|
|
||||||||
LIVER AND BILIARY TRACT
Departments of 1Environmental Medicine and 2Pathology, University of Rochester School of Medicine, Rochester, New York 14642
Submitted 23 August 2002 ; accepted in final form 3 April 2003
| ABSTRACT |
|---|
|
|
|---|
62 kDa, whereas in liver plasma membranes Oatp1 has
an M of
85 kDa. To assess whether underglycosylation of Oatp1 in
yeast suppressed functional activity, Oatp1 was expressed in Xenopus
laevis oocytes with and without tunicamycin, a glycosylation inhibitor.
With tunicamycin, M of Oatp1 decreased from
72 to
62 kDa
and transport activity was nearly abolished. Mutations to four predicted
N-glycosylation sites on Oatp1 (Asn to Asp at positions 62, 124, 135,
and 492) revealed a cumulative effect on function of Oatp1, leading to total
loss of taurocholate transport activity when all glycosylation sites were
removed. M of the quadruple mutant was
62 kDa, confirming that
these asparagine residues are sites of glycosylation in Oatp1. Relatively
little of the quadruple mutant was able to reach the plasma membrane, and most
remained in unidentified intracellular compartments. In contrast, two of the
triple mutants tested (N62/124/135D and N124/135/492D) were present in the
plasma membrane fraction yet exhibited minimal transport activity. These
results demonstrate that both membrane targeting and functional activity of
Oatp1 are controlled by the extent of N-glycosylation.
membrane transport; posttranslational modifications; protein trafficking; yeast; Xenopus oocytes
In an attempt to further characterize the mechanism of Oatp1-mediated transport, Oatp1 was expressed in the NY17 strain of Saccharomyces cerevisiae (sec64). Yeast have a number of attributes that make them particularly attractive for carrying out such studies, including the lack of Oatp-like genes in the S. cerevisiae genome and the fact that the sec64 strain allows for the isolation in high yield of secretory vesicles that are ideally suited for such transport studies (30, 31, 35). However, one drawback of yeast is that they have only a limited ability to carry out certain posttranslational modifications, including glycosylation (17, 18, 23, 24, 37). For example, the mammalian CHIP water channel (23), the rat Glut1 glucose transporter (17), and some P-glycoprotein transporters (24, 37) are only minimally glycosylated in yeast. Because N-glycosylation is required for proper trafficking and functional activity of many membrane transporters (e.g., Refs. 22, 26, and 38), but not necessarily all transporters (e.g., Refs. 7 and 37), this may limit the utility of yeast as a model system.
The role of phosphorylation on Oatp1 function has recently been investigated (12, 14), but the effects of N-glycosylation have not been examined. Oatp1 is predicted to have four N-glycosylation sites on its extracellular loops: asparagine residues at positions 62, 124, 135, and 492 as part of the consensus N-glycosylation sequence Asn-X-Ser/Thr (16). On the basis of the predicted membrane topology of Oatp1, Asn62 is located on the first extracellular loop, Asn124 and Asn135 on the second extracellular loop, and Asn492 on the fifth extracellular loop. Interestingly, these glycosylation sites are generally conserved in other members of the OATP/Oatp family (21, 36).
In the present study, Oatp1 was expressed in S. cerevisiae and the functional role of N-glycosylation was examined in Xenopus laevis oocytes. The results indicate that this transporter is dependent on N-glycosylation for both its functional activity and its delivery to the cell membrane.
| MATERIALS AND METHODS |
|---|
|
|
|---|
2.0 and diluted in
SD-URA(-) medium containing 2% raffinose-2% galactose (OD600
0.1) for 20 h at 27°C and 225 rpm (OD600
1.01.3).
Cells were grown at the nonpermissive temperature of 37°C for the final 2
h of induction to accumulate secretory vesicles. To determine the
glycosylation state of Oatp1 synthesized in yeast, cells were treated with
tunicamycin (10 µg/ml) for 4 h and whole cell lysate was used for analysis
of Oatp1 expression.
Yeast secretory vesicle isolation. Secretory vesicles were
isolated and characterized as previously described
(31). Briefly, NaN3
(10 mM) was added to cells chilled in an ice bath, and 10 min later the cells
were decanted to preweighed tubes and spun down at 8,000 g in a
Sorvall GSA rotor for 10 min. Cell pellets were washed with ice-cold 10 mM
NaN3, pelleted as before, weighed, and frozen at -80°C. Cell
pellets were thawed at room temperature in preweighed Sorvall SA-600 rotor
tubes with 25 ml of 100 mM Tris sulfate, pH 9.4, and 40 mM
-mercaptoethanol for 10 min at room temperature, pelleted at 3,000
g for 10 min, and resuspended in spheroplasting buffer (1.2 M
sorbitol, 20 mM HEPES-Tris, pH 7.5) containing 10 mM NaN3, 2 mM
EDTA, 40 mM
-mercaptoethanol, and 1.5 g of acid-washed glass beads per
10-ml volume. Cells were vortexed vigorously five times for 1 min with 3-min
incubations in between vortexing in ice. The lysate was spun down at 10,000
g for 10 min to pellet unbroken cells and glass beads. Secretory
vesicles were harvested by ultracentrifugation of slow-speed supernatant (S1)
in a Sorvall T-865 ultracentrifuge rotor at 100,000 g for 45 min.
Pellets were resuspended in transport buffer [250 mM sucrose, 10 mM HEPES-Tris
(pH 7.5), 20 mM KCl], spun at 100,000 g for 45 min, and resuspended
in transport buffer by being passed 1020 times through a syringe with a
25-gauge needle at a final concentration of 510 mg/ml protein.
Rat liver plasma membrane isolation. Rat liver basolateral plasma membrane vesicles were isolated according to the procedure of Meier et al. (27), as previously described in this laboratory (2, 9).
Transport measurements in yeast. Transport was measured as uptake of radiolabeled substrate into vesicles collected by rapid filtration on a Millipore 0.45-µm filter under vacuum, essentially as described previously (2). Secretory vesicles were thawed by immersion in a 30°C water bath, diluted to 5 mg/ml in transport buffer supplemented with 10 mM phosphocreatine, 10 mM MgCl2, 100 µg/ml creatine phosphokinase, and either 5 mM Na2ATP or 10 mM NaCl. Diluted secretory vesicles were repeatedly passed through a 25-gauge needle and incubated at 30°C for 15 min before initiation of the transport reaction. Transport was started by adding equal volumes of diluted secretory vesicles to 2x transport buffer with substrate at 30°C. Transport was quenched by removing aliquots of the reaction at various time points into 1 ml of ice-cold stop buffer [300 mM sucrose, 10 mM HEPES-Tris (pH 7.5), 20 mM KCl], and secretory vesicles were collected by applying 1 ml of quenched reaction solution to prewetted filter under a vacuum and then washing the filter with an additional 4 ml of ice-cold stop buffer. Filters were collected and dissolved in 5 ml of Opti-Fluor (Packard Instruments, Meriden, CT), and radiolabeled drug uptake was quantified by liquid scintillation measurements. Controls for nonspecific binding of drug to filters and vesicles were determined by measuring retention of radiolabeled substrate on secretory vesicles incubated in transport buffer at 4°C for each time point.
Mutagenesis of N-glycosylation sites of Oatp1. The four potential asparagine residues involved in N-linked glycosylation on Oatp1 were changed to aspartic acid by sequential single-nucleotide mutation with Stratagene QuickChange site-directed mutagenesis kit according to the supplied instruction manual. The codons for Asn located at positions 62, 124, 135, and 492 were mutated to Asp with the following oligos and their corresponding antisense oligos (the mutated Asp codons are underlined): N62D, GCTGGATTAATCGATGGGAGCTTTGAC; N124D, CACCTACAGGCGACTTGTCCTCAAACAGC; N135D, GTGTATGGAGGACCGAACACAGACC; and N492D, CAGTCATTAGGAGACTCGTCTGCAGTCC. In addition, single, double, and triple Asn-to-Asp mutations were made by using the same method in various combinations. Each resulting cDNA was sequenced at the University of Rochester School of Medicine sequencing facility.
Synthesis of FLAG epitope-tagged Oatp1 cDNAs. The FLAG epitope (DYKDDDDK) was added in frame to the 3'-end of Oatp1, N124/135/492D-Oatp1, and N62/124/135/492D-Oatp1 cDNA in the pSPORT vector just before the stop codon by using PCR. The forward primer contained a SalI restriction site, and the reverse primer contained the FLAG sequence and an XbaI site. The primer sequences used were as follows: forward, 5'-GGATTCCCGGGTCGACGAGCTCATGAGTGTACT-3'; reverse, 5'-AAATCTAGATTACTTGTCGTCATCGTCTTTGTAGTCCAGCTTCGTTTTCAGTTCTCCGTC-3'. The resulting PCR products were then subcloned into the pSPORT vector by using the SalI and XbaI restriction sites. Next, 700 bp of the Oatp1 3'-untranslated region was generated by using PCR with the forward primer containing the XbaI site and the reverse primer containing the MluI site. The primer sequences used were as follows: forward, 5'-AAATCTAGATGAGTTTTCTACTGCCCTGTTCAA-3'; reverse, 5'-TGCACGCGTACGTAAGCTTGGATCCTTTAAAGC-3'. This second fragment was then directionally subcloned into the pSPORT vector containing the Oatp1-FLAG constructs using the XbaI and MluI sites to produce the final pSPORT-Oatp1-FLAG plasmids.
In vitro transcription and expression in Xenopus oocytes. Plasmid cDNAs containing wild-type Oatp1 and mutant Oatp1 were linearized with XbaI and then transcribed with T7 polymerase by using the mMESSAGE mMACHINE (Ambion) transcription system. Isolation of X. laevis oocytes was performed as described by Goldin (13) and as described previously by our laboratory (4). Toads were anesthetized by immersion for 15 min in ice-cold water containing 0.3% tricaine (Sigma). Oocytes were removed from the ovary and washed with Ca2+-free OR-2 solution (in mM: 82.5 NaCl, 2 KCl, 1 MgCl2, and HEPES-Tris, pH 7.5) and incubated at room temperature with gentle shaking for 90 min in OR-2 solution supplemented with 2 mg/ml collagenase (Sigma type IA). Oocytes were transferred to fresh collagenase solution after the first 45 min of incubation. Collagenase was removed by extensive washing in OR-2 solution at room temperature. Stage V and VI defolliculated oocytes were selected and incubated at 18°C in modified Barth's solution [in mM: 88 NaCl, 1 KCl, 2.4 NaHCO3, 0.82 MgSO4, 0.33 Ca(NO3)2, 0.41 CaCl2, and 20 HEPES-Tris, pH 7.5] supplemented with gentamycin (0.05 mg/ml). After 34 h of incubation, healthy oocytes were injected with 50 nl of either wild-type Oatp1 cRNA solution (0.510 ng/oocyte), mutant Oatp1 cRNA (0.5 ng/oocyte), or FLAG-tagged Oatp1 constructs (2 ng/oocyte). Control oocytes were injected with a corresponding volume of sterile H2O. Injected oocytes were cultured at 18°C with a daily change of modified Barth's medium containing gentamycin. Healthy oocytes with a clean brown animal half and distinct equator line were selected for experiments.
Inhibition of N-glycosylation by tunicamycin. At 2 h before injection with cRNA, oocytes were preinjected with 50 nl of 400 µg/ml tunicamycin. Immediately before injection, a stock solution of 40 mg/ml tunicamycin in DMSO was diluted to 1% DMSO with sterile water.
Oocyte transport measurements. Uptake studies were performed 3 days after microinjection. Six to eight oocytes were incubated at 25°C for 1 h in 100 µl of modified Barth's solution in the presence of 0.5 µCi of 20 µM [3H]taurocholate. Uptake was stopped by adding 2.5 ml of ice-cold modified Barth's solution, and oocytes were washed three times each with 2.5 ml of ice-cold modified Barth's solution with 1 mM unlabeled taurocholate to reduce nonspecific binding of tracer taurocholate. Two oocytes were dissolved in a polypropylene scintillation vial with 0.2 ml of 10% SDS and counted in a Beckman model 6500 scintillation spectrometer after addition of 5 ml of Opti-Fluor (Packard Instruments).
Western blot of oocytes. Oocyte subcellular fractions and secretory vesicle fractions isolated from NY17 cells were added to an equal volume of sample loading buffer [50 mM Tris · HCl (pH 6.8), 2% (wt/vol) SDS, 0.1 mM dithiothreitol, 10% (vol/vol) glycerol] and subjected to SDS-PAGE on precast 420% (wt/vol) gradient gels (Bio-Rad). Whole yeast cell lysate was prepared using 24 x 107 cells in 100 µl of SDS-PAGE sample buffer and 100 mg of acid-washed glass beads. The contents were vortexed vigorously three times for 1 min with 2-min ice incubation periods in between. Ten to twenty microliters of cell lysate were subjected to SDS-PAGE (corresponding to 2040 µg protein). The separated polypeptides were electrotransferred onto 0.45-µm Immuno-Blot polyvinylidene difluoride membranes (Bio-Rad) for1hat120 mA using a semidry transfer apparatus. The filters were blocked and then incubated for 2 h at room temperature with a 1:3,000 dilution of rabbit antisera raised against the COOH-terminal Oatp1 antigen (kindly provided by Dr. Bruno Stieger, University Hospital, Zurich, Switzerland). Immunoreactive bands were detected by incubating washed membranes with a 1:3,000 dilution of anti-rabbit IgG conjugated with horseradish peroxidase enzyme (Sigma) and then detected by enhanced chemiluminescence according to the manufacturer's instructions (Amersham). Xenopus oocyte proteins were isolated at 3 days after RNA injection as described by Everts et al. (10). Briefly, 20 oocytes were homogenized in a buffer that contained 100 mM NaCl, 20 mM HEPES-Tris, pH 7.4, 1% Triton X-100, 1 mM phenylmethylsulfonyl fluoride, and a cocktail of additional protease inhibitors (Sigma P-8340). The homogenate was centrifuged for 10 min at 10,000 g. The supernatant containing the cytosolic proteins and the solubilized membrane proteins were separated at 4°C by SDS-PAGE.
For preparation of a crude plasma membrane subfraction, oocytes were lysed
by passage through a 25-gauge needle multiple times at 4°C in 7.5 mM NaCl,
10 mM HEPES-Tris, pH 7.4, containing 1 mM phenylmethylsulfonyl fluoride and
P-8340. After centrifugation for 10 min at 1,000 g to remove nuclei,
the supernatant was centrifuged at 45,000 g for 90 min at 4°C.
The pellet was resuspended in 100 mM NaCl, 20 mM HEPES-Tris, pH 7.4, 1% Triton
X-100, 1 mM phenylmethylsulfonyl fluoride, and P-8340 to yield
12
µg protein/µl.
Immunofluorescence labeling of intact oocytes. Intact Xenopus oocytes on day 3 after cRNA injection were fixed in methanol-acetone (1:1) for 10 min on ice, followed by four washes of 5 min each at room temperature and an overnight wash at 4°C in antibody dilution buffer (0.01 M PBS, 0.05% Tween 20, 1% BSA, 1% normal goat serum, and 0.01% sodium azide). Oocytes were washed at room temperature with 1x PBS-1% Tween 20 for 1 h, with 10-min buffer changes, followed by a 15-min incubation in blocking solution (3% BSA in antibody dilution buffer). Oocytes were then washed with 1x PBS-1% Tween 20 for another 1 h, with 10-min buffer changes, followed by an overnight wash at 4°C. The oocytes were incubated with anti-FLAG M2 monoclonal antibody for 1 h (4.9 mg/ml, diluted 1:200 with antibody dilution buffer; Sigma). To remove excess antibody, oocytes were washed in 1x PBS-1% Tween 20 three times for 5 min each, two times for 10 min each, and then overnight, followed by an incubation for 1 h with Alexa Fluor 488 F(ab')2 fragment of goat anti-mouse antibody in the dark (2 mg/ml, diluted 1:200; Molecular Probes). Secondary antibody was removed by washing oocytes with 1x PBS-1% Tween 20 three times for 5 min each, two times for 10 min each, and then overnight. Cells were imaged using a x10 objective on a Leica TCS-SP laser-scanning confocal microscope.
| RESULTS |
|---|
|
|
|---|
Western blot detection of whole cell yeast proteins revealed a band with an
apparent molecular mass of
62 kDa
(Fig. 1, lane 3), a
size similar to that of unmodified Oatp1
(16), whereas in rat liver
membranes Oatp1 had an apparent molecular mass of
85 kDa
(Fig. 1, lane 1).
Oatp1 was strongly expressed in yeast grown in the presence of 2% galactose
(Fig. 1) but was not present in
cells grown in glucose, a potent repressor of the GAL1 promoter
(Fig. 1, lane 2).
Higher-molecular-mass bands of
120 and
180 kDa were also detected in
yeast grown under inducing conditions, suggesting oligomerization of this
protein in the gel. Treatment of yeast cells with tunicamycin, an inhibitor of
N-glycosylation, did not further reduce the Oatp1 apparent molecular
mass (Fig. 1, lane 4),
indicating that the Oatp1 expressed in yeast is not glycosylated. The lack of
N-glycosylation of heterologously expressed mammalian transporters in
yeast has been previously reported for some P-glycoproteins
(24,
37), the CHIP water channel
(23), and the GLUT-1 glucose
transporter (17).
|
Immunoblot analysis of a purified yeast secretory vesicle fraction
(Fig. 2) showed similar bands
to those detected in whole cell lysates
(Fig. 1), namely a protein band
of
62 kDa, with higher-molecular-mass bands of
120 and 180 kDa.
These bands were not present in secretory vesicles isolated from cells grown
under repressive conditions with 2% glucose
(Fig. 2, lane 2). No
Oatp1-immunoreactive bands were detected in the soluble fraction
(Fig. 2, lane 4). Of
significance, Oatp1 was present at relatively high levels in yeast secretory
vesicles compared with an equal amount of rat liver membrane proteins
(Fig. 2). Oatp1 could be
detected by loading <1 µg of the whole cell yeast lysate or <100 ng
of a secretory vesicle fraction (data not shown), indicating a high level of
expression of this protein in yeast.
|
The growth of the cells under inducing (2% raffinose-2% galactose) and
noninducing (2% raffinose) conditions was followed to examine the potential
burden of Oatp1 expression. Figure
3 illustrates a typical experiment conducted until
OD600 reached
1.5; however, all yeast cells used for
expression analyses were grown only until OD600 reached
0.81.2. Growth by the Oatp1-expressing yeast cells was slower than
uninduced control cells (Fig.
3). Both cultures reached a stationary phase at OD600
2.52.6, but the noninducing and inducing cultures reached this
stage at different time points, i.e.,
28 and
45 h, respectively
(data not shown). The difference in growth between the two cultures is
probably due to the high levels of Oatp1 synthesized under inducing
conditions.
|
Because Oatp1 did not appear to be glycosylated in yeast, additional studies examined whether the high levels of Oatp1 protein synthesized by these cells may have overwhelmed the glycosylation machinery. To test this hypothesis, the level of Oatp1 expression was controlled by regulating the concentration of the inducing sugar galactose in the medium. The results show that Oatp1 protein is detected at 0.1% galactose, with a significant increase in expression at 0.5% galactose and maximal expression at 12% galactose (Fig. 4). However, the apparent molecular mass of Oatp1 was not changed, indicating that the level of Oatp1 expression did not appear to define the processing of this protein in yeast.
|
To examine Oatp1 functional activity in yeast, ATP-independent transport of taurocholate, estrone sulfate, and leukotriene C4 was measured in isolated yeast secretory vesicles. Because yeast secretory vesicles also contain many ATP-dependent transporters, including one for taurocholate (Bat1), ATP-dependent transport of taurocholate was also measured to assess the functional integrity of the secretory vesicles. ATP-dependent transport of taurocholate was robust and led to a fast steady-state accumulation in the secretory vesicles (Fig. 5), supporting the integrity of these secretory vesicles for transport assays. However, when ATP-independent transport of taurocholate, estrone sulfate, and leukotriene C4 was measured in both the Oatp1-expressing and control secretory vesicles, no transport activity was observed (Fig. 5), indicating that the Oatp1 expressed in yeast was not functional, despite the high level of Oatp1 protein present in these vesicles. To test whether the lack of transport activity in the yeast vesicles was due to a lack of GSH, we pre-loaded the vesicles with 10 mM GSH and then measured uptake of radiolabeled estrone sulfate and taurocholate. However, GSH failed to stimulate transport activity (data not shown). Transport of taurocholate in Oatp1-expressing yeast was also measured at the whole cell level; however, no transport activity was detected in the Oatp1-expressing yeast (data not shown).
|
To examine whether the lack of Oatp1 functional activity in yeast is related to its underglycosylation, additional studies were carried out in the X. laevis oocyte expression system. Oocytes were treated with tunicamycin to inhibit glycosylation or were injected with cRNA for Oatp1 that had been mutated to delete the four putative N-glycosylation sites, and [3H]taurocholate (20 µM) uptake was measured.
Western blot analysis of whole cell extracts from oocytes expressing rat
Oatp1 indicated that the apparent molecular mass of Oatp1 was
72 kDa
(Fig. 6A). This size
is smaller than that found in rat liver membranes (
85 kDa;
Fig. 6A) but larger
than that noted in yeast (
62 kDa, Fig.
1). Immunoblot analysis of whole cell extract from oocytes
expressing the Oatp1 mutants N62D, N124D, N135D, and N492D showed a molecular
mass band slightly smaller than the wild-type Oatp1 for all mutants
(Fig. 6A).
Taurocholate transport activity in oocytes expressing these individual mutants
was slightly less than that of wild-type Oatp1, but these differences were not
statistically significant (Fig.
6B). This suggests that all four predicted
N-glycosylation residues are glycosylated on Oatp1 and that no
individual glycosylation site is critical for expression and transport
activity.
|
Because no single N-glycosylation residue was critical for
function, various combinations of double and triple mutants were investigated
(Fig. 7), along with the
quadruple Oatp1 mutant N62/124/135/492D
(Fig. 8). The double and triple
mutants tested were as follows: N62/124D, N62/492D, N124/135D, N62/124/135D,
and N124/135/492D. Expression of these mutants was confirmed by Western
blotting (Figs. 7A and
8A). Transport
analysis revealed that the N124/135D mutant had a transport activity of
60% of wild-type Oatp1 and that N62/124D, N62/492D, N62/124/135D, and
N124/135/492D had transport activities of
1520% of wild-type Oatp1
(Fig. 7B). With the
quadruple Oatp1 mutant, Western blot analyses detected the mutant protein at
62 kDa in whole cell oocyte extracts
(Fig. 8A), but no
transport of taurocholate was detected
(Fig. 8B). These
results indicate that there are cumulative effects of mutating individual
N-glycosylation residues, leading to complete loss of Oatp1-mediated
taurocholate transport activity when all four N-glycosylation
residues are removed (Fig.
8A).
|
|
To examine whether N-glycosylation regulates the targeting of Oatp1 to the oocyte plasma membrane, the expression of wild-type Oatp1 and the N62/124/135/492D, N62/124/135D, and N124/135/492D mutants were analyzed in a crude plasma membrane fraction isolated from oocytes expressing these constructs. Immunoblot analysis showed that both the wild-type and most of the Oatp1 mutants were present in this membrane fraction (Fig. 9); however, the amount of the N62/124/135/492D mutant present in this subcellular fraction was significantly lower than the wild-type Oatp1 (Fig. 9), suggesting that this mutant is less efficiently inserted into the plasma membrane and may accumulate in intracellular compartments. In contrast, the amount of the triple mutants N62/124/135D and N124/135/492D present in this membrane fraction was comparable with the wild-type Oatp1 (Fig. 9), suggesting that only the quadruple Oatp1 mutant is defective in the translocation to the plasma membrane. Because minimal transport activity was detected in all of these mutants, N-glycosylation appears to control both the functional activity and the plasma membrane targeting of Oatp1.
|
To further characterize the effects of deglycosylation on the targeting and
transport activity of Oatp1, oocytes were treated with tunicamycin to inhibit
glycosylation. Tunicamycin treatment of oocytes decreased the Oatp1 molecular
mass to
62 kDa (Fig.
10A), a size comparable with the unglycosylated, in
vitro-translated Oatp1 (16)
and with the Oatp1 expressed in S. cerevisiae
(Fig. 1). Of significance,
tunicamycin treatment also reduced the Oatp1-mediated taurocholate transport
rate to
1525% of untreated oocytes
(Fig. 10B). However,
loss of transport activity was associated with the redistribution of the
protein away from the membrane-enriched subcellular fraction
(Fig. 10C),
suggesting that the deglycosylated protein was unable to reach the plasma
membrane.
|
Membrane localization of the mutant Oatp1 constructs was also examined by immunofluorescence, using FLAG epitope-tagged proteins. FLAG-tagged constructs of native Oatp1, N124/135/492D-Oatp1, and N62/124/135/492D-Oatp1 were synthesized, and functional activity of the constructs was assessed by measuring [3H]taurocholate uptake in oocytes (Fig. 11). As illustrated in Fig. 11, transport activity of the constructs was comparable with that of the untagged proteins (Fig. 7). Immunofluorescence analysis revealed a distinct membrane localization for Oatp1-FLAG and the triple mutant (N124/135/492D-Oatp1-FLAG), whereas the quadruple mutant (N62/124/135/492D-Oatp1-FLAG) provided only minimal staining of the plasma membrane (Fig. 12), confirming the immunoblot analyses illustrated in Figs. 9 and 10.
|
|
| DISCUSSION |
|---|
|
|
|---|
The expression of a functional mammalian protein in yeast is dependent on the yeast's ability to carry out the correct protein folding, posttranslational modifications, and targeting of the heterologous protein. The present results demonstrate that Oatp1 undergoes minimal posttranslational modifications in yeast and suggest that the absence of these modifications leads to a loss of transport function. This conclusion is consistent with that of several other studies that have shown a loss of functional activity in underglycosylated proteins. For example, Martinez-Maza et al. (26) reported a complete loss of activity of the glycine transporter GLYT2 when the glycosylated asparagine residues were removed via site-directed mutagenesis. The unglycosylated GLYT2 was retained in intracellular compartments when transiently expressed in COS-7 and MDCK cells (26), but the loss of activity of the unglycosylated GLYT2 was not directly related to its inability to reach the plasma membrane, as demonstrated by transport assays performed in artificial liposomes (26). Likewise, the deglycosylated human erythrocyte glucose transporter has diminished transport activity compared with the glycosylated protein (11). Transport mediated by the mouse organic anion transporter has been shown to be blocked by deglycosylation, but the loss of activity was due to the intracellular retention of the unglycosylated protein (22).
However, deglycosylation does not always abrogate function. For example, the unglycosylated rat GLUT-1 expressed in yeast was shown to be functional, but it exhibited some kinetic differences (1, 11). Similarly, the unglycosylated P-glycoproteins human multidrug resistance protein (MDR) 1 and mouse Mdr3 have been shown to be targeted to the plasma membrane and to be functionally active when expressed in the yeast Pichia pastoris (24, 37). The human multidrug resistance-associated protein (MRP) 1 (37) and the rat Mrp6 (6) have also been shown to be functional when expressed in the yeast P. pastoris, and the human CHIP28 water channel is functional when expressed in its unglycosylated form in S. cerevisiae secretory vesicles (23). The present study demonstrates that Oatp1 is not glycosylated in S. cerevisiae and that this transporter lacks functional activity.
The results from the X. laevis oocyte experiments provide direct evidence that N-glycosylation of Oatp1 modulates the function of this transporter and indicate that intracellular trafficking is also regulated by N-glycosylation. Preventing glycosylation with tunicamycin or by mutating the glycosylation sites nearly abolished the activity of Oatp1. Mutations to the four glycosylation sites on Oatp1 revealed that there was a cumulative effect on the function of Oatp1, leading to the total loss of activity when all glycosylation sites were removed. Interestingly, single N-glycosylation Oatp1 mutants retained most of their functional activity in oocytes, suggesting that no single glycosylation site on Oatp1 is crucial for expression and activity. However, there was a cumulative effect of removing additional glycosylation sites on Oatp1. Double and triple glycosylation site mutants appeared to be properly targeted to the plasma membrane but had significantly lower functional activity compared with wild-type Oatp1. On the other hand, the N62/124/135/492D Oatp1 mutant was present at lower amounts in the plasma membrane compared with the triple Oatp1 mutants and wild-type Oatp1, indicating that targeting to the plasma membrane was also defective. Of course, it is important to acknowledge that the loss of functional activity observed in the mutants may also have been due to the changes in amino acid sequence and not necessarily to the deglycosylation per se. However, our results with the yeast expressing the native underglycosylated Oatp1 and in oocytes treated with tunicamycin would argue that loss of glycosylation is sufficient to impair function.
Although Oatp1 expressed in X. laevis oocytes is functional and
appears to be partially glycosylated, it has a lower molecular mass than the
Oatp1 present in rat liver membranes. This may be due to differences in
terminal N-glycosylation between rat hepatocytes and Xenopus
oocytes (32). For example,
previous studies demonstrated that Oatps generally display decreased apparent
molecular mass when expressed in oocytes
(8). The type of carbohydrate
and the degree of branching of N-linked oligosaccharides is known to
depend on cell type (reviewed in Refs.
15 and
29). For example, the human
OATP8 is present as a 125-kDa protein in the basolateral membrane of the human
liver, but in HepG2 cells (a human liver-derived cell line) it displays a
molecular mass of only
90 kDa
(19).
The precise role that glycosylation plays in the functional expression of
Oatp1 is not known. At the functional level, the presence of the carbohydrate
moieties on the asparagine residues may promote the formation of an active
protein conformation or may aid in substrate recognition. It is interesting to
note that the ability of the immune system to recognize a vast array of
different antigens is due in part to the diversity in the
N-glycosylation of receptors (reviewed in Refs.
33 and
34). On the basis of this
information, it is conceivable that a transport protein expressed in different
cell types may have subtle or significant differences in protein activity.
Interestingly, Oatp1 has been shown to undergo differential processing in the
liver and kidney (5), although
the functional consequences of these differences among organs is unknown. In
addition, the human OATP2 (also known as LST-1 and OATP-C) is present as both
a glycosylated (
84 kDa) and an unglycosylated (
58 kDa) protein in
the basolateral membrane of the liver
(20), but the functional
significance of this is not yet known.
In conclusion, the yeast secretory vesicle expression system is an important model for studying membrane transporters, but the expression of a heterologous protein can be hindered if the protein of interest requires extensive posttranslational processing. The present study demonstrates that N-glycosylation plays an important role in the functional activity and trafficking of Oatp1.
| DISCLOSURES |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
P. Wang, S. Hata, Y. Xiao, J. W. Murray, and A. W. Wolkoff Topological assessment of oatp1a1: a 12-transmembrane domain integral membrane protein with three N-linked carbohydrate chains Am J Physiol Gastrointest Liver Physiol, April 1, 2008; 294(4): G1052 - G1059. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Pelis, W. M. Suhre, and S. H. Wright Functional influence of N-glycosylation in OCT2-mediated tetraethylammonium transport Am J Physiol Renal Physiol, May 1, 2006; 290(5): F1118 - F1126. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |