AJP - GI Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 285: G371-G381, 2003. First published April 17, 2003; doi:10.1152/ajpgi.00358.2002
0193-1857/03 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/2/G371    most recent
00358.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, T. K.
Right arrow Articles by Ballatori, N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, T. K.
Right arrow Articles by Ballatori, N.

LIVER AND BILIARY TRACT

N-glycosylation controls functional activity of Oatp1, an organic anion transporter

Thomas K. Lee,1 Albert S. Koh,1 Zhifeng Cui,1 Robert H. Pierce,2 and Nazzareno Ballatori1

Departments of 1Environmental Medicine and 2Pathology, University of Rochester School of Medicine, Rochester, New York 14642

Submitted 23 August 2002 ; accepted in final form 3 April 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Rat Oatp1 (Slc21a1) is an organic anion-transporting polypeptide believed to be an anion exchanger. To characterize its mechanism of transport, Oatp1 was expressed in Saccharomyces cerevisiae under control of the GAL1 promoter. Protein was present at high levels in isolated S. cerevisiae secretory vesicles but had minimal posttranslational modifications and failed to exhibit taurocholate transport activity. Apparent molecular mass (M) of Oatp1 in yeast was similar to that of unmodified protein, ~62 kDa, whereas in liver plasma membranes Oatp1 has an M of ~85 kDa. To assess whether underglycosylation of Oatp1 in yeast suppressed functional activity, Oatp1 was expressed in Xenopus laevis oocytes with and without tunicamycin, a glycosylation inhibitor. With tunicamycin, M of Oatp1 decreased from ~72 to ~62 kDa and transport activity was nearly abolished. Mutations to four predicted N-glycosylation sites on Oatp1 (Asn to Asp at positions 62, 124, 135, and 492) revealed a cumulative effect on function of Oatp1, leading to total loss of taurocholate transport activity when all glycosylation sites were removed. M of the quadruple mutant was ~ 62 kDa, confirming that these asparagine residues are sites of glycosylation in Oatp1. Relatively little of the quadruple mutant was able to reach the plasma membrane, and most remained in unidentified intracellular compartments. In contrast, two of the triple mutants tested (N62/124/135D and N124/135/492D) were present in the plasma membrane fraction yet exhibited minimal transport activity. These results demonstrate that both membrane targeting and functional activity of Oatp1 are controlled by the extent of N-glycosylation.

membrane transport; posttranslational modifications; protein trafficking; yeast; Xenopus oocytes


MEMBERS OF THE OATP/Oatp family of solute carriers (SLC21A/Slc21a) function as transporters for a large variety of amphipathic organic compounds (3, 21, 36). These proteins mediate Na+- and ATP-independent uptake of bile salts, steroids, thyroid hormones, anionic peptides, drugs, and xenobiotics. The energy-coupling mechanism for these transporters remains poorly defined, although there is considerable evidence that they function as anion exchangers (21, 36). A previous study from our laboratory (25) indicated that rat Oatp1 (Slc21a1) mediates uptake of organic anions in exchange for intracellular reduced glutathione (GSH).

In an attempt to further characterize the mechanism of Oatp1-mediated transport, Oatp1 was expressed in the NY17 strain of Saccharomyces cerevisiae (sec6–4). Yeast have a number of attributes that make them particularly attractive for carrying out such studies, including the lack of Oatp-like genes in the S. cerevisiae genome and the fact that the sec6–4 strain allows for the isolation in high yield of secretory vesicles that are ideally suited for such transport studies (30, 31, 35). However, one drawback of yeast is that they have only a limited ability to carry out certain posttranslational modifications, including glycosylation (17, 18, 23, 24, 37). For example, the mammalian CHIP water channel (23), the rat Glut1 glucose transporter (17), and some P-glycoprotein transporters (24, 37) are only minimally glycosylated in yeast. Because N-glycosylation is required for proper trafficking and functional activity of many membrane transporters (e.g., Refs. 22, 26, and 38), but not necessarily all transporters (e.g., Refs. 7 and 37), this may limit the utility of yeast as a model system.

The role of phosphorylation on Oatp1 function has recently been investigated (12, 14), but the effects of N-glycosylation have not been examined. Oatp1 is predicted to have four N-glycosylation sites on its extracellular loops: asparagine residues at positions 62, 124, 135, and 492 as part of the consensus N-glycosylation sequence Asn-X-Ser/Thr (16). On the basis of the predicted membrane topology of Oatp1, Asn62 is located on the first extracellular loop, Asn124 and Asn135 on the second extracellular loop, and Asn492 on the fifth extracellular loop. Interestingly, these glycosylation sites are generally conserved in other members of the OATP/Oatp family (21, 36).

In the present study, Oatp1 was expressed in S. cerevisiae and the functional role of N-glycosylation was examined in Xenopus laevis oocytes. The results indicate that this transporter is dependent on N-glycosylation for both its functional activity and its delivery to the cell membrane.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Yeast strain and Oatp1 plasmid construct. NY17 (sec6–4) mutant strain of S. cerevisiae was kindly provided by Peter Novick (Yale University, New Haven, CT), and the cDNA for Oatp1 was provided by Peter Meier (University Hospital, Zurich, Switzerland) as pSPORT/Oatp1 plasmid. The coding region of Oatp1 was subcloned into the yeast expression vector pYES2 by PCR to introduce a HindIII site (underlined) directly before 5'-ATG (5'-CGCAAGCTTATGGAAATGGAAGAAACAGAGAAAAAGATTGC-3') and a XbaI site (underlined) at the 3'-end of the translation termination site of Oatp1 (5'-CGCTCTAGATTACAGCTTCGTTTTCAGTTCTCCG-3'). The 2,031-bp PCR product generated was digested with HindIII and XbaI and ligated into the pYES2 vector. The pYES2/Oatp1 plasmid was transformed into NY17 cells by using the lithium acetate method as described by Mount and coworkers (28). NY17 transformants were maintained in synthetic uracil dropout medium [SD-URA(-); 0.17% yeast nitrogen base without amino acids (Difco), 0.5% ammonium sulfate, 0.77g/l of uracil dropout supplement (Clontech), and 2% glucose]. To induce the expression of Oatp1, start-up cultures were grown in SD-URA(-) medium supplemented with 2% raffinose for 18 h at 27°C and 225 rpm to optical density at 600 nm (OD600)of ~2.0 and diluted in SD-URA(-) medium containing 2% raffinose-2% galactose (OD600 ~ 0.1) for 20 h at 27°C and 225 rpm (OD600 ~ 1.0–1.3). Cells were grown at the nonpermissive temperature of 37°C for the final 2 h of induction to accumulate secretory vesicles. To determine the glycosylation state of Oatp1 synthesized in yeast, cells were treated with tunicamycin (10 µg/ml) for 4 h and whole cell lysate was used for analysis of Oatp1 expression.

Yeast secretory vesicle isolation. Secretory vesicles were isolated and characterized as previously described (31). Briefly, NaN3 (10 mM) was added to cells chilled in an ice bath, and 10 min later the cells were decanted to preweighed tubes and spun down at 8,000 g in a Sorvall GSA rotor for 10 min. Cell pellets were washed with ice-cold 10 mM NaN3, pelleted as before, weighed, and frozen at -80°C. Cell pellets were thawed at room temperature in preweighed Sorvall SA-600 rotor tubes with 25 ml of 100 mM Tris sulfate, pH 9.4, and 40 mM {beta}-mercaptoethanol for 10 min at room temperature, pelleted at 3,000 g for 10 min, and resuspended in spheroplasting buffer (1.2 M sorbitol, 20 mM HEPES-Tris, pH 7.5) containing 10 mM NaN3, 2 mM EDTA, 40 mM {beta}-mercaptoethanol, and 1.5 g of acid-washed glass beads per 10-ml volume. Cells were vortexed vigorously five times for 1 min with 3-min incubations in between vortexing in ice. The lysate was spun down at 10,000 g for 10 min to pellet unbroken cells and glass beads. Secretory vesicles were harvested by ultracentrifugation of slow-speed supernatant (S1) in a Sorvall T-865 ultracentrifuge rotor at 100,000 g for 45 min. Pellets were resuspended in transport buffer [250 mM sucrose, 10 mM HEPES-Tris (pH 7.5), 20 mM KCl], spun at 100,000 g for 45 min, and resuspended in transport buffer by being passed 10–20 times through a syringe with a 25-gauge needle at a final concentration of 5–10 mg/ml protein.

Rat liver plasma membrane isolation. Rat liver basolateral plasma membrane vesicles were isolated according to the procedure of Meier et al. (27), as previously described in this laboratory (2, 9).

Transport measurements in yeast. Transport was measured as uptake of radiolabeled substrate into vesicles collected by rapid filtration on a Millipore 0.45-µm filter under vacuum, essentially as described previously (2). Secretory vesicles were thawed by immersion in a 30°C water bath, diluted to 5 mg/ml in transport buffer supplemented with 10 mM phosphocreatine, 10 mM MgCl2, 100 µg/ml creatine phosphokinase, and either 5 mM Na2ATP or 10 mM NaCl. Diluted secretory vesicles were repeatedly passed through a 25-gauge needle and incubated at 30°C for 15 min before initiation of the transport reaction. Transport was started by adding equal volumes of diluted secretory vesicles to 2x transport buffer with substrate at 30°C. Transport was quenched by removing aliquots of the reaction at various time points into 1 ml of ice-cold stop buffer [300 mM sucrose, 10 mM HEPES-Tris (pH 7.5), 20 mM KCl], and secretory vesicles were collected by applying 1 ml of quenched reaction solution to prewetted filter under a vacuum and then washing the filter with an additional 4 ml of ice-cold stop buffer. Filters were collected and dissolved in 5 ml of Opti-Fluor (Packard Instruments, Meriden, CT), and radiolabeled drug uptake was quantified by liquid scintillation measurements. Controls for nonspecific binding of drug to filters and vesicles were determined by measuring retention of radiolabeled substrate on secretory vesicles incubated in transport buffer at 4°C for each time point.

Mutagenesis of N-glycosylation sites of Oatp1. The four potential asparagine residues involved in N-linked glycosylation on Oatp1 were changed to aspartic acid by sequential single-nucleotide mutation with Stratagene QuickChange site-directed mutagenesis kit according to the supplied instruction manual. The codons for Asn located at positions 62, 124, 135, and 492 were mutated to Asp with the following oligos and their corresponding antisense oligos (the mutated Asp codons are underlined): N62D, GCTGGATTAATCGATGGGAGCTTTGAC; N124D, CACCTACAGGCGACTTGTCCTCAAACAGC; N135D, GTGTATGGAGGACCGAACACAGACC; and N492D, CAGTCATTAGGAGACTCGTCTGCAGTCC. In addition, single, double, and triple Asn-to-Asp mutations were made by using the same method in various combinations. Each resulting cDNA was sequenced at the University of Rochester School of Medicine sequencing facility.

Synthesis of FLAG epitope-tagged Oatp1 cDNAs. The FLAG epitope (DYKDDDDK) was added in frame to the 3'-end of Oatp1, N124/135/492D-Oatp1, and N62/124/135/492D-Oatp1 cDNA in the pSPORT vector just before the stop codon by using PCR. The forward primer contained a SalI restriction site, and the reverse primer contained the FLAG sequence and an XbaI site. The primer sequences used were as follows: forward, 5'-GGATTCCCGGGTCGACGAGCTCATGAGTGTACT-3'; reverse, 5'-AAATCTAGATTACTTGTCGTCATCGTCTTTGTAGTCCAGCTTCGTTTTCAGTTCTCCGTC-3'. The resulting PCR products were then subcloned into the pSPORT vector by using the SalI and XbaI restriction sites. Next, 700 bp of the Oatp1 3'-untranslated region was generated by using PCR with the forward primer containing the XbaI site and the reverse primer containing the MluI site. The primer sequences used were as follows: forward, 5'-AAATCTAGATGAGTTTTCTACTGCCCTGTTCAA-3'; reverse, 5'-TGCACGCGTACGTAAGCTTGGATCCTTTAAAGC-3'. This second fragment was then directionally subcloned into the pSPORT vector containing the Oatp1-FLAG constructs using the XbaI and MluI sites to produce the final pSPORT-Oatp1-FLAG plasmids.

In vitro transcription and expression in Xenopus oocytes. Plasmid cDNAs containing wild-type Oatp1 and mutant Oatp1 were linearized with XbaI and then transcribed with T7 polymerase by using the mMESSAGE mMACHINE (Ambion) transcription system. Isolation of X. laevis oocytes was performed as described by Goldin (13) and as described previously by our laboratory (4). Toads were anesthetized by immersion for 15 min in ice-cold water containing 0.3% tricaine (Sigma). Oocytes were removed from the ovary and washed with Ca2+-free OR-2 solution (in mM: 82.5 NaCl, 2 KCl, 1 MgCl2, and HEPES-Tris, pH 7.5) and incubated at room temperature with gentle shaking for 90 min in OR-2 solution supplemented with 2 mg/ml collagenase (Sigma type IA). Oocytes were transferred to fresh collagenase solution after the first 45 min of incubation. Collagenase was removed by extensive washing in OR-2 solution at room temperature. Stage V and VI defolliculated oocytes were selected and incubated at 18°C in modified Barth's solution [in mM: 88 NaCl, 1 KCl, 2.4 NaHCO3, 0.82 MgSO4, 0.33 Ca(NO3)2, 0.41 CaCl2, and 20 HEPES-Tris, pH 7.5] supplemented with gentamycin (0.05 mg/ml). After 3–4 h of incubation, healthy oocytes were injected with 50 nl of either wild-type Oatp1 cRNA solution (0.5–10 ng/oocyte), mutant Oatp1 cRNA (0.5 ng/oocyte), or FLAG-tagged Oatp1 constructs (2 ng/oocyte). Control oocytes were injected with a corresponding volume of sterile H2O. Injected oocytes were cultured at 18°C with a daily change of modified Barth's medium containing gentamycin. Healthy oocytes with a clean brown animal half and distinct equator line were selected for experiments.

Inhibition of N-glycosylation by tunicamycin. At 2 h before injection with cRNA, oocytes were preinjected with 50 nl of 400 µg/ml tunicamycin. Immediately before injection, a stock solution of 40 mg/ml tunicamycin in DMSO was diluted to 1% DMSO with sterile water.

Oocyte transport measurements. Uptake studies were performed 3 days after microinjection. Six to eight oocytes were incubated at 25°C for 1 h in 100 µl of modified Barth's solution in the presence of 0.5 µCi of 20 µM [3H]taurocholate. Uptake was stopped by adding 2.5 ml of ice-cold modified Barth's solution, and oocytes were washed three times each with 2.5 ml of ice-cold modified Barth's solution with 1 mM unlabeled taurocholate to reduce nonspecific binding of tracer taurocholate. Two oocytes were dissolved in a polypropylene scintillation vial with 0.2 ml of 10% SDS and counted in a Beckman model 6500 scintillation spectrometer after addition of 5 ml of Opti-Fluor (Packard Instruments).

Western blot of oocytes. Oocyte subcellular fractions and secretory vesicle fractions isolated from NY17 cells were added to an equal volume of sample loading buffer [50 mM Tris · HCl (pH 6.8), 2% (wt/vol) SDS, 0.1 mM dithiothreitol, 10% (vol/vol) glycerol] and subjected to SDS-PAGE on precast 4–20% (wt/vol) gradient gels (Bio-Rad). Whole yeast cell lysate was prepared using 2–4 x 107 cells in 100 µl of SDS-PAGE sample buffer and 100 mg of acid-washed glass beads. The contents were vortexed vigorously three times for 1 min with 2-min ice incubation periods in between. Ten to twenty microliters of cell lysate were subjected to SDS-PAGE (corresponding to 20–40 µg protein). The separated polypeptides were electrotransferred onto 0.45-µm Immuno-Blot polyvinylidene difluoride membranes (Bio-Rad) for1hat120 mA using a semidry transfer apparatus. The filters were blocked and then incubated for 2 h at room temperature with a 1:3,000 dilution of rabbit antisera raised against the COOH-terminal Oatp1 antigen (kindly provided by Dr. Bruno Stieger, University Hospital, Zurich, Switzerland). Immunoreactive bands were detected by incubating washed membranes with a 1:3,000 dilution of anti-rabbit IgG conjugated with horseradish peroxidase enzyme (Sigma) and then detected by enhanced chemiluminescence according to the manufacturer's instructions (Amersham). Xenopus oocyte proteins were isolated at 3 days after RNA injection as described by Everts et al. (10). Briefly, 20 oocytes were homogenized in a buffer that contained 100 mM NaCl, 20 mM HEPES-Tris, pH 7.4, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, and a cocktail of additional protease inhibitors (Sigma P-8340). The homogenate was centrifuged for 10 min at 10,000 g. The supernatant containing the cytosolic proteins and the solubilized membrane proteins were separated at 4°C by SDS-PAGE.

For preparation of a crude plasma membrane subfraction, oocytes were lysed by passage through a 25-gauge needle multiple times at 4°C in 7.5 mM NaCl, 10 mM HEPES-Tris, pH 7.4, containing 1 mM phenylmethylsulfonyl fluoride and P-8340. After centrifugation for 10 min at 1,000 g to remove nuclei, the supernatant was centrifuged at 45,000 g for 90 min at 4°C. The pellet was resuspended in 100 mM NaCl, 20 mM HEPES-Tris, pH 7.4, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, and P-8340 to yield ~1–2 µg protein/µl.

Immunofluorescence labeling of intact oocytes. Intact Xenopus oocytes on day 3 after cRNA injection were fixed in methanol-acetone (1:1) for 10 min on ice, followed by four washes of 5 min each at room temperature and an overnight wash at 4°C in antibody dilution buffer (0.01 M PBS, 0.05% Tween 20, 1% BSA, 1% normal goat serum, and 0.01% sodium azide). Oocytes were washed at room temperature with 1x PBS-1% Tween 20 for 1 h, with 10-min buffer changes, followed by a 15-min incubation in blocking solution (3% BSA in antibody dilution buffer). Oocytes were then washed with 1x PBS-1% Tween 20 for another 1 h, with 10-min buffer changes, followed by an overnight wash at 4°C. The oocytes were incubated with anti-FLAG M2 monoclonal antibody for 1 h (4.9 mg/ml, diluted 1:200 with antibody dilution buffer; Sigma). To remove excess antibody, oocytes were washed in 1x PBS-1% Tween 20 three times for 5 min each, two times for 10 min each, and then overnight, followed by an incubation for 1 h with Alexa Fluor 488 F(ab')2 fragment of goat anti-mouse antibody in the dark (2 mg/ml, diluted 1:200; Molecular Probes). Secondary antibody was removed by washing oocytes with 1x PBS-1% Tween 20 three times for 5 min each, two times for 10 min each, and then overnight. Cells were imaged using a x10 objective on a Leica TCS-SP laser-scanning confocal microscope.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
The yeast NY17 (sec6–4) strain was transformed with the multicopy yeast expression vector pYES2 carrying the cDNA for rat Oatp1 under the control of the GAL1 promoter. Expression of Oatp1 was induced by growing cells in uracil dropout synthetic complete medium supplemented with 2% raffinose as the carbon source and 2% galactose to induce the expression of Oatp1. To repress the induction of Oatp1, cells were grown in either 2% glucose or 2% raffinose.

Western blot detection of whole cell yeast proteins revealed a band with an apparent molecular mass of ~62 kDa (Fig. 1, lane 3), a size similar to that of unmodified Oatp1 (16), whereas in rat liver membranes Oatp1 had an apparent molecular mass of ~85 kDa (Fig. 1, lane 1). Oatp1 was strongly expressed in yeast grown in the presence of 2% galactose (Fig. 1) but was not present in cells grown in glucose, a potent repressor of the GAL1 promoter (Fig. 1, lane 2). Higher-molecular-mass bands of ~120 and ~180 kDa were also detected in yeast grown under inducing conditions, suggesting oligomerization of this protein in the gel. Treatment of yeast cells with tunicamycin, an inhibitor of N-glycosylation, did not further reduce the Oatp1 apparent molecular mass (Fig. 1, lane 4), indicating that the Oatp1 expressed in yeast is not glycosylated. The lack of N-glycosylation of heterologously expressed mammalian transporters in yeast has been previously reported for some P-glycoproteins (24, 37), the CHIP water channel (23), and the GLUT-1 glucose transporter (17).



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 1. Expression of underglycosylated organic anion-transporting protein Oatp1 in yeast. Western blot analysis of yeast whole cell lysate separated by SDS-PAGE is shown. Yeast were grown to OD600 of ~0.8–1.2 at 27°C in SD-URA(-) synthetic medium supplemented with either 2% glucose or 2% raffinose-2% galactose, as indicated by the + sign in the figure. Cells were induced in galactose for 16–20 h. Whole cell lysate was prepared as described in MATERIALS AND METHODS. Yeast grown in repressive 2% glucose (lane 2), inducing 2% raffinose-2% galactose (lane 3), and inducing 2% raffinose-2% galactose in the presence of 10 µg/ml tunicamycin (lane 4) are compared with Oatp1 in isolated rat liver basolateral plasma membranes (lane 1). Each lane contains 30 µg protein.

 

Immunoblot analysis of a purified yeast secretory vesicle fraction (Fig. 2) showed similar bands to those detected in whole cell lysates (Fig. 1), namely a protein band of ~62 kDa, with higher-molecular-mass bands of ~120 and 180 kDa. These bands were not present in secretory vesicles isolated from cells grown under repressive conditions with 2% glucose (Fig. 2, lane 2). No Oatp1-immunoreactive bands were detected in the soluble fraction (Fig. 2, lane 4). Of significance, Oatp1 was present at relatively high levels in yeast secretory vesicles compared with an equal amount of rat liver membrane proteins (Fig. 2). Oatp1 could be detected by loading <1 µg of the whole cell yeast lysate or <100 ng of a secretory vesicle fraction (data not shown), indicating a high level of expression of this protein in yeast.



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 2. Oatp1 expression in yeast secretory vesicles. Western blot analysis of yeast secretory vesicles separated by SDS-PAGE. Expression of Oatp1 in rat liver basolateral plasma membranes was used as control (lane 1; 1 µg protein). One microgram of protein of secretory vesicles from uninduced and induced cultures (lanes 2 and 3, respectively) and 20 µg protein of cytosolic fraction (lane 4) were analyzed.

 

The growth of the cells under inducing (2% raffinose-2% galactose) and noninducing (2% raffinose) conditions was followed to examine the potential burden of Oatp1 expression. Figure 3 illustrates a typical experiment conducted until OD600 reached ~1.5; however, all yeast cells used for expression analyses were grown only until OD600 reached ~0.8–1.2. Growth by the Oatp1-expressing yeast cells was slower than uninduced control cells (Fig. 3). Both cultures reached a stationary phase at OD600 ~ 2.5–2.6, but the noninducing and inducing cultures reached this stage at different time points, i.e., ~28 and ~45 h, respectively (data not shown). The difference in growth between the two cultures is probably due to the high levels of Oatp1 synthesized under inducing conditions.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. Growth of Oatp1-transformed yeast under noninducing and inducing conditions. Growth of yeast was followed until it reached an optical density at 600 nm (OD600) of ~1.5. Cells were grown in SD-URA(-) synthetic medium supplemented with 2% raffinose (noninducing) or 2% raffinose-2% galactose (inducing) at 27°C and 225 rpm. Growth of cultures was followed periodically by measuring absorbance at OD600. Data are from a typical experiment.

 

Because Oatp1 did not appear to be glycosylated in yeast, additional studies examined whether the high levels of Oatp1 protein synthesized by these cells may have overwhelmed the glycosylation machinery. To test this hypothesis, the level of Oatp1 expression was controlled by regulating the concentration of the inducing sugar galactose in the medium. The results show that Oatp1 protein is detected at 0.1% galactose, with a significant increase in expression at 0.5% galactose and maximal expression at 1–2% galactose (Fig. 4). However, the apparent molecular mass of Oatp1 was not changed, indicating that the level of Oatp1 expression did not appear to define the processing of this protein in yeast.



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 4. Oatp1 expression as a function of galactose concentration in the culture medium. Western blot analysis of yeast whole cell lysate separated by SDS-PAGE is shown. Amount of Oatp1 expression in yeast was controlled by culturing cells in URA(-) synthetic medium supplemented with 2% raffinose and various concentrations of galactose. Whole cell lysate was prepared as described in MATERIALS AND METHODS. Twenty microliters of the lysate (~30 µg protein) were loaded in each lane. Oatp1 in rat liver membranes was used as control (~30 µg protein).

 

To examine Oatp1 functional activity in yeast, ATP-independent transport of taurocholate, estrone sulfate, and leukotriene C4 was measured in isolated yeast secretory vesicles. Because yeast secretory vesicles also contain many ATP-dependent transporters, including one for taurocholate (Bat1), ATP-dependent transport of taurocholate was also measured to assess the functional integrity of the secretory vesicles. ATP-dependent transport of taurocholate was robust and led to a fast steady-state accumulation in the secretory vesicles (Fig. 5), supporting the integrity of these secretory vesicles for transport assays. However, when ATP-independent transport of taurocholate, estrone sulfate, and leukotriene C4 was measured in both the Oatp1-expressing and control secretory vesicles, no transport activity was observed (Fig. 5), indicating that the Oatp1 expressed in yeast was not functional, despite the high level of Oatp1 protein present in these vesicles. To test whether the lack of transport activity in the yeast vesicles was due to a lack of GSH, we pre-loaded the vesicles with 10 mM GSH and then measured uptake of radiolabeled estrone sulfate and taurocholate. However, GSH failed to stimulate transport activity (data not shown). Transport of taurocholate in Oatp1-expressing yeast was also measured at the whole cell level; however, no transport activity was detected in the Oatp1-expressing yeast (data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 5. Transport measurements in yeast secretory vesicles. A: secretory vesicles (75 µg) from uninduced control and Oatp1-expressing cells were incubated in medium containing an ATP-regenerating system and 1 µM [3H]taurocholate in the presence of 5 mM ATP or 10 mM NaCl at 30°C. Each data point represents a mean ± SD for 3 separate experiments performed in triplicate. B: uptake of 1 µM [3H]estrone sulfate (ES) or 0.1 µM [3H]leukotriene C4 (LTC4) in secretory vesicles (30 µg) from uninduced control and Oatp1-expressing cells. Each data point represents a mean ± SD for 3 separate experiments performed in triplicate.

 

To examine whether the lack of Oatp1 functional activity in yeast is related to its underglycosylation, additional studies were carried out in the X. laevis oocyte expression system. Oocytes were treated with tunicamycin to inhibit glycosylation or were injected with cRNA for Oatp1 that had been mutated to delete the four putative N-glycosylation sites, and [3H]taurocholate (20 µM) uptake was measured.

Western blot analysis of whole cell extracts from oocytes expressing rat Oatp1 indicated that the apparent molecular mass of Oatp1 was ~72 kDa (Fig. 6A). This size is smaller than that found in rat liver membranes (~85 kDa; Fig. 6A) but larger than that noted in yeast (~62 kDa, Fig. 1). Immunoblot analysis of whole cell extract from oocytes expressing the Oatp1 mutants N62D, N124D, N135D, and N492D showed a molecular mass band slightly smaller than the wild-type Oatp1 for all mutants (Fig. 6A). Taurocholate transport activity in oocytes expressing these individual mutants was slightly less than that of wild-type Oatp1, but these differences were not statistically significant (Fig. 6B). This suggests that all four predicted N-glycosylation residues are glycosylated on Oatp1 and that no individual glycosylation site is critical for expression and transport activity.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 6. Effects of single glycosylation mutations on Oatp1 expression and function. A: representative Western blot analysis of cell extract from uninjected, wild-type Oatp1 and Oatp1 mutant N62D-, N124D-, N135D-, or N492D-expressing oocytes. After 3 days in culture, cell extracts were prepared as described in MATERIALS AND METHODS and 40 µg of protein were loaded on each lane. B: uptake of 20 µM [3H]taurocholate for 1 h into Xenopus laevis oocytes injected with wild-type Oatp1 cRNA or Oatp1 mutant N62D, N124D, N135D, or N492D cRNA. After 3 days in culture, transport measurements were performed as described in MATERIALS AND METHODS. Values are expressed as %wild-type Oatp1 (means ± SD of 4 separate experiments, each performed in triplicate).

 

Because no single N-glycosylation residue was critical for function, various combinations of double and triple mutants were investigated (Fig. 7), along with the quadruple Oatp1 mutant N62/124/135/492D (Fig. 8). The double and triple mutants tested were as follows: N62/124D, N62/492D, N124/135D, N62/124/135D, and N124/135/492D. Expression of these mutants was confirmed by Western blotting (Figs. 7A and 8A). Transport analysis revealed that the N124/135D mutant had a transport activity of ~60% of wild-type Oatp1 and that N62/124D, N62/492D, N62/124/135D, and N124/135/492D had transport activities of ~15–20% of wild-type Oatp1 (Fig. 7B). With the quadruple Oatp1 mutant, Western blot analyses detected the mutant protein at ~62 kDa in whole cell oocyte extracts (Fig. 8A), but no transport of taurocholate was detected (Fig. 8B). These results indicate that there are cumulative effects of mutating individual N-glycosylation residues, leading to complete loss of Oatp1-mediated taurocholate transport activity when all four N-glycosylation residues are removed (Fig. 8A).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 7. Effects of multiple glycosylation mutations on Oatp1 expression and function. A: representative Western blot analysis of cell extract from wild-type Oatp1 (lane 2) and Oatp1 mutant N62D/124D-, N62/492D-, N124D/135D-, N62/124/135D-, or N124/135/492D-expressing oocytes (lanes 3–7, respectively). After 3 days in culture, cell extracts were prepared as described in MATERIALS AND METHODS and 40 µg of protein were loaded on each lane. B: uptake of 20 µM [3H]taurocholate for 1 h into X. laevis oocytes injected with wild-type Oatp1 cRNA or Oatp1 mutant N62/124D, N62/492D, N124/135D, N62/124/135D, or N124/135/492D cRNA. After 3 days in culture, transport measurements were performed as described in MATERIALS AND METHODS. Values are expressed as %wild-type Oatp1 (means ± SD of 3 separate experiments, each performed in triplicate).

 


View larger version (20K):
[in this window]
[in a new window]
 
Fig. 8. Lack of functional activity of deglycosylated N62/124/135/492D Oatp1 mutant. A: representative Western blot analysis of cell extract from uninjected, wild-type Oatp1 and mutant N62/124/135/492D Oatp1-expressing oocytes. After 3 days in culture, cell extracts were prepared as described in MATERIALS AND METHODS and 40 µg of protein were loaded on each lane. B: uptake of 20 µM [3H]taurocholate for 1 h into X. laevis oocytes injected with wild-type Oatp1 cRNA or mutant N62/124/135/492D Oatp1 cRNA. After 3 days in culture, transport measurements were performed as described in MATERIALS AND METHODS. Values are expressed as %wild-type Oatp1 (means ± SD of 3 separate experiments, each performed in triplicate).

 

To examine whether N-glycosylation regulates the targeting of Oatp1 to the oocyte plasma membrane, the expression of wild-type Oatp1 and the N62/124/135/492D, N62/124/135D, and N124/135/492D mutants were analyzed in a crude plasma membrane fraction isolated from oocytes expressing these constructs. Immunoblot analysis showed that both the wild-type and most of the Oatp1 mutants were present in this membrane fraction (Fig. 9); however, the amount of the N62/124/135/492D mutant present in this subcellular fraction was significantly lower than the wild-type Oatp1 (Fig. 9), suggesting that this mutant is less efficiently inserted into the plasma membrane and may accumulate in intracellular compartments. In contrast, the amount of the triple mutants N62/124/135D and N124/135/492D present in this membrane fraction was comparable with the wild-type Oatp1 (Fig. 9), suggesting that only the quadruple Oatp1 mutant is defective in the translocation to the plasma membrane. Because minimal transport activity was detected in all of these mutants, N-glycosylation appears to control both the functional activity and the plasma membrane targeting of Oatp1.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 9. Expression of wild-type Oatp1 and N62/124/135/492D, N62/124/135D, and N124/135/492D Oatp1 mutants in plasma membrane-enriched fractions. Representative Western blot analysis of plasma membrane-enriched fraction from wild-type Oatp1 and N62/124/135/492D, N62/124/135/492D, and N62/124/135D Oatp1 mutant-expressing oocytes. Preparation of the plasma membrane-enriched fraction after 3 days in culture after cRNA injection is described in MATERIALS AND METHODS. Ten micrograms of protein were loaded on each lane.

 

To further characterize the effects of deglycosylation on the targeting and transport activity of Oatp1, oocytes were treated with tunicamycin to inhibit glycosylation. Tunicamycin treatment of oocytes decreased the Oatp1 molecular mass to ~62 kDa (Fig. 10A), a size comparable with the unglycosylated, in vitro-translated Oatp1 (16) and with the Oatp1 expressed in S. cerevisiae (Fig. 1). Of significance, tunicamycin treatment also reduced the Oatp1-mediated taurocholate transport rate to ~15–25% of untreated oocytes (Fig. 10B). However, loss of transport activity was associated with the redistribution of the protein away from the membrane-enriched subcellular fraction (Fig. 10C), suggesting that the deglycosylated protein was unable to reach the plasma membrane.



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 10. Deglycosylated Oatp1 has decreased functional activity in oocytes. A: representative Western blot analysis of whole cell extracts from uninjected and Oatp1-expressing oocytes with or without tunicamycin pretreatment. After 3 days in culture, cell extracts were prepared as described in MATERIALS AND METHODS and 40 µg of protein were loaded in each lane. Rat liver membranes (1 µg) were used as control. B: uptake of 20 µM [3H]taurocholate for 1 h into X. laevis oocytes injected with Oatp1 cRNA with or without tunicamycin (2 ng/oocyte) pretreatment. After 3 days in culture, transport measurements were performed as described in MATERIALS AND METHODS. Values are expressed as %wild-type Oatp1 (means ± SD of 4 separate experiments, each performed in triplicate). C: representative Western blot analysis of membrane fractions isolated from uninjected oocytes or from Oatp1-expressing oocytes with or without tunicamycin pretreatment. Rat liver membrane (3 µg) was used as control, and 15 µg of oocyte membrane protein were loaded on each of the other lanes.

 

Membrane localization of the mutant Oatp1 constructs was also examined by immunofluorescence, using FLAG epitope-tagged proteins. FLAG-tagged constructs of native Oatp1, N124/135/492D-Oatp1, and N62/124/135/492D-Oatp1 were synthesized, and functional activity of the constructs was assessed by measuring [3H]taurocholate uptake in oocytes (Fig. 11). As illustrated in Fig. 11, transport activity of the constructs was comparable with that of the untagged proteins (Fig. 7). Immunofluorescence analysis revealed a distinct membrane localization for Oatp1-FLAG and the triple mutant (N124/135/492D-Oatp1-FLAG), whereas the quadruple mutant (N62/124/135/492D-Oatp1-FLAG) provided only minimal staining of the plasma membrane (Fig. 12), confirming the immunoblot analyses illustrated in Figs. 9 and 10.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 11. Taurocholate transport activity in oocytes expressing Oatp1, Oatp1-FLAG, N124/135/492D-Oatp1-FLAG, or N62/124/135/492D-Oatp1-FLAG. Uptake of 20 µM [3H]taurocholate was measured for 1 h in oocytes injected with cRNA synthesized from Oatp1, Oatp1-FLAG, N124/135/492D-Oatp1-FLAG, or N62/124/135/492D-Oatp1-FLAG (2 ng cRNA per oocyte for each construct). Values are expressed as %native Oatp1 (means ± SE of 3 separate experiments, each performed in triplicate).

 


View larger version (51K):
[in this window]
[in a new window]
 
Fig. 12. Immunofluorescence detection of Oatp1-FLAG protein constructs expressed in Xenopus oocytes. Confocal microscopy images of a control oocyte (A) or oocytes expressing Oatp1-FLAG (B), N124/135/492D-Oatp1-FLAG (C), or N62/124/135/492D-Oatp1-FLAG (D) are shown. Cells were labeled with an anti-FLAG M2 monoclonal antibody and visualized by an Alexa Fluor 488 F(ab')2 fragment of goat anti-mouse antibody.

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Heterologous expression of functional mammalian proteins in yeast has been documented in several studies (1, 6, 23, 24, 37). The present study attempted to develop a suitable system for studying the mechanism of Oatp1-mediated transport by expressing this protein in the NY17 (sec6–4) yeast strain. The results show that, although high levels of the rat Oatp1 protein were present in secretory vesicles from this strain of yeast, Oatp1 was not functionally active. The lack of functional activity in yeast appears to be related to the lack of N-glycosylation, as demonstrated by studies carried out in X. laevis oocytes.

The expression of a functional mammalian protein in yeast is dependent on the yeast's ability to carry out the correct protein folding, posttranslational modifications, and targeting of the heterologous protein. The present results demonstrate that Oatp1 undergoes minimal posttranslational modifications in yeast and suggest that the absence of these modifications leads to a loss of transport function. This conclusion is consistent with that of several other studies that have shown a loss of functional activity in underglycosylated proteins. For example, Martinez-Maza et al. (26) reported a complete loss of activity of the glycine transporter GLYT2 when the glycosylated asparagine residues were removed via site-directed mutagenesis. The unglycosylated GLYT2 was retained in intracellular compartments when transiently expressed in COS-7 and MDCK cells (26), but the loss of activity of the unglycosylated GLYT2 was not directly related to its inability to reach the plasma membrane, as demonstrated by transport assays performed in artificial liposomes (26). Likewise, the deglycosylated human erythrocyte glucose transporter has diminished transport activity compared with the glycosylated protein (11). Transport mediated by the mouse organic anion transporter has been shown to be blocked by deglycosylation, but the loss of activity was due to the intracellular retention of the unglycosylated protein (22).

However, deglycosylation does not always abrogate function. For example, the unglycosylated rat GLUT-1 expressed in yeast was shown to be functional, but it exhibited some kinetic differences (1, 11). Similarly, the unglycosylated P-glycoproteins human multidrug resistance protein (MDR) 1 and mouse Mdr3 have been shown to be targeted to the plasma membrane and to be functionally active when expressed in the yeast Pichia pastoris (24, 37). The human multidrug resistance-associated protein (MRP) 1 (37) and the rat Mrp6 (6) have also been shown to be functional when expressed in the yeast P. pastoris, and the human CHIP28 water channel is functional when expressed in its unglycosylated form in S. cerevisiae secretory vesicles (23). The present study demonstrates that Oatp1 is not glycosylated in S. cerevisiae and that this transporter lacks functional activity.

The results from the X. laevis oocyte experiments provide direct evidence that N-glycosylation of Oatp1 modulates the function of this transporter and indicate that intracellular trafficking is also regulated by N-glycosylation. Preventing glycosylation with tunicamycin or by mutating the glycosylation sites nearly abolished the activity of Oatp1. Mutations to the four glycosylation sites on Oatp1 revealed that there was a cumulative effect on the function of Oatp1, leading to the total loss of activity when all glycosylation sites were removed. Interestingly, single N-glycosylation Oatp1 mutants retained most of their functional activity in oocytes, suggesting that no single glycosylation site on Oatp1 is crucial for expression and activity. However, there was a cumulative effect of removing additional glycosylation sites on Oatp1. Double and triple glycosylation site mutants appeared to be properly targeted to the plasma membrane but had significantly lower functional activity compared with wild-type Oatp1. On the other hand, the N62/124/135/492D Oatp1 mutant was present at lower amounts in the plasma membrane compared with the triple Oatp1 mutants and wild-type Oatp1, indicating that targeting to the plasma membrane was also defective. Of course, it is important to acknowledge that the loss of functional activity observed in the mutants may also have been due to the changes in amino acid sequence and not necessarily to the deglycosylation per se. However, our results with the yeast expressing the native underglycosylated Oatp1 and in oocytes treated with tunicamycin would argue that loss of glycosylation is sufficient to impair function.

Although Oatp1 expressed in X. laevis oocytes is functional and appears to be partially glycosylated, it has a lower molecular mass than the Oatp1 present in rat liver membranes. This may be due to differences in terminal N-glycosylation between rat hepatocytes and Xenopus oocytes (32). For example, previous studies demonstrated that Oatps generally display decreased apparent molecular mass when expressed in oocytes (8). The type of carbohydrate and the degree of branching of N-linked oligosaccharides is known to depend on cell type (reviewed in Refs. 15 and 29). For example, the human OATP8 is present as a 125-kDa protein in the basolateral membrane of the human liver, but in HepG2 cells (a human liver-derived cell line) it displays a molecular mass of only ~90 kDa (19).

The precise role that glycosylation plays in the functional expression of Oatp1 is not known. At the functional level, the presence of the carbohydrate moieties on the asparagine residues may promote the formation of an active protein conformation or may aid in substrate recognition. It is interesting to note that the ability of the immune system to recognize a vast array of different antigens is due in part to the diversity in the N-glycosylation of receptors (reviewed in Refs. 33 and 34). On the basis of this information, it is conceivable that a transport protein expressed in different cell types may have subtle or significant differences in protein activity. Interestingly, Oatp1 has been shown to undergo differential processing in the liver and kidney (5), although the functional consequences of these differences among organs is unknown. In addition, the human OATP2 (also known as LST-1 and OATP-C) is present as both a glycosylated (~84 kDa) and an unglycosylated (~58 kDa) protein in the basolateral membrane of the liver (20), but the functional significance of this is not yet known.

In conclusion, the yeast secretory vesicle expression system is an important model for studying membrane transporters, but the expression of a heterologous protein can be hindered if the protein of interest requires extensive posttranslational processing. The present study demonstrates that N-glycosylation plays an important role in the functional activity and trafficking of Oatp1.


    DISCLOSURES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
This work was supported in part by the National Institute of Health Grants ES-06484 and DK-48823, National Institute of Environmental Health Sciences Center Grant ES-01247, and Toxicology Training Program Grant ES-07026. Additional support to T. K. Lee was provided by an American Liver Foundation Student Research Fellowship Award.


    ACKNOWLEDGMENTS
 
We thank Judith Cornejo and David Seward for helpful advice.


    FOOTNOTES
 

Address for reprint requests and other correspondence: N. Ballatori, Dept. of Environmental Medicine, Box EHSC, Univ. of Rochester School of Medicine, 575 Elmwood Ave., Rochester, NY 14642 (E-mail: ned_ballatori{at}urmc.rochester.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 

  1. Asano T, Katagiri H, Takata K, Lin JL, Ishihara H, Inukai K, Tsukuda K, Kikuchi M, Hirano H, Yazaki Y, and Oka Y. The role of N-glycosylation of GLUT1 for glucose transport activity. J Biol Chem 266: 24632–24636, 1991.[Abstract/Free Full Text]
  2. Ballatori N, Moseley RH, and Boyer JL. Sodium gradient-dependent L-glutamate transport is localized to the canalicular domain of liver plasma membranes. Studies in rat liver sinusoidal and canalicular membrane vesicles. J Biol Chem 261: 6216–6221, 1986.[Abstract/Free Full Text]
  3. Ballatori N and Rebbeor JF. Roles of MRP2 and oatp1 in hepatocellular export of reduced glutathione. Semin Liver Dis 18: 377–387, 1998.[ISI][Medline]
  4. Ballatori N, Wang W, Li L, and Truong AT. An endogenous ATP-sensitive glutathione S-conjugate efflux mechanism in Xenopus laevis oocytes. Am J Physiol Regul Integr Comp Physiol 270: R1156–R1162, 1996.[Abstract/Free Full Text]
  5. Bergwerk AJ, Shi X, Ford AC, Kanai N, Jacquemin E, Burk RD, Bai S, Novikoff PM, Stieger B, Meier PJ, Schuster VL, and Wolkoff AW. Immunologic distribution of an organic anion transport protein in rat liver and kidney. Am J Physiol Gastrointest Liver Physiol 271: G231–G238, 1996.[Abstract/Free Full Text]
  6. CIA J, Dour R, Malawi O, Georges E, Pelletier J, and Gross P. Nucleotide binding and nucleotide hydrolysis properties of the ABC transporter MRP6 (ABCC6). Biochemistry 41: 8058–8067, 2002.[Medline]
  7. CIA J, Dour R, Georges E, and Gross P. Functional expression of multidrug resistance protein 1 in Pichia pastoris. Biochemistry 40: 8307–8316. 2001.
  8. Cattori V, Hagenbuch B, Hagenbuch N, Stieger B, Ha R, Winterhalter KE, and Meier PJ. Identification of organic anion transporting polypeptide 4 (Oatp4) as a major full-length isoform of the liver-specific transporter-1 (rlst-1) in rat liver. FEBS Lett 474: 242–245, 2000.[ISI][Medline]
  9. Dutczak WJ and Ballatori N. Transport of the glutathionemethylmercury complex across liver canalicular membranes on reduced glutathione carriers. J Biol Chem 269: 9746–9751, 1994.[Abstract/Free Full Text]
  10. Everts I, Villmann C, and Hollmann M. N-glycosylation is not a prerequisite for glutamate receptor function but is essential for lectin modulation. Mol Pharmacol 52: 861–873, 1997.[Abstract/Free Full Text]
  11. Feugeas JP, Neel D, Pavia AA, Laham A, Goussault Y, and Derappe C. Glycosylation of the human erythrocyte glucose transporter is essential for glucose transport activity. Biochim Biophys Acta 1030: 60–64, 1990.[Medline]
  12. Glavy JS, Wu SM, Wang PJ, Orr GA, and Wolkoff AW. Down-regulation by extracellular ATP of rat hepatocyte organic anion transport is mediated by serine phosphorylation of oatp1. J Biol Chem 275: 1479–1484, 2000.[Abstract/Free Full Text]
  13. Goldin AL. Maintenance of Xenopus laevis and oocyte injection. Methods Enzymol 207: 266–279, 1992.[ISI][Medline]
  14. Guo GL and Klaassen CD. Protein kinase C suppresses rat organic anion transporting polypeptide 1- and 2-mediated uptake. J Pharmacol Exp Ther 299: 551–557, 2001.[Abstract/Free Full Text]
  15. Helenius A and Aebi M. Intracellular functions of N-linked glycans. Science 291: 2364–2369, 2001.[Abstract/Free Full Text]
  16. Jacquemin E, Hagenbuch B, Stieger B, Wolkoff AW, and Meier PJ. Expression cloning of a rat liver Na+-independent organic anion transporter. Proc Natl Acad Sci USA 91: 133–137, 1994.[Abstract/Free Full Text]
  17. Kasahara T and Kasahara M. Expression of the rat GLUT1 glucose transporter in the yeast Saccharomyces cerevisiae. Biochem J 315: 177–182, 1996.
  18. Kiser GL, Gentzsch M, Kloser AK, Balzi E, Wolf DH, Goffeau A, and Riordan JR. Expression and degradation of the cystic fibrosis transmembrane conductance regulator in Saccharomyces cerevisiae. Arch Biochem Biophys 390: 195–205, 2001.[ISI][Medline]
  19. Konig J, Cui Y, Nies AT, and Keppler D. Localization and genomic organization of a new hepatocellular organic anion transporting polypeptide. J Biol Chem 275: 23161–23168, 2000.[Abstract/Free Full Text]
  20. Konig J, Cui Y, Nies AT, and Keppler D. A novel human organic anion transporting polypeptide localized to the basolateral hepatocyte membrane. Am J Physiol Gastrointest Liver Physiol 278: G156–G164, 2000.[Abstract/Free Full Text]
  21. Kullak-Ublick GA, Stieger B, Hagenbuch B, and Meier PJ. Hepatic transport of bile salts. Semin Liver Dis 20: 273–292, 2000.[ISI][Medline]
  22. Kuze K, Graves P, Leahy A, Wilson P, Stuhlmann H, and You G. Heterologous expression and functional characterization of a mouse renal organic anion transporter in mammalian cells. J Biol Chem 274: 1519–1524, 1999.[Abstract/Free Full Text]
  23. Laize V, Rousselet G, Verbavatz JM, Berthonaud V, Gobin R, Roudier N, Abrami L, Ripoche R, and Tacnet F. Functional expression of the human CHIP28 water channel in a yeast secretory mutant. FEBS Lett 373: 269–274, 1995.[ISI][Medline]
  24. Lerner-Marmarosh N, Gimi K, Urbatsch IL, Gross P, and Senior AE. Large scale purification of detergent-soluble P-glycoprotein from Pichia pastoris cells and characterization of nucleotide binding properties of wild-type, Walker A, and Walker B mutant proteins. J Biol Chem 274: 34711–34718, 1999.[Abstract/Free Full Text]
  25. Li L, Lee TK, Meier PJ, and Ballatori N. Identification of glutathione as a driving force and leukotriene C4 as a substrate for Oatp1, the hepatic sinusoidal organic solute transporter. J Biol Chem 273: 16184–16191, 1998.[Abstract/Free Full Text]
  26. Martinez-Maza R, Poyatos I, Lopez-Corcuera B, Nunez E, Gimenez C, Zafra F, and Aragon C. The role of N-glycosylation in transport to the plasma membrane and sorting of the neuronal glycine transporter GLYT2. J Biol Chem 276: 2168–2173, 2001.[Abstract/Free Full Text]
  27. Meier PJ, St. Meier-Abt A, Barrett C, and Boyer JL. Mechanisms of taurocholate transport in canalicular and basolateral rat liver plasma membrane vesicles. Evidence for an electrogenic canalicular organic anion carrier. J Biol Chem 259: 10614–10622, 1984.[Abstract/Free Full Text]
  28. Mount RC, Jordan BE, and Hadfield C. Transformation of lithium-treated yeast cells and the selection of auxotrophic and dominant markers. Methods Mol Biol 53: 139–145, 1996.[Medline]
  29. Munro S. What can yeast tell us about N-linked glycosylation in the Golgi apparatus? FEBS Lett 498: 223–227, 2001.[ISI][Medline]
  30. Nakamoto RK, Rao R, and Slayman CW. Expression of the yeast plasma membrane [H+]ATPase in secretory vesicles. A new strategy for directed mutagenesis. J Biol Chem 266: 7940–7949, 1991.[Abstract/Free Full Text]
  31. Rebbeor JF, Connolly GC, Dumont ME, and Ballatori N. ATP-dependent transport of reduced glutathione in yeast secretory vesicles. Biochem J 334: 723–729, 1998.
  32. Roitsch T and Lehle L. Expression of yeast invertase in oocytes from Xenopus laevis. Secretion of active enzyme differing in glycosylation. Eur J Biochem 181: 733–739, 1989.[ISI][Medline]
  33. Rudd PM, Elliott T, Cresswell P, Wilson IA, and Dwek RA. Glycosylation and the immune system. Science 291: 2370–2376, 2001.[Abstract/Free Full Text]
  34. Rudd PM, Wormald MR, Stanfield RL, Huang M, Mattsson N, Speir JA, DiGennaro JA, Fetrow JS, Dwek RA, and Wilson IA. Roles for glycosylation of cell surface receptors involved in cellular immune recognition. J Mol Biol 293: 351–366, 1999.[ISI][Medline]
  35. Ruetz S and Gross P. Functional expression of P-glycoproteins in secretory vesicles. J Biol Chem 269: 12277–12284, 1994.[Abstract/Free Full Text]
  36. Suzuki H and Sugiyama Y. Transport of drugs across the hepatic sinusoidal membrane: sinusoidal drug influx and efflux in the liver. Semin Liver Dis 20: 251–263, 2000.[ISI][Medline]
  37. Urbatsch IL, Wilke-Mounts S, Gimi K, and Senior AE. Purification and characterization of N-glycosylation mutant mouse and human P-glycoproteins expressed in Pichia pastoris cells. Arch Biochem Biophys 388: 171–177, 2001.[ISI][Medline]
  38. Zafra F and Gimenez C. Molecular determinants involved in the asymmetrical distribution of glycine transporters in polarized cells. Biochem Soc Trans 29: 746–750, 2001.[ISI][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
P. Wang, S. Hata, Y. Xiao, J. W. Murray, and A. W. Wolkoff
Topological assessment of oatp1a1: a 12-transmembrane domain integral membrane protein with three N-linked carbohydrate chains
Am J Physiol Gastrointest Liver Physiol, April 1, 2008; 294(4): G1052 - G1059.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
R. M. Pelis, W. M. Suhre, and S. H. Wright
Functional influence of N-glycosylation in OCT2-mediated tetraethylammonium transport
Am J Physiol Renal Physiol, May 1, 2006; 290(5): F1118 - F1126.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
285/2/G371    most recent
00358.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, T. K.
Right arrow Articles by Ballatori, N.
Right arrow