intestine. Therefore, not only is the overall duodenal activity significantly lower in transgenic mice containing the GATA-mutated enhancer compared with the wild type, but the region of the small intestine expressing the transgene at high levels is reduced and limited to the very most anterior portion of the small intestine.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4.   GATA mutant duodena have an altered pattern of transgene expression along the anterior/posterior (A/P) axis. Contiguous 2-cm sections of small intestine beginning at pyloric sphincter were harvested and assayed for CAT activity. CAT activity (pmol · h-1 · 100 µg-1 · transgene copy-1) is shown vs. position along the A/P axis for transgenic mice from wild-type line 10 (A) and GATA mutant line 1 (B). Results with the wild type have been published previously (16).

GATA mutant duodena have decreased numbers of cells on the villus that are able to achieve full transgene activation. High-level endogenous expression of ADA in the mouse small intestine is observed predominantly in a subpopulation of the differentiated epithelial cells, the enterocytes, found on the villus (58). As seen by ISH experiments using an antisense CAT probe, duodena from mice containing the wild-type transgene exhibit a pattern of CAT expression along this crypt/villus axis that is identical to the endogenous ADA expression (Fig. 5A). Transgene expression is limited to the villous epithelium composed primarily of differentiated enterocytes. The transgene is not expressed in the crypt or in the underlying mucosa. ISH was also used to examine the CAT expression pattern in GATA mutant line 1, the single mutant line that showed significant activity. The levels and patterns of duodenal activities from this line showed reduced activities when compared with wild-type activities, and mice within this line showed a high degree of variability, even among transgenic littermates. Figure 5, D-F, shows in situ experiments on a single transgenic mouse. Crypt-villus distribution has not changed qualitatively from the wild type in that high-level expression is still limited to the villous epithelium and absent from the crypts and the mucosa. However, the total number of cells expressing the transgene at high levels is reduced significantly, resulting in a mosaic pattern of expression (Fig. 5, D and E). Figure 5B and the enlarged subregion in Fig. 5C show ISH performed on a transgenic littermate to the mouse used for D-F. In this mouse, the loss of cells expressing high levels of the transgene is even more dramatic. Only three to five cells per cross section express the transgene (Fig. 5C). These few cells do appear to express the transgene quite robustly at levels similar to those observed with the wild-type enhancer transgene. This suggests that the reduced activity observed in the GATA mutant enhancer mice is not the result of decreased transgene expression in all cells but rather a decrease in the total number of cells able to express at high levels.


View larger version (97K):
[in this window]
[in a new window]
 
Fig. 5.   GATA mutant duodena have a slightly altered pattern of crypt/villus transgene expression. In situ hybridization (ISH) experiments are shown for mouse duodenum from wild-type line 10 (A) and GATA mutant line 1 (B-F). Duodenal cross sections were hybridized to either sense (F) or antisense (A-E) CAT probe. In transgenic mice containing the wild-type enhancer (A), signal is observed over the villous epithelium (v) but not in the crypts (c) or the underlying mucosa (m). B-E show that GATA mutant line 1 duodena have a reduction in the number of cells expressing the transgene at high levels. D and E are from a single mouse duodenum. A transgenic littermate of the mouse used in D-F is shown in B and at higher magnification in C, where individual cells with high-level transgene expression are indicated with arrows. A, B, and D-F: ×10 magnification. C: ×25 magnification.

GATA-4 is the predominant GATA family member in the duodenum. EMSA studies suggested that only GATA-4 protein was present in detectable amounts in the adult mouse duodenum. The relative cephalocaudal expression and distribution of the GATA factors within mouse small intestine have not yet been defined. To investigate this further, Northern blot analysis was performed to examine the distribution of each GATA factor along the length of the small intestine and in other tissues. Five adult FVB/N mice were killed. Heart, stomach, liver, cecum, colon, and small intestine were harvested. The small intestines were divided into 2-cm segments, and equivalent segments from the five mice were pooled. The poly(A)+ RNA was isolated, and 1 µg of each was electrophoresed, blotted, and hybridized to labeled antisense GATA-4, GATA-5, or GATA-6 RNA probes (Fig. 6A). The results agree in general with previous studies that investigated GATA expression in liver, heart, and the small intestine (1, 8, 44, 45). Appropriately sized mRNA were observed with each probe. A 4-kb GATA-4 mRNA was observed in heart, stomach, and all of the small intestine samples. It was absent from cecum and colon and present in only small amounts in liver. Two distinct GATA-5 mRNA species, a 3.2- and a 1.8-kb mRNA, were observed. Both species had been observed previously when using a probe to the open-reading frame of GATA-5 such as the one used in this experiment (45). Both mRNA were found to correspond to cDNAs that encoded a full-length GATA-5 protein. GATA-5 mRNA was observed in the stomach and all small intestine segments. It was absent from cecum, colon, liver, and heart. A 3.2-kb GATA-6 mRNA was found in all small intestine sections, stomach, cecum, colon and heart and was absent from liver. A PhosphorImager quantitation of these signals is shown in Fig. 6B. Because both GATA-5 mRNAs observed in the intestine contain the entire coding region, these bands were quantitated and added together. In all small intestinal regions, GATA-6 is expressed at a relatively uniform low level. In the regions encompassing the duodenum, proximal jejunum, and the distal jejunum, GATA-4 mRNA is the predominant mRNA species. In more distal segments, GATA-4 mRNA levels drop dramatically such that, in the distal ileum, GATA-4 and GATA-6 are expressed at similar levels and GATA-5 is the predominant mRNA. GATA-5 mRNA levels are lowest in the proximal portions of the small intestine and show an increase distally, especially in ileum. Therefore, although each GATA mRNA was detected in all sections of the small intestine, high-level expression of GATA-4 and of GATA-5 appear to be complementary to one another along the length of the mouse small intestine.


View larger version (56K):
[in this window]
[in a new window]
 
Fig. 6.   Intestinal distribution of GATA-4, -5, and-6. A: Northern blots. Each lane contains 1 µg poly(A)+ RNA from various mouse tissues hybridized to either an antisense GATA-4, GATA-5, or GATA-6 RNA probe. Small intestine was divided into 2-cm segments (1-19). B: quantitation using a PhosphorImager (Molecular Dynamics) of Northern blot signal for GATA-4 (filled bars), GATA-5 (open bars), and GATA-6 (gray bars) in the small intestine segments. Traditional functional demarcations of the small intestine are as follows: duodenum (D), proximal jejunum (PJ), distal jejunum (DJ), and ileum (I).

Mutation of specific protein-binding sites in the duodenal enhancer does not interfere with formation of hypersensitive site D. Many active enhancers are located in a region of DNA with altered chromatin structure, resulting in increased sensitivity to DNase I (21). We have previously characterized the enhancer region of the human ADA gene through DNase I hypersensitivity experiments (16). DNase I mapping of intron 2 of the human ADA transgene in duodenal nuclear DNA has identified multiple hypersensitive sites, and the duodenal enhancer is associated with one of these sites, specifically hypersensitive site D (HS-D in Fig. 1A; see Refs. 15 and 16). We have demonstrated above that mutation of the GATA sites within the enhancer results in a significant loss of enhancer-driven expression. Previous studies have shown that specific mutations to the PDX-1 sites in the enhancer result in a complete loss of enhancer-driven expression (15). Studies examining the ADA thymic enhancer region have demonstrated that loss of a particular enhancer-binding factor can result in altered regional hypersensitivity and altered expression (23). To determine if loss of activity in the PDX or GATA mutant enhancers is associated with an inability of HS-D to form, DNase I hypersensitivity analysis of transgenic duodenal nuclear DNA was performed. Nuclei from duodena of mice expressing each of these mutant transgenes were treated with DNase I, and the hypersensitive sites were identified and compared with those in the wild-type transgene. DNase hypersensitivity experiments were performed as described previously (16). A Southern blot of the hypersensitive regions from the wild-type (Transgene V, line 10) and mutated [GATA mutant (line 8) and PDX mutant (line 8)] transgenes are shown in Fig. 7. DNase I hypersensitive sites are also shown in Fig. 7. Despite the observed complete loss of enhancer function in these GATA and PDX mutant lines, the duodenal-specific hypersensitive site HS-D is able to form in these mice. Although there are apparent small variations in the relative intensity of the bands, HS-D, along with all the other previously observed hypersensitive sites, are observed to form in each case.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 7.   Duodenal DNase I hypersensitivity of mutated transgenes. DNase I-treated duodenal nuclear DNA from adult mice containing the wild-type, GATA mutant, or PDX mutant transgenes was digested with XbaI, Southern blotted, and probed as described previously (16). Multiple hypersensitive sites are indicated with arrows labeled A-G, with hypersensitive site D (HS-D), the region that contains the duodenal enhancer, shown in bold. HS-G was initially identified as an individual site (16), but because of an increased time of electrophoresis, it has resolved into multiple bands.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Enhancers play a central role in eukaryotic gene regulation, especially in controlling tissue-specific expression (35). Enhancer function normally results from the combinatorial action of multiple factors whose binding sites reside within a regulatory module of discrete size and location (3, 39). These factors may be tissue specific in their expression pattern or more widely expressed, even ubiquitous. Factors bound at the sites in an enhancer regulatory module are thought to form a higher-order protein complex, termed an enhanceosome, during functional activation (10, 52). Previously, we identified a duodenum-specific enhancer in the second intron of the human ADA gene (15, 16). The core of this enhancer was mapped to a region of ~300 bp associated with a duodenum-specific DNase I HS-D (15). Within this core region, multiple proposed factor binding sites were identified by DNase I footprinting experiments (15). Recently, we demonstrated that several of these sites bind the transcription factor PDX-1 and that PDX-1 binding is essential to the enhancer's in vivo function (17). In adults, PDX-1 expression is limited principally to duodenum and pancreas (22, 33, 38, 47). Therefore, PDX-1 likely contributes significantly to the tissue specificity of the duodenal enhancer. However, evidence indicates that PDX-1 alone is insufficient to activate the enhancer (17). This is not surprising, considering our knowledge of the combinatorial factor requirements of most enhancers and the multiple footprints observed in the enhancer core.

The evidence presented here indicates that the GATA sites identified in the enhancer also play a critical role in its function. Mutation of these sites that prevented GATA factor binding severely crippled enhancer function in vivo and in some transgenic mouse lines essentially destroyed it. There are some discernable differences from previous transgenic mouse studies in which the enhancer module was deleted or specifically mutated. The ability to distinguish these differences is due in part to the exquisite sensitivity of the CAT reporter assay, the number of wild-type lines assayed, and the full penetrance of the wild-type transgene. The residual duodenal CAT activity in the GATA mutant transgenic mice, although quite low, is higher than that observed for the PDX mutant mice or Delta enhancer mice that contain a small deletion of the entire enhancer core region (15, 17). The mean normalized duodenal CAT value in 10 PDX mutant lines is 0.5 units (excluding line 3, which shows generalized activation in all tissues). In the seven lines of Delta enhancer mice, where expression is presumably driven only by the ADA promoter, the normalized duodenal CAT value is also 0.5 units. The mean value for GATA mutant mice is 90 units, almost 200 times higher. Even without the unusually high value from line 1, the GATA mutant mean value would be 16 units (>30 times higher). In addition, some residual duodenal specificity is seen in the GATA mutant mice that is not observed in the PDX mutant mice or Delta enhancer mice. In 5 of the 10 GATA mutant lines, duodenum is the highest-expressing tissue. These are the lines with the highest residual duodenal CAT activity (lines 1, 3, 4, 6, and 7). Duodenum was the highest-expressing tissue among the 9 tissues surveyed in only 2 of the 17 PDX mutant mice and Delta enhancer mouse lines. Therefore, although mutation of the GATA binding sites had a dramatic effect on enhancer function in vivo, some residual duodenal-specific activation was observable. This was most clearly evident in GATA mutant line 1, where duodenal expression was >10% of the wild-type mean and just outside the wild-type's broad normal range. These results suggest that, although GATA-4 serves as a strong activator from this enhancer, it may not be involved in its duodenal specificity.

Because of the higher level of CAT reporter expression in GATA mutant line 1 than in the other GATA mutant lines, it was possible to examine the effects of the mutations on transgene expression along various axes. A/P studies demonstrate that expression in line 1 is significantly anteriorized along this axis, where activity is present only in the first 2 cm of small intestine compared with the 4-6 cm observed for every wild-type transgene analyzed (15). The reason for this is not clear. It may be that, in the absence of GATA binding, activation of the enhancer is more dependent on other factor(s), such as PDX-1, and relies more on their expression pattern. Along the crypt-villus axis, activation of the transgene in line 1 is limited to the villi, like the wild type. However, this activation is not uniform and is limited to a variable number of villous epithelial cells. This result is likely related to the observation that enhancers increase the probability but not the level of gene expression (56). In cells that contain transgenes with the wild-type enhancer, the probability of expression is very high, and most, if not all, enterocytes show high-level expression. However, in cells that contain the crippled GATA mutant enhancer (11, 34, 43), the probability is relatively low and variable, with only a discrete subpopulation demonstrating high-level expression. Among all the GATA mutant lines, only the genomic insertion site for line 1 is permissive for this stochastic type of high-level enhancer activation in the presence of the mutated GATA sites. What the peculiar nature of this insertion site is, how the absence of GATA binding is overcome, and how this relates to the mechanism of normal enhancer function in general is not at all clear.

Among the three GATA family members expressed in the small intestinal epithelium, our EMSA studies indicate that the ADA enhancer specifically binds GATA-4 in duodenal nuclear extracts. This is somewhat surprising since our messenger RNA studies show that GATA-5 and GATA-6 are also transcribed in duodenum. The Northern blot results indicate that GATA-4 mRNA is the predominate species in the duodenum, where it is at least four to five times higher than either GATA-5 or GATA-6 mRNA. This predominance might explain most, but not all, of the GATA-4 specificity. Binding-site selectivity does not play a role, because a GATA consensus oligonucleotide that can bind all GATA family members (Fig. 2D) also binds only GATA-4 in the duodenal nuclear extracts (data not shown). One possible but unlikely explanation might be instability of GATA-5 and -6 in the extracts. Perhaps a more likely explanation is specific modification or sequestration of the proteins. GATA-4 has been shown to be serine phosphorylated, and this modification has been shown to enhance both its binding activity and its transcriptional potency (11, 34, 43). It has been proposed that this phosphorylation plays an important regulatory role in GATA-4 function in cardiomyocytes. It is unknown whether any specific nonnuclear localization or sequestration of GATA proteins occurs in intestinal cells. This is a relevant question, since the EMSAs were performed with nuclear extracts, not whole cell extracts. It is also possible that translational efficiency plays a role, affecting the relative level of GATA proteins compared with mRNA levels. Additional studies are underway to clarify which, if any, of these possibilities plays a role in determining the specificity of the ADA enhancer for GATA-4.

In a recent publication examining regulation of the SI gene, it was reported that GATA-4 binds the promoter of this gene and plays a combinatory role with Cdx2 and hepatocyte nuclear factor (HNF)-1alpha in the time- and position-dependent regulation of this gene in intestine (8). In a result that is strikingly similar to our results with the ADA enhancer, their binding studies showed that GATA sites in the SI promoter specifically bound GATA-4 from nuclear extracts of intestinal epithelial cells and not GATA-5 or -6. They do not identify a specific segment of intestine as the source of the nuclear extracts. Expression of the SI gene is dramatically induced at the suckling-weanling transition in mice, in a pattern very similar to that of ADA. Along the A/P axis the expression pattern of SI is quite different from the predominantly duodenal activation of ADA. SI is broadly expressed along the small intestine, with highest levels in jejunum but significant levels in ileum and duodenum. In light of these similarities and differences in expression patterns for ADA and SI, it is an important observation that the intestine-specific regulatory regions of both specifically bind GATA-4, not GATA-5 or -6. The effect of site-specific mutation of the SI promoter GATA site in vivo (such as in transgenic mice) has not yet been reported. The keys to which GATA factor functions in the regulation of a particular gene within an intestinal epithelial cell in vivo are likely the relative levels of transcription of the GATA factor genes, the localization and activation state of each GATA protein, and perhaps the context of the promoter or enhancer where the GATA-binding site is located. It has been shown that GATA-4 can bind its cognate site in compacted chromatin and open the local nucleosomal domain (12). This has been proposed as a mechanism for potentiation of gene expression during development, tissue specification, and cell differentiation (7). We considered this a possible mechanism by which mutation of GATA-binding sites, and possibly mutation of PDX-1-binding sites, might interfere with activation of enhancer function in vivo. The active enhancer has been mapped to a region intimately associated with the duodenal hypersensitive site, HS-D (15). Therefore, we examined formation of HS-D in the nuclear chromatin of intestinal cells from GATA mutant and PDX mutant transgenic mice. Although there is some variability in formation of HS-D evident between transgene constructs, HS-D clearly forms in both cases. Therefore, failure to initially open the chromatin at HS-D is not likely to be a significant cause for the dramatic effects on enhancer function that these mutant transgenes display.

We propose that a multiprotein enhanceosome forms on the ADA gene's duodenal enhancer in the combinatorial process of enhancer activation. Our studies thus far have implicated PDX-1 and GATA-4 as transcriptional activators in this combinatorial process. Other factors are almost certainly involved. Our footprinting and binding studies have suggested that the intestinal-specific homeodomain protein Cdx and the more ubiquitously expressed YY1 and NF-I family of factors have binding sites in the enhancer and may be involved in enhancer function (data not shown). Studies to investigate this possibility are underway. The ability of Cdx to interact with GATA-4 and HNF-1alpha to promote transcriptional activation was mentioned previously. Cdx has also been shown to interact with PDX-1 (24), although a transcriptional effect of this interaction has not been reported. GATA-4 and YY1 were recently shown to cooperate in cardiac regulation of B-type natriuretic peptide gene expression (5). In addition to protein-protein interaction among activators, a common theme in recent studies of eukaryotic gene regulation has been the involvement of coactivators and corepressors that do not bind DNA but function through protein-protein interactions (32) with the transcriptional activators. The factor p300 has been shown to function as a coactivator with GATA-4 (14) as well as GATA-5 and -6 (26, 55). It seems likely that coregulators are also involved in the ADA-enhancer complex. Additional studies will be necessary to determine the role of other factors besides PDX-1 and GATA-4 in regulation of duodenal-specific ADA expression through this multifactorial enhancer.

Recently, microarray technology was used to survey expression of >8,000 genes in segments of adult mouse gastrointestinal tract, from stomach to distal colon (4). The cDNAs from >500 genes showed elevated expression in one or more segments, and most of these genes displayed sharp segmental expression boundaries. The majority of these boundaries was at anatomically defined locations along the A/P axis. Computer analysis and comparison of putative regulatory regions indicated that a number of genes might be regulated coordinately. Basic analysis of regulatory regions, such as the ADA duodenal-specific enhancer and the factors that function there, will be important to elucidating how such global control is accomplished.


    ACKNOWLEDGEMENTS

We thank Patrick Ryan for technical assistance and work with the mouse colony. We also thank Helena Edlund and Jeffery Molkentin for supplying critical reagents.


    FOOTNOTES

This work is supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-52343 (to D. A. Wiginton).

Address for reprint requests and other correspondence: D. A. Wiginton, Div. of Developmental Biology, Dept. of Pediatrics, Univ. of Cincinnati College of Medicine and Cincinnati Children's Hospital Research Foundation, Cincinnati, OH 45229 (E-mail: dan.wiginton{at}chmcc.org).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

First published February 5, 2003;10.1152/ajpgi.00483.2002

Received 7 November 2002; accepted in final form 4 February 2003.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1.   Arceci, RJ, King AA, Simon MC, Orkin SH, and Wilson DB. Mouse GATA-4: a retinoic acid-inducible GATA-binding transcription factor expressed in endodermally derived tissues and heart. Mol Cell Biol 13: 2235-2246, 1993[Abstract/Free Full Text].

2.   Aronow, BJ, Silbiger RN, Dusing MR, Stock JL, Yager KL, Potter SS, Hutton JJ, and Wiginton DA. Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression. Mol Cell Biol 12: 4170-4185, 1992[Abstract/Free Full Text].

3.   Atchison, ML. Enhancers: mechanisms of action and cell specificity. Annu Rev Cell Biol 4: 127-153, 1988[Web of Science][Medline].

4.   Bates, MD, Erwin CR, Sanford LP, Wiginton D, Bezerra JA, Schatzman LC, Jegga AG, Ley-Ebert C, Williams SS, Steinbrecher KA, Warner BW, Cohen MB, and Aronow BJ. Novel genes and functional relationships in the adult mouse gastrointestinal tract identified by microarray analysis. Gastroenterology 122: 1467-1482, 2002[Web of Science][Medline].

5.   Bhalla, SS, Robitaille L, and Nemer M. Cooperative activation by GATA-4 and YY1 of the cardiac B-type natriuretic peptide promoter. J Biol Chem 276: 11439-11445, 2001[Abstract/Free Full Text].

6.   Blackburn, MR, and Kellems RE. Regulation and function of adenosine deaminase in mice. Prog Nucleic Acid Res Mol Biol 55: 195-226, 1996[Web of Science][Medline].

7.   Bossard, P, and Zaret KS. GATA transcription factors as potentiators of gut endoderm differentiation. Development 125: 4909-4917, 1998[Abstract].

8.   Boudreau, F, Rings EH, van Wering HM, Kim RK, Swain GP, Krasinski SD, Moffett J, Grand RJ, Suh ER, and Traber PG. Hepatocyte nuclear factor-1 alpha, GATA-4, and caudal related homeodomain protein Cdx2 interact functionally to modulate intestinal gene transcription. Implication for the developmental regulation of the sucrase-isomaltase gene. J Biol Chem 277: 31909-31917, 2002[Abstract/Free Full Text].

9.   Brickner, A, Gossage D, Dusing M, and Wiginton D. Identification of a murine homolog of the human adenosine deaminase thymic enhancer. Gene 167: 261-266, 1995[Web of Science][Medline].

10.   Carey, M. The enhanceosome and transcriptional synergy. Cell 92: 5-8, 1998[Web of Science][Medline].

11.   Charron, F, Tsimiklis G, Arcand M, Robitaille L, Liang Q, Molkentin JD, Meloche S, and Nemer M. Tissue-specific GATA factors are transcriptional effectors of the small GTPase RhoA. Genes Dev 15: 2702-2719, 2001[Abstract/Free Full Text].

12.   Cirillo, LA, Lin FR, Cuesta I, Friedman D, Jarnik M, and Zaret KS. Opening of compacted chromatin by early developmental transcription factors HNF3 (FoxA) and GATA-4. Mol Cell 9: 279-289, 2002[Web of Science][Medline].

13.   Clatworthy, JP, and Subramanian V. Stem cells and the regulation of proliferation, differentiation and patterning in the intestinal epithelium: emerging insights from gene expression patterns, transgenic and gene ablation studies. Mech Dev 101: 3-9, 2001[Web of Science][Medline].

14.   Dai, YS, and Markham BE. p300 functions as a coactivator of transcription factor GATA-4. J Biol Chem 276: 37178-37185, 2001[Abstract/Free Full Text].

15.   Dusing, MR, Brickner AG, Lowe SY, Cohen MB, and Wiginton DA. A duodenum-specific enhancer regulates expression along three axes in the small intestine. Am J Physiol Gastrointest Liver Physiol 279: G1080-G1093, 2000[Abstract/Free Full Text].

16.   Dusing, MR, Brickner AG, Thomas MB, and Wiginton DA. Regulation of duodenal specific expression of the human adenosine deaminase gene. J Biol Chem 272: 26634-26642, 1997[Abstract/Free Full Text].

17.   Dusing, MR, Florence EA, and Wiginton DA. Pdx-1 is required for activation in vivo from a duodenum-specific enhancer. J Biol Chem 276: 14434-14442, 2001[Abstract/Free Full Text].

18.   Fang, R, Olds LC, Santiago NA, and Sibley E. GATA family transcription factors activate lactase gene promoter in intestinal Caco-2 cells. Am J Physiol Gastrointest Liver Physiol 280: G58-G67, 2001[Abstract/Free Full Text].

19.   Fitzgerald, K, Bazar L, and Avigan MI. GATA-6 stimulates a cell line-specific activation element in the human lactase promoter. Am J Physiol Gastrointest Liver Physiol 274: G314-G324, 1998[Abstract/Free Full Text].

20.   Gao, X, Sedgwick T, Shi YB, and Evans T. Distinct functions are implicated for the GATA-4, -5, and -6 transcription factors in the regulation of intestine epithelial cell differentiation. Mol Cell Biol 18: 2901-2911, 1998[Abstract/Free Full Text].

21.   Gross, DS, and Garrard WT. Nuclease hypersensitive sites in chromatin. Annu Rev Biochem 57: 159-197, 1988[Web of Science][Medline].

22.   Guz, Y, Montminy MR, Stein R, Leonard J, Gamer LW, Wright CV, and Teitelman G. Expression of murine STF-1, a putative insulin gene transcription factor, in beta cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny. Development 121: 11-18, 1995[Abstract].

23.   Haynes, TL, Thomas MB, Dusing MR, Valerius MT, Potter SS, and Wiginton DA. An enhancer LEF-1/TCF-1 site is essential for insertion-site independent transgene expression in thymus. Nucleic Acids Res 24: 5034-5044, 1996[Abstract/Free Full Text].

24.   Heller, RS, Stoffers DA, Hussain MA, Miller CP, and Habener JF. Misexpression of the pancreatic homeodomain protein IDX-1 by the Hoxa-4 promoter associated with agenesis of the cecum. Gastroenterology 115: 381-387, 1998[Web of Science][Medline].

25.   Jacobsen, CM, Narita N, Bielinska M, Syder AJ, Gordon JI, and Wilson DB. Genetic mosaic analysis reveals that GATA-4 is required for proper differentiation of mouse gastric epithelium. Dev Biol 241: 34-46, 2002[Web of Science][Medline].

26.   Kakita, T, Hasegawa K, Morimoto T, Kaburagi S, Wada H, and Sasayama S. p300 protein as a coactivator of GATA-5 in the transcription of cardiac- restricted atrial natriuretic factor gene. J Biol Chem 274: 34096-34102, 1999[Abstract/Free Full Text].

27.   Ko, LJ, and Engel JD. DNA-binding specificities of the GATA transcription factor family. Mol Cell Biol 13: 4011-4022, 1993[Abstract/Free Full Text].

28.   Koutsourakis, M, Langeveld A, Patient R, Beddington R, and Grosveld F. The transcription factor GATA6 is essential for early extraembryonic development. Development 126: 723-732, 1999[Abstract].

29.   Krasinski, SD, Van Wering HM, Tannemaat MR, and Grand RJ. Differential activation of intestinal gene promoters: functional interactions between GATA-5 and HNF-1 alpha. Am J Physiol Gastrointest Liver Physiol 281: G69-G84, 2001[Abstract/Free Full Text].

30.   Kuo, CT, Morrisey EE, Anandappa R, Sigrist K, Lu MM, Parmacek MS, Soudais C, and Leiden JM. GATA4 transcription factor is required for ventral morphogenesis and heart tube formation. Genes Dev 11: 1048-1060, 1997[Abstract/Free Full Text].

31.   Laverriere, AC, MacNeill C, Mueller C, Poelmann RE, Burch JB, and Evans T. GATA-4/5/6, a subfamily of three transcription factors transcribed in developing heart and gut. J Biol Chem 269: 23177-23184, 1994[Abstract/Free Full Text].

32.   Lemon, B, and Tjian R. Orchestrated response: a symphony of transcription factors for gene control. Genes Dev 14: 2551-2569, 2000[Free Full Text].

33.   Leonard, J, Peers B, Johnson T, Ferreri K, Lee S, and Montminy MR. Characterization of somatostatin transactivating factor-1, a novel homeobox factor that stimulates somatostatin expression in pancreatic islet cells. Mol Endocrinol 7: 1275-1283, 1993[Abstract/Free Full Text].

34.   Liang, Q, Wiese RJ, Bueno OF, Dai YS, Markham BE, and Molkentin JD. The transcription factor GATA4 is activated by extracellular signal-regulated kinase 1- and 2-mediated phosphorylation of serine 105 in cardiomyocytes. Mol Cell Biol 21: 7460-7469, 2001[Abstract/Free Full Text].

35.   Maniatis, T, Goodbourn S, and Fischer JA. Regulation of inducible and tissue-specific gene expression. Science 236: 1237-1245, 1987[Abstract/Free Full Text].

36.   Merika, M, and Orkin SH. DNA-binding specificity of GATA family transcription factors. Mol Cell Biol 13: 3999-4010, 1993[Abstract/Free Full Text].

37.   Migchielsen, AA, Breuer ML, van Roon MA, te Riele H, Zurcher C, Ossendorp F, Toutain S, Hershfield MS, Berns A, and Valerio D. Adenosine-deaminase-deficient mice die perinatally and exhibit liver-cell degeneration, atelectasis and small intestinal cell death. Nat Genet 10: 279-287, 1995[Web of Science][Medline].

38.   Miller, CP, McGehee RE, Jr, and Habener JF. IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene. EMBO J 13: 1145-1156, 1994[Web of Science][Medline].

39.   Mitchell, PJ, and Tjian R. Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245: 371-378, 1989[Abstract/Free Full Text].

40.   Molkentin, JD. The zinc finger-containing transcription factors GATA-4, -5, and -6. Ubiquitously expressed regulators of tissue-specific gene expression. J Biol Chem 275: 38949-38952, 2000[Free Full Text].

41.   Molkentin, JD, Lin Q, Duncan SA, and Olson EN. Requirement of the transcription factor GATA4 for heart tube formation and ventral morphogenesis. Genes Dev 11: 1061-1072, 1997[Abstract/Free Full Text].

42.   Molkentin, JD, Tymitz KM, Richardson JA, and Olson EN. Abnormalities of the genitourinary tract in female mice lacking GATA5. Mol Cell Biol 20: 5256-5260, 2000[Abstract/Free Full Text].

43.   Morimoto, T, Hasegawa K, Kaburagi S, Kakita T, Wada H, Yanazume T, and Sasayama S. Phosphorylation of GATA-4 is involved in alpha 1-adrenergic agonist-responsive transcription of the endothelin-1 gene in cardiac myocytes. J Biol Chem 275: 13721-13726, 2000[Abstract/Free Full Text].

44.   Morrisey, EE, Ip HS, Lu MM, and Parmacek MS. GATA-6: a zinc finger transcription factor that is expressed in multiple cell lineages derived from lateral mesoderm. Dev Biol 177: 309-322, 1996[Web of Science][Medline].

45.   Morrisey, EE, Ip HS, Tang Z, Lu MM, and Parmacek MS. GATA-5: a transcriptional activator expressed in a novel temporally and spatially-restricted pattern during embryonic development. Dev Biol 183: 21-36, 1997[Web of Science][Medline].

46.   Morrisey, EE, Tang Z, Sigrist K, Lu MM, Jiang F, Ip HS, and Parmacek MS. GATA6 regulates HNF4 and is required for differentiation of visceral endoderm in the mouse embryo. Genes Dev 12: 3579-3590, 1998[Abstract/Free Full Text].

47.   Ohlsson, H, Karlsson K, and Edlund T. IPF1, a homeodomain-containing transactivator of the insulin gene. EMBO J 12: 4251-4259, 1993[Web of Science][Medline].

48.   Potten, CS, Booth C, and Pritchard DM. The intestinal epithelial stem cell: the mucosal governor. Int J Exp Pathol 78: 219-243, 1997[Web of Science][Medline].

49.   Potten, CS, and Loeffler M. Stem cells: attributes, cycles, spirals, pitfalls and uncertainties. Lessons for and from the crypt. Development 110: 1001-1020, 1990[Abstract/Free Full Text].

50.   Shi, D, Winston JH, Blackburn MR, Datta SK, Hanten G, and Kellems RE. Diverse genetic regulatory motifs required for murine adenosine deaminase gene expression in the placenta. J Biol Chem 272: 2334-2341, 1997[Abstract/Free Full Text].

51.   Soudais, C, Bielinska M, Heikinheimo M, MacArthur CA, Narita N, Saffitz JE, Simon MC, Leiden JM, and Wilson DB. Targeted mutagenesis of the transcription factor GATA-4 gene in mouse embryonic stem cells disrupts visceral endoderm differentiation in vitro. Development 121: 3877-3888, 1995[Abstract].

52.   Thanos, D, and Maniatis T. Virus induction of human IFN beta gene expression requires the assembly of an enhanceosome. Cell 83: 1091-1100, 1995[Web of Science][Medline].

53.   Traber, PG, and Silberg DG. Intestine-specific gene transcription. Annu Rev Physiol 58: 275-297, 1996[Web of Science][Medline].

54.   Van Wering, HM, Huibregtse IL, van der Zwan SM, de Bie MS, Dowling LN, Boudreau F, Rings EH, Grand RJ, and Krasinski SD. Physical interaction between GATA-5 and hepatocyte nuclear factor-1alpha results in synergistic activation of the human lactase-phlorizin hydrolase promoter. J Biol Chem 277: 27659-27667, 2002[Abstract/Free Full Text].

55.   Wada, H, Hasegawa K, Morimoto T, Kakita T, Yanazume T, and Sasayama S. A p300 protein as a coactivator of GATA-6 in the transcription of the smooth muscle-myosin heavy chain gene. J Biol Chem 275: 25330-25335, 2000[Abstract/Free Full Text].

56.   Walters, MC, Fiering S, Eidemiller J, Magis W, Groudine M, and Martin DI. Enhancers increase the probability but not the level of gene expression. Proc Natl Acad Sci USA 92: 7125-7129, 1995[Abstract/Free Full Text].

57.   Winston, JH, Hong L, Datta SK, and Kellems RE. An intron 1 regulatory region from the murine adenosine deaminase gene can activate heterologous promoters for ubiquitous expression in transgenic mice. Somat Cell Mol Genet 22: 261-278, 1996[Web of Science][Medline].

58.   Witte, DP, Wiginton DA, Hutton JJ, and Aronow BJ. Coordinate developmental regulation of purine catabolic enzyme expression in gastrointestinal and postimplantation reproductive tracts. J Cell Biol 115: 179-190, 1991[Abstract/Free Full Text].

59.   Xu, PA, and Kellems RE. Function of murine adenosine deaminase in the gastrointestinal tract. Biochem Biophys Res Commun 269: 749-757, 2000[Web of Science][Medline].

60.   Xu, PA, Winston JH, Datta SK, and Kellems RE. Regulation of forestomach-specific expression of the murine adenosine deaminase gene. J Biol Chem 274: 10316-10323, 1999[Abstract/Free Full Text].


Am J Physiol Gastrointest Liver Physiol 284(6):G1053-G1065
0193-1857/03 $5.00 Copyright © 2003 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
B. Chen, E. Yates, Y. Huang, P. Kogut, L. Ma, J. R. Turner, Y. Tao, B. Camoretti-Mercado, D. Lang, E. C. Svensson, et al.
Alternative promoter and GATA5 transcripts in mouse
Am J Physiol Gastrointest Liver Physiol, December 1, 2009; 297(6): G1214 - G1222.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. K. Divine, L. J. Staloch, H. Haveri, C. W. Rowley, M. Heikinheimo, and T. C. Simon
Cooperative interactions among intestinal GATA factors in activating the rat liver fatty acid binding protein gene
Am J Physiol Gastrointest Liver Physiol, August 1, 2006; 291(2): G297 - G306.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
L. Wang, A. Klopot, J.-N. Freund, L. N. Dowling, S. D. Krasinski, and J. C. Fleet
Control of differentiation-induced calbindin-D9k gene expression in Caco-2 cells by cdx-2 and HNF-1{alpha}
Am J Physiol Gastrointest Liver Physiol, November 1, 2004; 287(5): G943 - G953.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. K. Divine, L. J. Staloch, H. Haveri, C. M. Jacobsen, D. B. Wilson, M. Heikinheimo, and T. C. Simon
GATA-4, GATA-5, and GATA-6 activate the rat liver fatty acid binding protein gene in concert with HNF-1{alpha}
Am J Physiol Gastrointest Liver Physiol, November 1, 2004; 287(5): G1086 - G1099.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
H. M. van Wering, T. Bosse, A. Musters, E. de Jong, N. de Jong, C. E. Hogen Esch, F. Boudreau, G. P. Swain, L. N. Dowling, R. K. Montgomery, et al.
Complex regulation of the lactase-phlorizin hydrolase promoter by GATA-4
Am J Physiol Gastrointest Liver Physiol, October 1, 2004; 287(4): G899 - G909.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
T. J. Oesterreicher and S. J. Henning
Rapid induction of GATA transcription factors in developing mouse intestine following glucocorticoid administration
Am J Physiol Gastrointest Liver Physiol, June 1, 2004; 286(6): G947 - G953.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
284/6/G1053    most recent
00483.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (18)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dusing, M. R.
Right arrow Articles by Wiginton, D. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dusing, M. R.
Right arrow Articles by Wiginton, D. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2003 by the American Physiological Society.