|
|
||||||||
Division of Developmental Biology, Department of Pediatrics, University of Cincinnati College of Medicine and Cincinnati Children's Hospital Research Foundation, Cincinnati, Ohio 45229
| |
ABSTRACT |
|---|
|
|
|---|
The purine metabolic gene adenosine deaminase (ADA) is expressed at high levels in a well-defined spatiotemporal pattern in the villous epithelium of proximal small intestine. A duodenum-specific enhancer module responsible for this expression pattern has been identified in the second intron of the human ADA gene. It has previously been shown that binding of the factor PDX-1 is essential for function of this enhancer. The studies presented here examine the proposed roles of GATA factors in the enhancer. Site-directed mutagenesis of the enhancer's GATA binding sites crippled enhancer function in 10 lines of transgenic mice, with 9 of the lines demonstrating <1% of normal activity. Detailed studies along the longitudinal axis of mouse small intestine indicate that GATA-4 and GATA-5 mRNA levels display a reciprocal pattern, with low levels of GATA-6 throughout. Interestingly, gel shift studies with duodenal nuclear extracts showed binding only by GATA-4.
adenosine deaminase; GATA-4; intestine; intestinal epithelium
| |
INTRODUCTION |
|---|
|
|
|---|
THE MAMMALIAN INTESTINAL EPITHELIUM has a complex, but highly defined, architecture. The primary components of this architecture in the small intestine are the crypt and villus. Within the lower parts of the crypts are anchored stem cells that serve as precursors of all four cell types populating the continuously regenerating epithelium (48, 49). After undergoing cell division and the initiation of differentiation in the crypts, the immature cells undergo a bipolar migration. Enterocytes, goblet cells, and enteroendocrine cells migrate as a linear column up the surface of the villus. Paneth cells migrate in the opposite direction toward the base of the crypt. The function of each of these various differentiated cell types in the intestinal epithelium is defined principally by the set(s) of genes that are expressed in that cell type. Therefore, profiles of expression exist along the crypt-villus axis that are dependent on cell type, differentiation status, and cell migration. In addition, significant variations in gene expression within the same cell type are observed along the cephalocaudal (horizontal) axis of the intestine. These functional variations are established and maintained in the adult even though the intestinal epithelium undergoes a continuous renewal. It is proposed that a discrete regulatory network controls these processes. This interrelated network of transcription factors and cis-acting elements that specify and regulate gene expression along the various physical and temporal axes of the small intestine is just now beginning to be sorted out (13, 53). The analysis of promoters and enhancers that specify the intestinal expression of individual genes can contribute significantly to that process.
The adenosine deaminase (ADA) gene has a complex, highly regulated tissue-specific pattern of expression. It is expressed in all mammalian tissues, but the expression levels vary over a range of several thousand-fold and undergo significant changes in various tissues and cell types in a developmentally specific manner (6). A number of distinct genomic regions (regulatory modules) that control ADA tissue expression in mice and humans have been identified and characterized (2, 9, 15, 50, 57, 60). These modules contain tissue-specific enhancers that bind a variety of transcription factors, which collaborate to control chromatin structure and activate ADA gene transcription in distinct cell types. One cell type that exhibits very high levels of ADA expression is the absorptive enterocyte of the duodenal epithelium in the small intestine. This high-level expression in enterocytes is observed only in the duodenum and only in enterocytes that have migrated past the crypt-villus junction on the villus. Developmentally, this enhancer-dependent high-level activation is first observed in mice at the suckling-weanling transition and continues into adulthood. Gene ablation studies have shown that ADA expression is essential for duodenal integrity and viability (37, 59). Transgenic mouse studies have been used to identify and map an enhancer that activates high-level ADA expression specifically in the duodenum (15-17). The enhancer can activate expression that recapitulates endogenous gene activation exactly along three distinct axes: the cephalocaudal [anterior/posterior (A/P) axis], the crypt-villus differentiation axis, and the axis of developmental time (15, 16). In initial footprinting studies, a number of transcription factors were indirectly implicated in enhancer function (15). Recent studies have shown that the factor PDX-1 is critical for enhancer function (17). The present study examines proposed roles for the GATA family of transcription factors in the enhancer's function.
Each member of the GATA family of transcription factors has a highly conserved DNA-binding domain containing two zinc fingers that recognizes the consensus sequence WGATAR (27, 36). Six GATA factors have been identified in vertebrates, and these can be divided into two subfamilies, GATA-1, -2, and -3 and GATA-4, -5, and -6. The latter subfamily is expressed in various tissues of mesodermal and endodermal origin, including heart, liver, lung, gonad, and gut, where they play critical roles in regulating tissue-specific gene expression (40). Targeted disruption of the GATA-4, -5, and -6 mouse genes have identified roles for these factors in formation of heart, endoderm, lung epithelium, gastric epithelium, and genitourinary tract (25, 28, 30, 41, 42, 46, 51). In adult mice, GATA-4, GATA-5, and GATA-6 are all expressed in epithelium of the small intestine (1, 40, 44). Initial analysis of GATA factor expression in the gastrointestinal epithelium of embryonic chicks and young hatchlings led to the proposal of both distinct (20) and overlapping (31) functions for GATA-4, -5, and -6 in that epithelium. GATA factors have been implicated in the intestine-specific regulation of promoter function for several genes, including sucrase-isomaltase (SI; see Refs. 8, 29, 53), rat and human lactase-phlorizin hydrolase (18, 19, 29, 54), and intestinal fatty acid-binding protein (20). In the studies presented here, transgenic mouse experiments were used to identify a crucial role for GATA binding sites in the in vivo function of the duodenum-specific enhancer of the ADA gene. Additional studies with duodenal nuclear extracts indicate that these sites are bound principally, if not exclusively, by GATA-4.
| |
EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Oligonucleotides.
Oligonucleotides were synthesized at the University of Cincinnati DNA
core facility and are as shown in Fig.
1B or as described below.
Oligonucleotides G2 and PDX-1 have been published previously as
oligonucleotides FP 2C and P1, respectively (17).
Oligonucleotide consensus sequences for activator protein (AP)-1
CGCTTGATGACTCA- GCCGGAA and GATA CACTTGATAACAGAAAGTGATAACTCT are as
indicated in the Santa Cruz Biotechnology catalog. Probe
oligonucleotides for EMSA experiments were gel purified as reported
(17).
|
Transient transfection. The GATA expression vector plasmids, pcDNA GATA-4, pcDNA GATA-5, and pcDNA GATA-6, were the generous gift of Jeffery Molkentin (Cincinnati Children's Hospital Medical Center). The human adenocarcinoma cell line Caco-2 (no. HTB 37; ATCC) was cultured in DMEM with 10% FBS, 0.05 units penicillin, and 0.05 µg/ml streptomycin. DNA was introduced into cells at 70-80% confluence by Life Technologies (Carlsbad, CA) Lipofectin transfection according to the manufacturer's protocol using 27.7 µl Lipofectin and 2 µg DNA/100-mm dish. Media was replaced 16 and 40 h after transfection. After transfection (64 h), cells were harvested and nuclear extracts were prepared.
Extract preparation.
Mouse duodenal nuclear extracts (MDNE) were prepared as previously
described (17). Transfected cells were washed with PBS at
37°C and then scraped into 1 ml PBS at 4°C, pelleted, washed again
with 1 ml PBS at 4°C, and repelleted. Cells were resuspended in two
packed cell volumes of lysis buffer (10 mM HEPES-KOH, pH 7.9, 10 mM
KCl, 0.1 mM EDTA, 1.5 mM MgCl2, 0.2% Nonidet P-40, 1 mM
DTT, and 0.5 mM PEFABLOC), vortexed for 5 min, and incubated 10 min on
ice. Nuclei were pelleted, washed one time with lysis buffer, and
pelleted again. The nuclear pellet was resuspended in 100 µl
extraction buffer (20 mM HEPES-KOH, pH 7.9, 420 mM NaCl, 0.1 mM EDTA,
1.5 mM MgCl2, 25% glycerol, 1 mM DTT, and 0.5 mM PEFABLOC). Samples were incubated on ice for 20 min and vortexed every
10 s. Samples were spun at 15,000 rpm at 4°C for 20 min in a
microcentrifuge. The supernatant was removed and stored at
70°C.
EMSA. MDNE (10 µg)- or Caco-2-transfected nuclear extract (2 µl) was used for each gel shift reaction. Normal rabbit IgG and antibodies to GATA-4, -5, and -6 were purchased from Santa Cruz Biotechnology. Supershift EMSAs were incubated overnight at 4°C.
Site-directed mutagenesis and transgene preparation.
All enzymes were from New England Biolabs (Beverly, MA) unless
otherwise stated. pALTER 319+ (17) was used as a template for mutagenesis reactions using the Promega Altered Sites protocol (Madison, WI). GATA mutation oligonucleotides were prepared at the
University of Cincinnati DNA core facility with the following sequences: GCGTACGTTTGAACCCAGAGTGTCTGCCCCCGAGTCC (G1m-ext),
GCTCCATAAATGTCACTTAATGAGTATATTCTTATTAATTGGAGC (G2m-ext), and
GGGGTGAAACCTCTTGGCTTAAGTCTGCCTGGCCTTTGC (G3m-ext). Successive
rounds of mutagenesis were used to introduce each mutation shown in
Fig. 1B into the enhancer core fragment. The mutated BsiWI
enhancer fragment containing the GATA site mutations was sequenced in
its entirety to ensure fidelity of both the mutated sites and the
remaining sequences of the enhancer. The GATA-mutated enhancer fragment
was liberated with BsiWI and ligated into BsiWI cut p5'acba L117
D
(15) to generate the plasmid p5'acba L117 GATA mut.
Transgene fragments, mice, and analysis. The transgene listed as the wild type has been described previously and characterized as such and as Transgene IV (15, 17). The plasmid p5'acba L117 GATA mut was digested with NdeI and PvuI. The resulting 18,471-bp fragment was isolated and purified as described previously (15). Transgenic mice were made by microinjection at both the Cincinnati Children's Hospital Research Foundation and the University of Cincinnati core facilities. Analysis of F1 mice was routinely performed between 4 and 6 wk or at other times as noted. CAT assays, protein determination, and copy number analysis were performed as previously described (15). Tissues assayed included tongue, esophagus, stomach, duodenum, jejunum, ileum, colon, liver, and thymus for each line.
In situ hybridization. In situ hybridization (ISH) experiments were performed using CAT-specific RNA probes on transgenic duodena from wild-type line 10 or GATA mutant line 1, as described previously (15, 16).
RNA isolation and Northern blot analysis. Stomach, small intestine, cecum, colon, liver, and heart were isolated from five 7-wk-old nontransgenic FVB/N mice. The small intestine was subdivided further into 2-cm segments, and equivalent segments were pooled. The poly(A)+ fraction of RNA was isolated as described previously (4). Samples containing 1 µg poly(A)+ RNA were electrophoresed and blotted, and Northern blot analysis was performed using the RNA antisense probes described below. pcDNA GATA-4 was digested with EagI, filled with T4 DNA polymerase, and subsequently digested with EcoRI. The 436-bp fragment was isolated and ligated to SmaI-EcoRI-cut pGEM4Z (Promega). The resulting plasmid pGEM-G4 was linearized with EcoRI and used as a template for antisense RNA probe synthesis using T7 RNA polymerase. pcDNA GATA-5 was digested with NcoI, filled with T4 DNA polymerase, and then digested with HindIII. A 389-bp fragment was isolated and ligated to SmaI-HindIII-digested pGEM-4Z. The resulting plasmid, pGEM-G5.2, was linearized with HindIII and used as a template for radioactive antisense RNA probes synthesized with SP6 RNA polymerase. pcDNA GATA-6 was digested with AccI, filled with T4 DNA polymerase, and then digested with SacI. A 528-bp fragment was isolated and ligated to SmaI- and SacI-digested pGEM-4Z to form pGEM-G6. pGEM-G6 was linearized with HindIII and used as a template for radioactive antisense probe synthesis using SP6 RNA polymerase. Probes were synthesized and stripped as directed in the Ambion Strip-EZ kit (Austin, TX). GATA-4/5/6 mRNA was quantitated using a PhosphorImager (Molecular Dynamics) and normalized to both the background and the specific activity of the probe.
DNase I hypersensitivity. Transgenic mice were bred to homozygosity. Duodena were isolated from four adult mice, and nuclei were prepared, as described previously (17), with the following exceptions. Buffers A and B were supplemented only with 80 µM PMSF and 1.0 mM DTT, and N-acetyl-L-cysteine was omitted. The nuclear pellet was resuspended in 5 ml cold nuclei wash buffer (20 mM HEPES-KOH, pH 7.9, 13.3 mM NaCl, 13.3 mM KCl, 0.133 mM spermidine, 0.5 mM spermine, 2 mM EDTA, 0.5 mM EGTA, and 3 mM MgCl2), and the number of nuclei was estimated using a hemacytometer. DNase I treatment, DNA isolation, and Southern blotting were performed as described previously (16) except that each sample was treated with 9 U of DNase I for 10 min at 30°C.
| |
RESULTS |
|---|
|
|
|---|
Duodenum-specific enhancer contains three sites that bind GATA-4.
The duodenum-specific enhancer region is located within the second
intron of the human ADA gene (Fig. 1A). Two
consensus GATA recognition sequences were observed within the
footprinted regions of this enhancer. A third consensus match sequence
is also present in the enhancer core but was not observed to footprint
(perhaps because of its location adjacent to the end of the DNA strand used for these experiments). To assess the binding ability of these
sites, oligonucleotides corresponding to these sequences (G1, G2, and
G3 in Fig. 1B) were synthesized as well as an
oligonucleotide containing a GATA consensus binding sequence. The
position of the putative GATA binding site within each oligonucleotide
is shown in Fig. 1B. Each oligonucleotide was labeled and
used as a probe in EMSA experiments (Fig.
2). As seen in Fig. 2A, an
equivalent slowly migrating complex is observed with G1, G2, and G3
oligonucleotides upon addition of 10 µg MDNE (lanes 1,
4, and 8). This shifted complex can be
specifically prevented by the addition of 100-fold molar excess
unlabeled GATA consensus oligonucleotide to the binding reaction (Fig.
2A, lanes 2, 5, and 9). For
each oligonucleotide probe, this complex was observed to be GATA
specific, since it was not affected by the addition of the same amount
of an unlabeled AP-1 consensus oligonucleotide (Fig. 2A,
lane 10). This complex is labeled as GATA in Fig. 2,
A-D. The trio of faster-migrating complexes observed with
the G2 probe (Fig. 2A, lanes 4 and 5) were all previously identified as complexes that contain the
homeodomain factor PDX-1 (17). The addition of both the
PDX-1 and the GATA oligonucleotides to the binding reaction effectively
prevents formation of all complexes on this probe (Fig. 2A,
lane 6).
|
GATA-4 complexes do not form on the mutated oligonucletides G1m, G2m, and G3m. Experiments were carried out to identify sequence changes that specifically eliminate GATA binding in vitro. Various base pair changes were introduced into each oligonucleotide sequence and tested in EMSA experiments for loss of GATA binding (data not shown). The optimal mutations are shown in the sequences designated as G1m, G2m, and G3m in Fig. 1B. EMSA experiments using the wild-type and mutated oligonucleotides as probe are shown in Fig. 2B. Once again, the slowly migrating complex, labeled as GATA, is observed in the lanes containing wild-type probe and MDNE (lanes 1, 4, and 6). Addition of excess GATA consensus sequence oligonucleotide to the binding reactions prevented complex formation (lanes 2 and 7). When the GATA-mutated oligonucleotides were used as probes, the GATA complex was not observed (lanes 3, 5, and 8), indicating that GATA binding has been ablated. The mutated probes do retain other identified (PDX-1, lane 5) and unidentified (lane 3) complexes. Loss of GATA binding on the G2m probe results in an apparent increase in PDX-1 binding. A variety of other GATA mutations tested resulted in a similar increase (data not shown). The binding sites for PDX-1 (ACTTAATG) and GATA (TGATAA) overlap considerably in the G2 oligonucleotide (Fig. 1B). A slight increase in GATA binding was previously observed for the PDX-1-specific mutation of this oligonucleotide (17). Increased binding in the mutated oligonucleotides may reflect loss of competition between PDX-1 and GATA-4 for their overlapping binding sites upon the loss of one or the other.
GATA mutant transgenic mice have decreased duodenal CAT activity. The mutations that resulted in loss of GATA binding (G1m, G2m, and G3m) were used in transgenic studies to assess the role these factors play in the enhancer function in vivo. Mutations were introduced into the enhancer core such that all the GATA sites within the enhancer core were ablated. This mutated enhancer core was then used to replace the wild-type enhancer core within a 13-kb intragenic ADA fragment, maintaining the same position and orientation. Wild-type and GATA mutant transgenes each contain analogous DNA fragments (Fig. 1A). These include a 3.8-kb human ADA promoter/5' flanking segment attached to the CAT coding sequence and the 13-kb fragment containing the enhancer and its core. The only relevant sequence differences between these transgenes is the mutations described above. Ten independent transgenic lines were produced and analyzed for the GATA mutant.
A minimum of two adult F1 mice were analyzed for CAT activity in various tissues for each independent transgenic line. Protein concentration and copy number were also assessed. All transgenic CAT activities reported are normalized to both protein concentration and transgene copy number and are expressed in units of picomoles per hour per 100 µg protein/transgene copy (Fig. 3 and Table 1). CAT activities for the wild-type transgene were reported previously (15-17) and are included here for comparison only. As shown in Fig. 3, duodenal CAT activity/copy in mice containing the wild-type 13-kb fragment range from 1,400 to 31,000 units, with a mean activity of 9,100 units. In every line, duodenum is the site of highest transgene activity and is usually 100- to 1,000-fold greater than the next highest tissue (Table 1).
|
|
A/P CAT distribution is altered in the GATA mutant transgenic
duodena.
Along the A/P axis of the small intestine, high levels of endogenous
mouse ADA are restricted to the region between the pyloric sphincter and a point 4-5 cm distal to it (16). The
transgene containing the wild-type enhancer exhibits an identical
pattern along the A/P axis, with high-level CAT activity limited to the first 4-5 cm of the small intestine, as shown in
Fig. 4A (16). To
examine the effects of the GATA site mutations on the expression of the
transgene in vivo along the A/P axis, small intestines from GATA mutant
line 1 were analyzed segmentally (Fig. 4B). The intestines were cut into 2-cm sections beginning at the pyloric sphincter, and each segment was assayed for transgene activity. In
these mice, essentially all of the activity is limited to the first 2 cm of the small intestine. Therefore, not only is the overall duodenal
activity significantly lower in transgenic mice containing the
GATA-mutated enhancer compared with the wild type, but the region of
the small intestine expressing the transgene at high levels is reduced
and limited to the very most anterior portion of the small intestine.
|
GATA mutant duodena have decreased numbers of cells on the villus
that are able to achieve full transgene activation.
High-level endogenous expression of ADA in the mouse small
intestine is observed predominantly in a subpopulation of the
differentiated epithelial cells, the enterocytes, found on the villus
(58). As seen by ISH experiments using an antisense CAT
probe, duodena from mice containing the wild-type transgene exhibit a
pattern of CAT expression along this crypt/villus axis that is
identical to the endogenous ADA expression (Fig.
5A). Transgene expression is
limited to the villous epithelium composed primarily of differentiated enterocytes. The transgene is not expressed in the crypt or in the
underlying mucosa. ISH was also used to examine the CAT expression pattern in GATA mutant line 1, the single mutant line that
showed significant activity. The levels and patterns of duodenal
activities from this line showed reduced activities when compared with
wild-type activities, and mice within this line showed a high degree of variability, even among transgenic littermates. Figure 5,
D-F, shows in situ experiments on a single transgenic
mouse. Crypt-villus distribution has not changed qualitatively from the
wild type in that high-level expression is still limited to the villous epithelium and absent from the crypts and the mucosa. However, the
total number of cells expressing the transgene at high levels is
reduced significantly, resulting in a mosaic pattern of expression (Fig. 5, D and E). Figure 5B and the
enlarged subregion in Fig. 5C show ISH performed on a
transgenic littermate to the mouse used for D-F. In this
mouse, the loss of cells expressing high levels of the transgene is
even more dramatic. Only three to five cells per cross section express
the transgene (Fig. 5C). These few cells do appear to
express the transgene quite robustly at levels similar to those
observed with the wild-type enhancer transgene. This suggests that the
reduced activity observed in the GATA mutant enhancer mice is not the
result of decreased transgene expression in all cells but rather a
decrease in the total number of cells able to express at high levels.
|
GATA-4 is the predominant GATA family member in the duodenum.
EMSA studies suggested that only GATA-4 protein was present in
detectable amounts in the adult mouse duodenum. The relative cephalocaudal expression and distribution of the GATA factors within
mouse small intestine have not yet been defined. To investigate this
further, Northern blot analysis was performed to examine the
distribution of each GATA factor along the length of the small intestine and in other tissues. Five adult FVB/N mice were killed. Heart, stomach, liver, cecum, colon, and small intestine were harvested. The small intestines were divided into 2-cm segments, and
equivalent segments from the five mice were pooled. The
poly(A)+ RNA was isolated, and 1 µg of each was
electrophoresed, blotted, and hybridized to labeled antisense GATA-4,
GATA-5, or GATA-6 RNA probes (Fig.
6A). The results agree in
general with previous studies that investigated GATA expression in
liver, heart, and the small intestine (1, 8, 44, 45).
Appropriately sized mRNA were observed with each probe. A 4-kb GATA-4
mRNA was observed in heart, stomach, and all of the small intestine
samples. It was absent from cecum and colon and present in only small
amounts in liver. Two distinct GATA-5 mRNA species, a 3.2- and a 1.8-kb mRNA, were observed. Both species had been observed previously when
using a probe to the open-reading frame of GATA-5 such as the one used
in this experiment (45). Both mRNA were found to correspond to cDNAs that encoded a full-length GATA-5 protein. GATA-5
mRNA was observed in the stomach and all small intestine segments. It
was absent from cecum, colon, liver, and heart. A 3.2-kb GATA-6 mRNA
was found in all small intestine sections, stomach, cecum, colon and
heart and was absent from liver. A PhosphorImager quantitation of these
signals is shown in Fig. 6B. Because both GATA-5 mRNAs
observed in the intestine contain the entire coding region, these bands
were quantitated and added together. In all small intestinal regions,
GATA-6 is expressed at a relatively uniform low level. In the regions
encompassing the duodenum, proximal jejunum, and the distal jejunum,
GATA-4 mRNA is the predominant mRNA species. In more distal segments,
GATA-4 mRNA levels drop dramatically such that, in the distal ileum,
GATA-4 and GATA-6 are expressed at similar levels and GATA-5 is the
predominant mRNA. GATA-5 mRNA levels are lowest in the proximal
portions of the small intestine and show an increase distally,
especially in ileum. Therefore, although each GATA mRNA was detected in
all sections of the small intestine, high-level expression of GATA-4 and of GATA-5 appear to be complementary to one another along the
length of the mouse small intestine.
|
Mutation of specific protein-binding sites in the duodenal enhancer
does not interfere with formation of hypersensitive site D.
Many active enhancers are located in a region of DNA with altered
chromatin structure, resulting in increased sensitivity to DNase I
(21). We have previously characterized the enhancer region
of the human ADA gene through DNase I hypersensitivity experiments (16). DNase I mapping of intron 2 of the human
ADA transgene in duodenal nuclear DNA has identified
multiple hypersensitive sites, and the duodenal enhancer is associated
with one of these sites, specifically hypersensitive site D (HS-D in
Fig. 1A; see Refs. 15 and 16). We have
demonstrated above that mutation of the GATA sites within the enhancer
results in a significant loss of enhancer-driven expression. Previous
studies have shown that specific mutations to the PDX-1 sites in the
enhancer result in a complete loss of enhancer-driven expression
(15). Studies examining the ADA thymic enhancer
region have demonstrated that loss of a particular enhancer-binding
factor can result in altered regional hypersensitivity and altered
expression (23). To determine if loss of activity in the
PDX or GATA mutant enhancers is associated with an inability of HS-D to
form, DNase I hypersensitivity analysis of transgenic duodenal nuclear
DNA was performed. Nuclei from duodena of mice expressing each of these
mutant transgenes were treated with DNase I, and the hypersensitive
sites were identified and compared with those in the wild-type
transgene. DNase hypersensitivity experiments were performed as
described previously (16). A Southern blot of the
hypersensitive regions from the wild-type (Transgene V, line 10) and
mutated [GATA mutant (line 8) and PDX mutant (line 8)] transgenes are shown in Fig. 7.
DNase I hypersensitive sites are also shown in Fig. 7. Despite the
observed complete loss of enhancer function in these GATA and PDX
mutant lines, the duodenal-specific hypersensitive site HS-D is able to
form in these mice. Although there are apparent small variations in the
relative intensity of the bands, HS-D, along with all the other
previously observed hypersensitive sites, are observed to form in each
case.
|
| |
DISCUSSION |
|---|
|
|
|---|
Enhancers play a central role in eukaryotic gene regulation, especially in controlling tissue-specific expression (35). Enhancer function normally results from the combinatorial action of multiple factors whose binding sites reside within a regulatory module of discrete size and location (3, 39). These factors may be tissue specific in their expression pattern or more widely expressed, even ubiquitous. Factors bound at the sites in an enhancer regulatory module are thought to form a higher-order protein complex, termed an enhanceosome, during functional activation (10, 52). Previously, we identified a duodenum-specific enhancer in the second intron of the human ADA gene (15, 16). The core of this enhancer was mapped to a region of ~300 bp associated with a duodenum-specific DNase I HS-D (15). Within this core region, multiple proposed factor binding sites were identified by DNase I footprinting experiments (15). Recently, we demonstrated that several of these sites bind the transcription factor PDX-1 and that PDX-1 binding is essential to the enhancer's in vivo function (17). In adults, PDX-1 expression is limited principally to duodenum and pancreas (22, 33, 38, 47). Therefore, PDX-1 likely contributes significantly to the tissue specificity of the duodenal enhancer. However, evidence indicates that PDX-1 alone is insufficient to activate the enhancer (17). This is not surprising, considering our knowledge of the combinatorial factor requirements of most enhancers and the multiple footprints observed in the enhancer core.
The evidence presented here indicates that the GATA sites identified in
the enhancer also play a critical role in its function. Mutation of
these sites that prevented GATA factor binding severely crippled
enhancer function in vivo and in some transgenic mouse lines
essentially destroyed it. There are some discernable differences from
previous transgenic mouse studies in which the enhancer module was
deleted or specifically mutated. The ability to distinguish these
differences is due in part to the exquisite sensitivity of the CAT
reporter assay, the number of wild-type lines assayed, and the full
penetrance of the wild-type transgene. The residual duodenal CAT
activity in the GATA mutant transgenic mice, although quite low, is
higher than that observed for the PDX mutant mice or
enhancer mice
that contain a small deletion of the entire enhancer core region
(15, 17). The mean normalized duodenal CAT value in 10 PDX
mutant lines is 0.5 units (excluding line 3, which shows
generalized activation in all tissues). In the seven lines of
enhancer mice, where expression is presumably driven only by the
ADA promoter, the normalized duodenal CAT value is also 0.5 units. The mean value for GATA mutant mice is 90 units, almost 200 times higher. Even without the unusually high value from line
1, the GATA mutant mean value would be 16 units (>30 times
higher). In addition, some residual duodenal specificity is seen in the
GATA mutant mice that is not observed in the PDX mutant mice or
enhancer mice. In 5 of the 10 GATA mutant lines, duodenum is the
highest-expressing tissue. These are the lines with the highest
residual duodenal CAT activity (lines 1, 3,
4, 6, and 7). Duodenum was the
highest-expressing tissue among the 9 tissues surveyed in only 2 of the
17 PDX mutant mice and
enhancer mouse lines. Therefore, although
mutation of the GATA binding sites had a dramatic effect on enhancer
function in vivo, some residual duodenal-specific activation was
observable. This was most clearly evident in GATA mutant line
1, where duodenal expression was >10% of the wild-type mean and
just outside the wild-type's broad normal range. These results suggest
that, although GATA-4 serves as a strong activator from this enhancer,
it may not be involved in its duodenal specificity.
Because of the higher level of CAT reporter expression in GATA mutant line 1 than in the other GATA mutant lines, it was possible to examine the effects of the mutations on transgene expression along various axes. A/P studies demonstrate that expression in line 1 is significantly anteriorized along this axis, where activity is present only in the first 2 cm of small intestine compared with the 4-6 cm observed for every wild-type transgene analyzed (15). The reason for this is not clear. It may be that, in the absence of GATA binding, activation of the enhancer is more dependent on other factor(s), such as PDX-1, and relies more on their expression pattern. Along the crypt-villus axis, activation of the transgene in line 1 is limited to the villi, like the wild type. However, this activation is not uniform and is limited to a variable number of villous epithelial cells. This result is likely related to the observation that enhancers increase the probability but not the level of gene expression (56). In cells that contain transgenes with the wild-type enhancer, the probability of expression is very high, and most, if not all, enterocytes show high-level expression. However, in cells that contain the crippled GATA mutant enhancer (11, 34, 43), the probability is relatively low and variable, with only a discrete subpopulation demonstrating high-level expression. Among all the GATA mutant lines, only the genomic insertion site for line 1 is permissive for this stochastic type of high-level enhancer activation in the presence of the mutated GATA sites. What the peculiar nature of this insertion site is, how the absence of GATA binding is overcome, and how this relates to the mechanism of normal enhancer function in general is not at all clear.
Among the three GATA family members expressed in the small intestinal epithelium, our EMSA studies indicate that the ADA enhancer specifically binds GATA-4 in duodenal nuclear extracts. This is somewhat surprising since our messenger RNA studies show that GATA-5 and GATA-6 are also transcribed in duodenum. The Northern blot results indicate that GATA-4 mRNA is the predominate species in the duodenum, where it is at least four to five times higher than either GATA-5 or GATA-6 mRNA. This predominance might explain most, but not all, of the GATA-4 specificity. Binding-site selectivity does not play a role, because a GATA consensus oligonucleotide that can bind all GATA family members (Fig. 2D) also binds only GATA-4 in the duodenal nuclear extracts (data not shown). One possible but unlikely explanation might be instability of GATA-5 and -6 in the extracts. Perhaps a more likely explanation is specific modification or sequestration of the proteins. GATA-4 has been shown to be serine phosphorylated, and this modification has been shown to enhance both its binding activity and its transcriptional potency (11, 34, 43). It has been proposed that this phosphorylation plays an important regulatory role in GATA-4 function in cardiomyocytes. It is unknown whether any specific nonnuclear localization or sequestration of GATA proteins occurs in intestinal cells. This is a relevant question, since the EMSAs were performed with nuclear extracts, not whole cell extracts. It is also possible that translational efficiency plays a role, affecting the relative level of GATA proteins compared with mRNA levels. Additional studies are underway to clarify which, if any, of these possibilities plays a role in determining the specificity of the ADA enhancer for GATA-4.
In a recent publication examining regulation of the SI gene,
it was reported that GATA-4 binds the promoter of this gene and plays a
combinatory role with Cdx2 and hepatocyte nuclear factor (HNF)-1
in
the time- and position-dependent regulation of this gene in intestine
(8). In a result that is strikingly similar to our
results with the ADA enhancer, their binding studies showed that GATA sites in the SI promoter specifically bound GATA-4
from nuclear extracts of intestinal epithelial cells and not GATA-5 or
-6. They do not identify a specific segment of intestine as the source
of the nuclear extracts. Expression of the SI gene is
dramatically induced at the suckling-weanling transition in mice, in a
pattern very similar to that of ADA. Along the A/P axis the
expression pattern of SI is quite different from the predominantly duodenal activation of ADA. SI is
broadly expressed along the small intestine, with highest levels in
jejunum but significant levels in ileum and duodenum. In light of these
similarities and differences in expression patterns for ADA
and SI, it is an important observation that the
intestine-specific regulatory regions of both specifically bind GATA-4,
not GATA-5 or -6. The effect of site-specific mutation of the
SI promoter GATA site in vivo (such as in transgenic mice)
has not yet been reported. The keys to which GATA factor functions in
the regulation of a particular gene within an intestinal epithelial
cell in vivo are likely the relative levels of transcription of the
GATA factor genes, the localization and activation state of each GATA
protein, and perhaps the context of the promoter or enhancer where the
GATA-binding site is located. It has been shown that GATA-4 can bind
its cognate site in compacted chromatin and open the local nucleosomal
domain (12). This has been proposed as a mechanism for
potentiation of gene expression during development, tissue
specification, and cell differentiation (7). We considered
this a possible mechanism by which mutation of GATA-binding sites, and
possibly mutation of PDX-1-binding sites, might interfere with
activation of enhancer function in vivo. The active enhancer has been
mapped to a region intimately associated with the duodenal
hypersensitive site, HS-D (15). Therefore, we examined
formation of HS-D in the nuclear chromatin of intestinal cells from
GATA mutant and PDX mutant transgenic mice. Although there is some
variability in formation of HS-D evident between transgene constructs,
HS-D clearly forms in both cases. Therefore, failure to initially open
the chromatin at HS-D is not likely to be a significant cause for the
dramatic effects on enhancer function that these mutant transgenes display.
We propose that a multiprotein enhanceosome forms on the
ADA gene's duodenal enhancer in the combinatorial process
of enhancer activation. Our studies thus far have implicated PDX-1 and
GATA-4 as transcriptional activators in this combinatorial process.
Other factors are almost certainly involved. Our footprinting and
binding studies have suggested that the intestinal-specific homeodomain protein Cdx and the more ubiquitously expressed YY1 and NF-I family of
factors have binding sites in the enhancer and may be involved in
enhancer function (data not shown). Studies to investigate this
possibility are underway. The ability of Cdx to interact with GATA-4
and HNF-1
to promote transcriptional activation was mentioned
previously. Cdx has also been shown to interact with PDX-1
(24), although a transcriptional effect of this
interaction has not been reported. GATA-4 and YY1 were recently shown
to cooperate in cardiac regulation of B-type natriuretic peptide gene
expression (5). In addition to protein-protein interaction
among activators, a common theme in recent studies of eukaryotic gene
regulation has been the involvement of coactivators and corepressors
that do not bind DNA but function through protein-protein interactions (32) with the transcriptional activators. The factor p300
has been shown to function as a coactivator with GATA-4
(14) as well as GATA-5 and -6 (26, 55). It
seems likely that coregulators are also involved in the
ADA-enhancer complex. Additional studies will be necessary
to determine the role of other factors besides PDX-1 and GATA-4 in
regulation of duodenal-specific ADA expression through this
multifactorial enhancer.
Recently, microarray technology was used to survey expression of >8,000 genes in segments of adult mouse gastrointestinal tract, from stomach to distal colon (4). The cDNAs from >500 genes showed elevated expression in one or more segments, and most of these genes displayed sharp segmental expression boundaries. The majority of these boundaries was at anatomically defined locations along the A/P axis. Computer analysis and comparison of putative regulatory regions indicated that a number of genes might be regulated coordinately. Basic analysis of regulatory regions, such as the ADA duodenal-specific enhancer and the factors that function there, will be important to elucidating how such global control is accomplished.
| |
ACKNOWLEDGEMENTS |
|---|
We thank Patrick Ryan for technical assistance and work with the mouse colony. We also thank Helena Edlund and Jeffery Molkentin for supplying critical reagents.
| |
FOOTNOTES |
|---|
This work is supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-52343 (to D. A. Wiginton).
Address for reprint requests and other correspondence: D. A. Wiginton, Div. of Developmental Biology, Dept. of Pediatrics, Univ. of Cincinnati College of Medicine and Cincinnati Children's Hospital Research Foundation, Cincinnati, OH 45229 (E-mail: dan.wiginton{at}chmcc.org).
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
First published February 5, 2003;10.1152/ajpgi.00483.2002
Received 7 November 2002; accepted in final form 4 February 2003.
| |
REFERENCES |
|---|
|
|
|---|
1.
Arceci, RJ,
King AA,
Simon MC,
Orkin SH,
and
Wilson DB.
Mouse GATA-4: a retinoic acid-inducible GATA-binding transcription factor expressed in endodermally derived tissues and heart.
Mol Cell Biol
13:
2235-2246,
1993
2.
Aronow, BJ,
Silbiger RN,
Dusing MR,
Stock JL,
Yager KL,
Potter SS,
Hutton JJ,
and
Wiginton DA.
Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.
Mol Cell Biol
12:
4170-4185,
1992
3.
Atchison, ML.
Enhancers: mechanisms of action and cell specificity.
Annu Rev Cell Biol
4:
127-153,
1988[Web of Science][Medline].
4.
Bates, MD,
Erwin CR,
Sanford LP,
Wiginton D,
Bezerra JA,
Schatzman LC,
Jegga AG,
Ley-Ebert C,
Williams SS,
Steinbrecher KA,
Warner BW,
Cohen MB,
and
Aronow BJ.
Novel genes and functional relationships in the adult mouse gastrointestinal tract identified by microarray analysis.
Gastroenterology
122:
1467-1482,
2002[Web of Science][Medline].
5.
Bhalla, SS,
Robitaille L,
and
Nemer M.
Cooperative activation by GATA-4 and YY1 of the cardiac B-type natriuretic peptide promoter.
J Biol Chem
276:
11439-11445,
2001
6.
Blackburn, MR,
and
Kellems RE.
Regulation and function of adenosine deaminase in mice.
Prog Nucleic Acid Res Mol Biol
55:
195-226,
1996[Web of Science][Medline].
7.
Bossard, P,
and
Zaret KS.
GATA transcription factors as potentiators of gut endoderm differentiation.
Development
125:
4909-4917,
1998[Abstract].
8.
Boudreau, F,
Rings EH,
van Wering HM,
Kim RK,
Swain GP,
Krasinski SD,
Moffett J,
Grand RJ,
Suh ER,
and
Traber PG.
Hepatocyte nuclear factor-1 alpha, GATA-4, and caudal related homeodomain protein Cdx2 interact functionally to modulate intestinal gene transcription. Implication for the developmental regulation of the sucrase-isomaltase gene.
J Biol Chem
277:
31909-31917,
2002
9.
Brickner, A,
Gossage D,
Dusing M,
and
Wiginton D.
Identification of a murine homolog of the human adenosine deaminase thymic enhancer.
Gene
167:
261-266,
1995[Web of Science][Medline].
10.
Carey, M.
The enhanceosome and transcriptional synergy.
Cell
92:
5-8,
1998[Web of Science][Medline].
11.
Charron, F,
Tsimiklis G,
Arcand M,
Robitaille L,
Liang Q,
Molkentin JD,
Meloche S,
and
Nemer M.
Tissue-specific GATA factors are transcriptional effectors of the small GTPase RhoA.
Genes Dev
15:
2702-2719,
2001
12.
Cirillo, LA,
Lin FR,
Cuesta I,
Friedman D,
Jarnik M,
and
Zaret KS.
Opening of compacted chromatin by early developmental transcription factors HNF3 (FoxA) and GATA-4.
Mol Cell
9:
279-289,
2002[Web of Science][Medline].
13.
Clatworthy, JP,
and
Subramanian V.
Stem cells and the regulation of proliferation, differentiation and patterning in the intestinal epithelium: emerging insights from gene expression patterns, transgenic and gene ablation studies.
Mech Dev
101:
3-9,
2001[Web of Science][Medline].
14.
Dai, YS,
and
Markham BE.
p300 functions as a coactivator of transcription factor GATA-4.
J Biol Chem
276:
37178-37185,
2001
15.
Dusing, MR,
Brickner AG,
Lowe SY,
Cohen MB,
and
Wiginton DA.
A duodenum-specific enhancer regulates expression along three axes in the small intestine.
Am J Physiol Gastrointest Liver Physiol
279:
G1080-G1093,
2000
16.
Dusing, MR,
Brickner AG,
Thomas MB,
and
Wiginton DA.
Regulation of duodenal specific expression of the human adenosine deaminase gene.
J Biol Chem
272:
26634-26642,
1997
17.
Dusing, MR,
Florence EA,
and
Wiginton DA.
Pdx-1 is required for activation in vivo from a duodenum-specific enhancer.
J Biol Chem
276:
14434-14442,
2001
18.
Fang, R,
Olds LC,
Santiago NA,
and
Sibley E.
GATA family transcription factors activate lactase gene promoter in intestinal Caco-2 cells.
Am J Physiol Gastrointest Liver Physiol
280:
G58-G67,
2001
19.
Fitzgerald, K,
Bazar L,
and
Avigan MI.
GATA-6 stimulates a cell line-specific activation element in the human lactase promoter.
Am J Physiol Gastrointest Liver Physiol
274:
G314-G324,
1998
20.
Gao, X,
Sedgwick T,
Shi YB,
and
Evans T.
Distinct functions are implicated for the GATA-4, -5, and -6 transcription factors in the regulation of intestine epithelial cell differentiation.
Mol Cell Biol
18:
2901-2911,
1998
21.
Gross, DS,
and
Garrard WT.
Nuclease hypersensitive sites in chromatin.
Annu Rev Biochem
57:
159-197,
1988[Web of Science][Medline].
22.
Guz, Y,
Montminy MR,
Stein R,
Leonard J,
Gamer LW,
Wright CV,
and
Teitelman G.
Expression of murine STF-1, a putative insulin gene transcription factor, in beta cells of pancreas, duodenal epithelium and pancreatic exocrine and endocrine progenitors during ontogeny.
Development
121:
11-18,
1995[Abstract].
23.
Haynes, TL,
Thomas MB,
Dusing MR,
Valerius MT,
Potter SS,
and
Wiginton DA.
An enhancer LEF-1/TCF-1 site is essential for insertion-site independent transgene expression in thymus.
Nucleic Acids Res
24:
5034-5044,
1996
24.
Heller, RS,
Stoffers DA,
Hussain MA,
Miller CP,
and
Habener JF.
Misexpression of the pancreatic homeodomain protein IDX-1 by the Hoxa-4 promoter associated with agenesis of the cecum.
Gastroenterology
115:
381-387,
1998[Web of Science][Medline].
25.
Jacobsen, CM,
Narita N,
Bielinska M,
Syder AJ,
Gordon JI,
and
Wilson DB.
Genetic mosaic analysis reveals that GATA-4 is required for proper differentiation of mouse gastric epithelium.
Dev Biol
241:
34-46,
2002[Web of Science][Medline].
26.
Kakita, T,
Hasegawa K,
Morimoto T,
Kaburagi S,
Wada H,
and
Sasayama S.
p300 protein as a coactivator of GATA-5 in the transcription of cardiac- restricted atrial natriuretic factor gene.
J Biol Chem
274:
34096-34102,
1999
27.
Ko, LJ,
and
Engel JD.
DNA-binding specificities of the GATA transcription factor family.
Mol Cell Biol
13:
4011-4022,
1993
28.
Koutsourakis, M,
Langeveld A,
Patient R,
Beddington R,
and
Grosveld F.
The transcription factor GATA6 is essential for early extraembryonic development.
Development
126:
723-732,
1999[Abstract].
29.
Krasinski, SD,
Van Wering HM,
Tannemaat MR,
and
Grand RJ.
Differential activation of intestinal gene promoters: functional interactions between GATA-5 and HNF-1 alpha.
Am J Physiol Gastrointest Liver Physiol
281:
G69-G84,
2001
30.
Kuo, CT,
Morrisey EE,
Anandappa R,
Sigrist K,
Lu MM,
Parmacek MS,
Soudais C,
and
Leiden JM.
GATA4 transcription factor is required for ventral morphogenesis and heart tube formation.
Genes Dev
11:
1048-1060,
1997
31.
Laverriere, AC,
MacNeill C,
Mueller C,
Poelmann RE,
Burch JB,
and
Evans T.
GATA-4/5/6, a subfamily of three transcription factors transcribed in developing heart and gut.
J Biol Chem
269:
23177-23184,
1994
32.
Lemon, B,
and
Tjian R.
Orchestrated response: a symphony of transcription factors for gene control.
Genes Dev
14:
2551-2569,
2000
33.
Leonard, J,
Peers B,
Johnson T,
Ferreri K,
Lee S,
and
Montminy MR.
Characterization of somatostatin transactivating factor-1, a novel homeobox factor that stimulates somatostatin expression in pancreatic islet cells.
Mol Endocrinol
7:
1275-1283,
1993
34.
Liang, Q,
Wiese RJ,
Bueno OF,
Dai YS,
Markham BE,
and
Molkentin JD.
The transcription factor GATA4 is activated by extracellular signal-regulated kinase 1- and 2-mediated phosphorylation of serine 105 in cardiomyocytes.
Mol Cell Biol
21:
7460-7469,
2001
35.
Maniatis, T,
Goodbourn S,
and
Fischer JA.
Regulation of inducible and tissue-specific gene expression.
Science
236:
1237-1245,
1987
36.
Merika, M,
and
Orkin SH.
DNA-binding specificity of GATA family transcription factors.
Mol Cell Biol
13:
3999-4010,
1993
37.
Migchielsen, AA,
Breuer ML,
van Roon MA,
te Riele H,
Zurcher C,
Ossendorp F,
Toutain S,
Hershfield MS,
Berns A,
and
Valerio D.
Adenosine-deaminase-deficient mice die perinatally and exhibit liver-cell degeneration, atelectasis and small intestinal cell death.
Nat Genet
10:
279-287,
1995[Web of Science][Medline].
38.
Miller, CP,
McGehee RE, Jr,
and
Habener JF.
IDX-1: a new homeodomain transcription factor expressed in rat pancreatic islets and duodenum that transactivates the somatostatin gene.
EMBO J
13:
1145-1156,
1994[Web of Science][Medline].
39.
Mitchell, PJ,
and
Tjian R.
Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins.
Science
245:
371-378,
1989
40.
Molkentin, JD.
The zinc finger-containing transcription factors GATA-4, -5, and -6. Ubiquitously expressed regulators of tissue-specific gene expression.
J Biol Chem
275:
38949-38952,
2000
41.
Molkentin, JD,
Lin Q,
Duncan SA,
and
Olson EN.
Requirement of the transcription factor GATA4 for heart tube formation and ventral morphogenesis.
Genes Dev
11:
1061-1072,
1997
42.
Molkentin, JD,
Tymitz KM,
Richardson JA,
and
Olson EN.
Abnormalities of the genitourinary tract in female mice lacking GATA5.
Mol Cell Biol
20:
5256-5260,
2000
43.
Morimoto, T,
Hasegawa K,
Kaburagi S,
Kakita T,
Wada H,
Yanazume T,
and
Sasayama S.
Phosphorylation of GATA-4 is involved in alpha 1-adrenergic agonist-responsive transcription of the endothelin-1 gene in cardiac myocytes.
J Biol Chem
275:
13721-13726,
2000
44.
Morrisey, EE,
Ip HS,
Lu MM,
and
Parmacek MS.
GATA-6: a zinc finger transcription factor that is expressed in multiple cell lineages derived from lateral mesoderm.
Dev Biol
177:
309-322,
1996[Web of Science][Medline].
45.
Morrisey, EE,
Ip HS,
Tang Z,
Lu MM,
and
Parmacek MS.
GATA-5: a transcriptional activator expressed in a novel temporally and spatially-restricted pattern during embryonic development.
Dev Biol
183:
21-36,
1997[Web of Science][Medline].
46.
Morrisey, EE,
Tang Z,
Sigrist K,
Lu MM,
Jiang F,
Ip HS,
and
Parmacek MS.
GATA6 regulates HNF4 and is required for differentiation of visceral endoderm in the mouse embryo.
Genes Dev
12:
3579-3590,
1998
47.
Ohlsson, H,
Karlsson K,
and
Edlund T.
IPF1, a homeodomain-containing transactivator of the insulin gene.
EMBO J
12:
4251-4259,
1993[Web of Science][Medline].
48.
Potten, CS,
Booth C,
and
Pritchard DM.
The intestinal epithelial stem cell: the mucosal governor.
Int J Exp Pathol
78:
219-243,
1997[Web of Science][Medline].
49.
Potten, CS,
and
Loeffler M.
Stem cells: attributes, cycles, spirals, pitfalls and uncertainties. Lessons for and from the crypt.
Development
110:
1001-1020,
1990
50.
Shi, D,
Winston JH,
Blackburn MR,
Datta SK,
Hanten G,
and
Kellems RE.
Diverse genetic regulatory motifs required for murine adenosine deaminase gene expression in the placenta.
J Biol Chem
272:
2334-2341,
1997
51.
Soudais, C,
Bielinska M,
Heikinheimo M,
MacArthur CA,
Narita N,
Saffitz JE,
Simon MC,
Leiden JM,
and
Wilson DB.
Targeted mutagenesis of the transcription factor GATA-4 gene in mouse embryonic stem cells disrupts visceral endoderm differentiation in vitro.
Development
121:
3877-3888,
1995[Abstract].
52.
Thanos, D,
and
Maniatis T.
Virus induction of human IFN beta gene expression requires the assembly of an enhanceosome.
Cell
83:
1091-1100,
1995[Web of Science][Medline].
53.
Traber, PG,
and
Silberg DG.
Intestine-specific gene transcription.
Annu Rev Physiol
58:
275-297,
1996[Web of Science][Medline].
54.
Van Wering, HM,
Huibregtse IL,
van der Zwan SM,
de Bie MS,
Dowling LN,
Boudreau F,
Rings EH,
Grand RJ,
and
Krasinski SD.
Physical interaction between GATA-5 and hepatocyte nuclear factor-1alpha results in synergistic activation of the human lactase-phlorizin hydrolase promoter.
J Biol Chem
277:
27659-27667,
2002
55.
Wada, H,
Hasegawa K,
Morimoto T,
Kakita T,
Yanazume T,
and
Sasayama S.
A p300 protein as a coactivator of GATA-6 in the transcription of the smooth muscle-myosin heavy chain gene.
J Biol Chem
275:
25330-25335,
2000
56.
Walters, MC,
Fiering S,
Eidemiller J,
Magis W,
Groudine M,
and
Martin DI.
Enhancers increase the probability but not the level of gene expression.
Proc Natl Acad Sci USA
92:
7125-7129,
1995
57.
Winston, JH,
Hong L,
Datta SK,
and
Kellems RE.
An intron 1 regulatory region from the murine adenosine deaminase gene can activate heterologous promoters for ubiquitous expression in transgenic mice.
Somat Cell Mol Genet
22:
261-278,
1996[Web of Science][Medline].
58.
Witte, DP,
Wiginton DA,
Hutton JJ,
and
Aronow BJ.
Coordinate developmental regulation of purine catabolic enzyme expression in gastrointestinal and postimplantation reproductive tracts.
J Cell Biol
115:
179-190,
1991
59.
Xu, PA,
and
Kellems RE.
Function of murine adenosine deaminase in the gastrointestinal tract.
Biochem Biophys Res Commun
269:
749-757,
2000[Web of Science][Medline].
60.
Xu, PA,
Winston JH,
Datta SK,
and
Kellems RE.
Regulation of forestomach-specific expression of the murine adenosine deaminase gene.
J Biol Chem
274:
10316-10323,
1999
This article has been cited by other articles:
![]() |
B. Chen, E. Yates, Y. Huang, P. Kogut, L. Ma, J. R. Turner, Y. Tao, B. Camoretti-Mercado, D. Lang, E. C. Svensson, et al. Alternative promoter and GATA5 transcripts in mouse Am J Physiol Gastrointest Liver Physiol, December 1, 2009; 297(6): G1214 - G1222. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Divine, L. J. Staloch, H. Haveri, C. W. Rowley, M. Heikinheimo, and T. C. Simon Cooperative interactions among intestinal GATA factors in activating the rat liver fatty acid binding protein gene Am J Physiol Gastrointest Liver Physiol, August 1, 2006; 291(2): G297 - G306. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Wang, A. Klopot, J.-N. Freund, L. N. Dowling, S. D. Krasinski, and J. C. Fleet Control of differentiation-induced calbindin-D9k gene expression in Caco-2 cells by cdx-2 and HNF-1{alpha} Am J Physiol Gastrointest Liver Physiol, November 1, 2004; 287(5): G943 - G953. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Divine, L. J. Staloch, H. Haveri, C. M. Jacobsen, D. B. Wilson, M. Heikinheimo, and T. C. Simon GATA-4, GATA-5, and GATA-6 activate the rat liver fatty acid binding protein gene in concert with HNF-1{alpha} Am J Physiol Gastrointest Liver Physiol, November 1, 2004; 287(5): G1086 - G1099. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. van Wering, T. Bosse, A. Musters, E. de Jong, N. de Jong, C. E. Hogen Esch, F. Boudreau, G. P. Swain, L. N. Dowling, R. K. Montgomery, et al. Complex regulation of the lactase-phlorizin hydrolase promoter by GATA-4 Am J Physiol Gastrointest Liver Physiol, October 1, 2004; 287(4): G899 - G909. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Oesterreicher and S. J. Henning Rapid induction of GATA transcription factors in developing mouse intestine following glucocorticoid administration Am J Physiol Gastrointest Liver Physiol, June 1, 2004; 286(6): G947 - G953. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |