AJP - GI Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 286: G51-G59, 2004. First published June 19, 2003; doi:10.1152/ajpgi.00169.2002
0193-1857/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/1/G51    most recent
00169.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McLaughlin, J. T.
Right arrow Articles by Wang, T. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McLaughlin, J. T.
Right arrow Articles by Wang, T. C.

HORMONES AND SIGNALING

PACAP and gastrin regulate the histidine decarboxylase promoter via distinct mechanisms

John T. McLaughlin,1 Wandong Ai,2 Natalie F. Sinclair,2 Rocchina Colucci,3 Raktima Raychowdhury,3 Theodore J. Koh,2 and Timothy C. Wang2

1Gastrointestinal Sciences, University of Manchester, Hope Hospital, Salford, M6 8HD United Kingdom; 2Division of Digestive Diseases and Nutrition, University of Massachusetts Memorial Medical Center, Worcester 01605; and 3Gastrointestinal Unit, Massachusetts General Hospital, Boston, Massachusetts 02114

Submitted 9 May 2002 ; accepted in final form 3 June 2003


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
The enterochromaffin-like (ECL) cell controls gastric acid secretion via histamine, generated by L-histidine decarboxylase (HDC). HDC expression is regulated by gastrin. However, gastrin is not alone in controlling ECL cell function. For example, the neural peptide pituitary adenylate cyclase-activating polypeptide (PACAP) also increases ECL cell proliferation. To investigate a potential role of PACAP in regulating HDC expression, we generated a series of HDC promoter-luciferase reporter constructs and transiently transfected them into PC12 cells (stably expressing the gastrin-CCK-2 receptor). We found that PACAP regulates HDC promoter activity. This is temporally biphasic, involving both adenyl cyclase and phospholipase C-dependent pathways. Deletional analysis, block mutation, and EMSA demonstrated a PACAP-response element at -177 to -170, wholly necessary for the effects of PACAP and discrete from known gastrin-responsive elements. Discrete neural and endocrine pathways regulate ECL cells through different patterns of postreceptor signaling and promoter activation, which may be appropriate to their functions in vivo.

histamine


THE ENTEROCHROMAFFIN-LIKE (ECL) cell of the gastric fundic mucosa plays an important role in the regulation of acid secretion through the production and release of histamine. Histamine stimulates parietal cells to secrete acid by binding to the histamine (H-2) receptor expressed on their surface (13). The importance of histamine in acid secretion has been borne out with the development and usage of H-2 receptor antagonists that effectively block acid secretion.

Histamine is generated through the action of L-histidine decarboxylase (HDC). The best characterized stimulus of HDC gene expression and activity is the peptide hormone gastrin (7, 14). Gastrin acts as a ligand for the CCK-2 receptor on ECL cells, resulting in the release of histamine (30, 33) and increased HDC production, in part through upregulation of HDC gene expression. It has been shown that binding of gastrin to its receptor, CCK-2, results in activation of the PKC signaling pathway, resulting in increased transcription of HDC (42). This requires binding of at least three, as yet unidentified, distinct nuclear transcription factors to the +1 to +48 regions of the HDC promoter (31).

However, it would appear that gastrin is not the sole stimulus of ECL cell-induced acid secretion or proliferation, and several other mediators are likely to contribute in vivo. Supporting evidence for this includes the incomplete acid suppression observed following the administration of gastrin/CCK-2 receptor antagonists (33) and recent observations in gastrin/CCK-2 receptor and gastrin peptide gene knockout mice, which display reduced but not abolished acid secretion in response to feeding. (9, 19). Both knockout models retain ECL and parietal cells but in reduced numbers.

It is likely that another significant mechanism governing HDC expression and acid secretion is neural in origin. It has long been recognized that the neural system plays a significant role in acid secretion, mainly through the activation of vagal pathways (34). Additionally, it has been shown that administration of atropine and/or vagotomy can significantly reduce acid secretion in response to both gastric distension and peptone, independent of gastrin and histamine (23, 28). Cholinergic agonists can cause histamine and acid release in vivo whether centrally or peripherally mediated (13, 39), whereas unilateral vagotomy is associated with an ipsilateral decrease in ECL cell number, even in the face of secondary hypergastrinemia (1). However, most ECL cells do not express cholinergic receptors, and the cholinergic agonist carbachol is not associated with a rise in intracellular calcium in studies of primary ECL cells (22, 30, 41). Therefore, alternative neurotransmitters must be implicated.

Recent evidence suggests that pituitary adenylate cyclase-activating polypeptide (PACAP), a member of the VIP family of peptides, may be the neurotransmitter affecting ECL cell function. In the stomach, PACAP immunoreactive fibers have been shown to innervate the gastric mucosa (10), and PACAP fibers have also been identified in cultured vagal neurons (32). In addition, the ECL cell has been shown to express a PACAP receptor, PAC1 (40).

Originally isolated from the ovine hypothalamus (24), PACAP is a widely expressed neuropeptide and has been shown to regulate the function of endocrine tissues that operate under neuronal modulation (e.g., pituitary, adrenal medulla, pancreatic islets, pineal gland). (11, 25, 26). It exists in two forms, PACAP-38 and PACAP-27, which are derived from a common precursor (38), with the longer form being more abundant in the gut (21, 35). PACAP acts as a ligand to a subfamily of seven transmembrane G-coupled protein receptors, including the PACAP-preferring (PAC1) receptor and receptors that bind with equal affinity to VIP and PACAP (VPAC1 and 2) (38). Binding of PACAP to PAC1 has been shown to activate both the adenylate cyclase/protein kinase A and phospholipase C/protein kinase C pathways, differentially coupling to Gs or Gq protein subunits, respectively (18, 38).

PACAP stimulation of PAC1 in purified rat gastric ECL cells has also been shown to induce histamine secretion via an influx of intracellular calcium (40). Hence, it is possible, as occurs with gastrin to replenish just-secreted histamine, that PACAP will activate the HDC gene. Initial studies looking at peripheral infusion of PACAP failed to demonstrate significant increases in acid secretion (27). However, coinfusion of somatostatin-neutralizing antibodies reveals that PACAP can induce acid secretion (40), probably because PACAP also elicits counterregulatory somatostatin secretion from D cells. Hence, the effects of PACAP on ECL cells reported to date broadly resemble those of gastrin and indeed may account for residual ECL properties when functional gastrin is absent.

Interestingly, activation of PAC1 by PACAP has also been associated with a marked increase in proliferative response in isolated rat ECL cells (20). Given that the effects of gastrin-receptor activation on ECL cells seem to be mediated by the PKC-signaling pathway (15, 16, 42), it is also possible that PACAP could modify gastrin responses in ECL cells, such as HDC gene expression.

To clarify the role of PACAP on HDC gene expression and how it may compare with gastrin-induced HDC expression, we have defined the signaling pathways and cis-regulatory element involved in PACAP regulation of the HDC promoter. Because no gastric endocrine cell line is currently available, these studies were undertaken using the PACAP receptor-expressing, neuroendocrine (and aminergic) cell line PC12, derived from rat adrenal chromaffin tissue, and these were additionally stably transfected with the gastrin/CCK-2 receptor. These experiments reveal that PACAP does regulate the HDC promoter through activation of both adenyl cyclase and PKC-dependent pathways. We also find that PACAP appears to act on a different promoter element than gastrin, and we speculate about their relative functional significance.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
Plasmids. As previously reported (15, 42), a human HDC promoter fragment, containing ~1.8 kb of 5'-flanking DNA and 126 nucleotides of the noncoding first exon, was amplified by PCR and ligated into the promoterless pXP2 vector upstream of the firefly luciferase gene. A series of human HDC promoter 5'-deletion constructs (hHDC-luciferase) containing 800, 400, 180, 125, and 47 consecutive nucleotides upstream of the start site as well as the first 126 nucleotides of the noncoding first exon were made by PCR amplification of segments from the human HDC promoter, using the 1,800-nucleotide promoter template and ligated into pXP2. Additional heterologous promoter constructs containing various amounts of the human HDC promoter and noncoding first exon were generated by insertion of the relevant PCR-generated or annealed oligonucleotide segments upstream of the herpes simplex virus thymidine kinase promoter of the pT81 vector. Mutant promoter constructs were generated through PCR mutagenesis and then cloned into either pXP2 or pT81. All pXP2 and pT81 constructs were checked by restriction digests for the correct length of promoter segments and then confirmed by sequencing. Plasmids were grown in DH-5{alpha} E. coli and purified on Qiagen columns for transfection (Qiagen, Chatsworth, CA).

Cell culture and transfection studies. PC12-gastrin (GAS) cells were derived from PC12 cells through stable transfection of the expression vector pEF1{alpha}-CCKB (gift of R. Xavier, Massachusetts General Hospital, Boston, MA), which expresses the full-length human gastrin/CCK-2 receptor mRNA. Stably transfected cells were initially selected in puromycin (1 mg/ml in complete medium). Functional receptor expression was confirmed by responsiveness of the 1.8-kB HDC-luciferase promoter to amidated gastrin, which has no effect in wild-type (WT) PC12 cells. The clone exhibiting the greatest gastrin response was used in subsequent experiments.

PC12-WT and PC12-GAS cells were grown in high-glucose Dulbecco's modified Eagle's medium (BioWhittaker, Walkersville, MD) containing 10% horse serum, 5% fetal bovine calf serum, 100 IU/ml penicillin, and 100 µg/ml streptomycin in a humidified atmosphere (5% CO2-95% air). Transient transfections of cultured cells were carried out using the lipofection technique in accordance with the manufacturer's instructions (Lipofectamine transfection kit, Life Technologies, Gaithersburg, MD). Cells were plated in 35-mm wells and transfected the next day at ~30% confluence with 0.25–0.5 µg plasmid/well. On the following morning, medium was replaced with serum-free Ultraculture medium (BioWhittaker) to minimize preexperimental basal exposure to putative regulatory peptides. On the second day posttransfection, stimulation was carried out using a variety of receptor-dependent and independent agonists. PACAP-27 or -38, VIP (Sigma, St. Louis, MO), sulfated gastrin-17, and VIP-27 (Peninsula Laboratories, San Diego, CA), forskolin, and PMA (BIOMOL Research Laboratories, Plymouth Meeting, PA) were added at the appropriate concentrations as stated, and incubation was then continued for the times denoted below. Incubations were performed in triplicate or quadruplicate, and results were calculated as the means ± SE. Where required, antagonist agents were added for preincubation 1 h before stimulation. Purchased antagonists were H-7 (PKC and A antagonist), PD-98059 (MEK1 inhibitor, New England Biolaboratories, Beverly, MA), and H-89 (predominant PKA antagonist, Calbiochem, San Diego, CA). Cells were harvested after relevant time periods, using commercial lysis buffer for luciferase assays after gentle washing with PBS (Promega, Madison, WI).

Luciferase assays were performed using luciferin, ATP, and coenzyme A (Promega, Madison, WI) with a Monolight Luminometer 3010C (BD, Franklin Lakes, NJ) as described previously (31). Values for HDC-luciferase activity were expressed as fold increases in luciferase activity compared with untreated controls. The Rous sarcoma virus-luciferase and pT81-luciferase constructs, in which the luciferase gene is driven by the Rous sarcoma virus promoter or enhancerless herpes simplex thymidine kinase promoter, respectively, served as additional controls. Activities given represent the means ± SE of at least three independent transfections.

EMSA. Nuclear extracts were obtained from semiconfluent PC12-GAS cells, either before or after 24 h stimulation with PACAP (10-7 M) or gastrin (10-7 M) as previously described (42). Briefly, 10 µg of nuclear extract protein were incubated with an [{alpha}-32P]dCTP end-labeled double-stranded oligonucleotide probe of interest in a buffer containing (in mM) 10 Tris-Cl (pH 7.5), 50 NaCl, 5 MgCl2, 1 dithiothreitol, and 1 EDTA, with 1 µg poly(dA-dT) and 10% glycerol with a final volume of 20 µl for 20 min at room temperature. The resulting DNA-protein complexes were then run on a 6% nondenaturing polyacrilamide gel containing 0.25x Tris borate/EDTA buffer at a constant current of 15 mA.

For competition experiments, the nuclear extracts were incubated with 100-fold excess of competitor double-stranded oligonucleotides at room temperature for 10 min before the addition of the radiolabeled probe. For supershift experiments, the nuclear extracts and antibodies were incubated for 10 min at room temperature followed by a 30-min incubation at 4°C before the addition of the radiolabeled probe. Anti-CREB antibody, CRE, and mutant CRE oligonucleotides were purchased from Santa Cruz Biotechnology.

Statistical analysis. Statistical analysis was performed using Minitab software, employing the Mann-Whitney U test for this non-parametric data.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
The human HDC promoter is responsive to PACAP in PC12-WT and to PACAP and gastrin in PC12-GAS cells. To establish that PACAP has a stimulatory effect on the activity of the human HDC promoter, the 1.8-kb hHDC-luciferase construct was transiently transfected into PC12-WT cells, which are known from previous functional studies and RT-PCR evidence to express the PACAP-preferring receptor PAC1 (4). After 24 h of stimulation, PACAP-27 and -38, but neither VIP nor gastrin, produced an increase in luciferase activity in keeping with the anticipated functional expression of the PAC1 receptor, but not VPAC1, VPAC2, or the CCK-2 receptor (Fig. 1A). PACAP responsiveness was dose and time dependent (Fig. 1, B and C). The 1.8-kb hHDC-luciferase construct could also be stimulated by the receptor-independent agonists PMA and forskolin, suggesting that both activation of PKC- and PKA-dependent signaling pathways can mediate stimulation of the HDC promoter (Fig. 1, A and C).



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. Pituitary adenylate cyclase-activating polypeptide (PACAP) stimulates L-histidine decarboxylase (HDC) promoter activity. A: PACAP-38, PACAP-27, VIP, gastrin, PMA (all 10-7 M), or forskolin (FORSK; 10-4 M) were added to PC-12 wild-type (WT) cells transiently transfected with a 1.8-kb HDC-luciferase reporter expression construct for 24 h. The results are expressed as fold increase over unstimulated cells transiently transfected with the 1.8-kb HDC-luciferase reporter expression construct, and they represent the mean of at least 3 independent experiments. (*P < 0.05). B: various doses of PACAP-38 were added to PC-12 cells transiently transfected with a 1.8-kb HDC-luciferase reporter expression construct for 24 h. The results represent the mean of at least 3 independent experiments. C: PACAP-38 (10-7 M), PMA (10-7 M), or forskolin (10-4 M) were added to PC12-WT cells transiently transfected with a 1.8-kb HDC-luciferase reporter expression construct for the times shown. (d) PACAP-38 (10-7M), gastrin (10-7 M), or a combination of PACAP-38 + gastrin were added to cells stably transfected with the CCK-2R (PC-12-GAS), transiently transfected with a 1.8-kb HDC-luciferase reporter expression construct for the times shown.

 

The human HDC promoter has previously been shown to be gastrin responsive in the gastric cancer cell line, AGS, which has been stably transfected with the gastrin/CCK-2 receptor (denoted AGS-B) (42), and this effect is reconstituted in PC12-GAS cells following the stable transfection of the same receptor (Fig. 1D). Gastrin induces a two- to threefold response at 16–24 h in PC12-GAS cells, broadly comparable with the threefold response previously described in AGS-B cells. Furthermore, PACAP responsiveness is increased in the used PC12-GAS clone (4-fold at 24 h) compared with the PC12-WT cells (~2-fold at 24 h; Fig. 1A), so PC12-GAS cells were used for all subsequent detailed studies of promoter activation and signal transduction.

Interestingly, in time course studies of the effects of PACAP-38, gastrin, or both peptides in PC12-GAS, both peptides exhibited a biphasic time course. This was also observed for PACAP and forskolin but not PMA in PC12-WT cells (Fig. 1C). In PC12-GAS cells, PACAP-38 elicits a more clearly biphasic response, with a rise in luciferase activity becoming detectable at 2 h and attaining an initial peak of an approximately fivefold increase at 4–6 h. Despite continued incubation with PACAP, luciferase activity transiently falls at 8–16 h (3-fold at trough), then rises to a smaller (~4-fold) secondary peak at 24 h. The time course of the effect of gastrin mirrors this biphasicity to some extent, but in contrast, its initial effect at 4–6 h is relatively small and slower in onset (2.5-fold), with the major peak (~3.5-fold) occurring at 16 h. Importantly, the time taken to achieve peak luciferase activity in response to gastrin in PC12-GAS cells corresponds to that observed previously in gastric AGS cells (42). Costimulation with both PACAP-38 and gastrin produced no significant potentiation of either peak effect.

Multiple signaling pathways contribute to the effects of PACAP and gastrin on hHDC promoter activity. It has been previously shown that the effect of gastrin on the human HDC promoter can be entirely blocked by antagonism or downregulation of the protein kinase C/MAP kinase signaling pathways in nonaminergic AGS-B cells (15, 42). Also, as noted above, receptor-independent PKA and PKC activation by forskolin and PMA, respectively, stimulate the HDC promoter in PC12 cells (Fig. 1C). Because the effect of PACAP-38 and, to a lesser extent, gastrin exhibited a biphasic time course, and PACAP-induced activation of the PAC1 receptor can activate both the PKA- and PKC-dependent pathways (18, 38), cells were pretreated with various inhibitors to evaluate relative contributions to the effects observed. Interestingly, the initial peak in response to PACAP, gastrin, or both was abolished by the mixed antagonist H-7, but H-7 had no significant inhibitory effect on the secondary peak in response to either agonist (Fig. 2, A and B). Results obtained by more specific PKC downregulation produced by 24-h preincubation with PMA further suggested that PKC was more important for the early peak than for the later peak (Fig. 2, C and D). The more specific PKA inhibitor H-89 fully abolished the secondary peak response to PACAP and gastrin (Fig. 2, E and F). Additionally, the phosphatidylinositol 3-kinase inhibitor wortmannin had no inhibitory effect on either PACAP or gastrin-induced HDC expression (data not shown).



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 2. The role of PKC and PKA signaling pathways in PACAP- and gastrin-induced stimulation of the HDC promoter. A: PACAP-38 (P38; 10-7 M), gastrin (GAS; 10-7 M), or both PACAP-38 and gastrin (P38 + GAS) were added to PC-12-GAS cells after 1 h preincubation with the nonspecific protein kinase antagonist H7 (100 µM). Cells were harvested after 4 h, and luciferase assays were performed. The results are expressed as %inhibition, and they represent the mean of at least 3 independent experiments. B: an identical experiment was performed with the cells harvested after 24 h of stimulation. C: P38 (10-7 M), GAS (10-7 M), or P38 + GAS were added to PC-12-GAS cells after 24-h preincubation with the PMA (10-6 M) to chronically specifically downregulate PKC family members. Cells were harvested after 4 h, and luciferase assays were performed. D: an identical experiment was performed, with the cells harvested after 24 h of stimulation in the continued presence of PMA. E: P38 (10-7 M), GAS (10-7 M), or P38 + GAS were added to PC-12-GAS cells after 1 h preincubation with the antagonist H89 (20 µM), which is more selective for PKA at this concentration. Cells were harvested after 4 h. F: an identical experiment was performed, with the cells harvested after 24 h of stimulation.

 

Because PKC activation is known to lead to MAP kinase pathway activation via ERK and MEK1 in the gastrin-mediated effect on hHDC-luc in AGS-B cells (15), the effect of the MAP kinase (MEK1) inhibitor PD-98059 was also studied. PD-98059 had a marked inhibitory effect on the early response to gastrin but was only partially inhibitory to the initial effect of PACAP. PD-98059 had no inhibitory effect at 24 h; interestingly, it appeared to potentiate the effect of PACAP at this time point (Fig. 3, A and B).



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 3. The role of MEK1 in PACAP and gastrin-induced stimulation of the HDC promoter. A: P38 (10-7 M), GAS (10-7 M), or P38 + GAS were added to PC-12-GAS cells after 1 h preincubation with the MEK1 antagonist PD-98059 (10-5 M). Cells were harvested after 4 h, and luciferase assays were performed. The results are expressed as %inhibition, and they represent the mean of at least 3 independent experiments. B: an identical experiment was performed with the cells harvested after 24 h of stimulation.

 

Deletion analysis of the hHDC sequences responsible for the transcriptional responses to PACAP. Because the PKA- and PKC-mediated transcriptional effects initiated by PACAP and gastrin display key differences in their timing and magnitude, it was considered unlikely that they would act on identical cis-acting elements in the hHDC promoter. To identify the cis-acting DNA sequences involved in the transcriptional response to PACAP, deletion analysis of the hHDC promoter was undertaken. An initial series of 5'-deletion constructs, all known to be gastrin responsive in AGS cells and containing 800, 400, 180, 125, or 47 bp of 5'-flanking DNA plus 126 bp of the noncoding first exon were transfected into PC12-WT cells. As in AGS cells, the -47-luc construct lacked basal promoter activity. The others were all responsive to PACAP-38 (Fig. 4). A fall in PACAP responsiveness was noted between -180 and -125 bp.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 4. The PACAP response element lies between -400 and -125. Serial HDC promoter, luciferase reporter deletion constructs were generated and transiently transfected into PC12-WT cells. They were then stimulated with P38 (10-7 M) for 24 h, and luciferase activity was determined. The results are presented as fold increase compared with unstimulated cells: 2 constructs were significantly more responsive (P < 0.05). The results represent the means of at least 3 independent experiments.

 

Gastrin responsiveness of the hHDC promoter occurs via entirely PKC/ERK-dependent pathways in AGS cells (15, 16, 42) and has been assigned to at least three cis-acting gastrin-response elements (GAS-RE) in the +1 to +48 region of the noncoding first exon (31). In our studies, the appropriate -125-hHDC 5'-deletion construct transfected into PC12-GAS cells exhibited similar gastrin responsiveness to the 1.8-kb full-length promoter (data not shown), while lacking full PACAP responsiveness (Fig. 4). In keeping with this, a series of smaller hHDC promoter fragments containing this gastrin-responsive 5'-untranslated region were ligated into the construct pT81 upstream of the enhancerless thymidine kinase promoter. These constructs lacked responsiveness to either PACAP-38 or forskolin (Fig. 5, A and B) when expressed in PC12 cells, whereas a positive control sequence containing all the putative overlapping GAS-REs (-47 to +126) exhibited appropriate responsiveness to PMA (Fig. 5C). Hence, it appears that the PKA-dependent component of the PACAP response is upstream of the -125 to -47 region of the HDC promoter and is independent of the PKC response elements that are known to be activated by gastrin (31).



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 5. The gastrin-response element does not mediate PACAP responsiveness. Various regions of the HDC promoter were cloned into the enhancerless expression construct pT81 and were transiently transfected into PC-12GAS cells. They were then stimulated with PACAP-38 (10-7 M; A), forskolin (10-4 M; B), or PMA (10-7 M; C) for 24 h, and luciferase activity was determined. The results are presented as fold increase compared with unstimulated cells. The results represent the mean of at least 3 independent experiments.

 

A putative element in the PKA component of the transcriptional response. PKA-mediated transcriptional responses most frequently operate via c-AMP-dependent activation of CREB, which binds to a CRE box in the promoter: for example, the chromogranin A promoter, which is PACAP responsive in PC12 cells (36). Deletion analysis demonstrated that peak activity between -400 and -125 bp and a CRE-comparable, but not quite canonical, palindrome (CCTGCAGG), is present at -177 to -170 bp in the 5'-flanking sequence of the promoter. An additional similar element is present at -46 to -39 (CCTGGAGG), but 5'-deletion down to this point does not support basal promoter activity. A further deletion construct was made starting at -180, as well as an identical construct where the -177 CCTGCAGG -170 region was mutated to -177 TTTCAAGG -170. The WT -180 construct retained PACAP responsiveness, whereas the mutant construct (HDC180M) lost PACAP responsiveness at 24 h (Fig. 6A).



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 6. The area of PACAP responsiveness lies between -177 and -170 on the HDC promoter. A: an HDC-luciferase expression construct containing 180 bp of the WT HDC promoter in pXP2 (HDC 180, as Fig. 5) and an HDC-luciferase construct of the same length with a mutation in the -177 to -172 region also in pXP2 (-177 CCTGCAGG -170 mutated to -177 TTTCAAGG -170, denoted HDC180M) were employed. Additionally, heterologous promoter constructs were made where either the WT -180 to -165 region of the HDC promoter (HDC180–165) or the above mutant sequence (HDC180–165M) was cloned into the enhancerless expression construct pT81. These were transiently transfected into PC-12GAS cells. They were all then stimulated with PACAP-38 (10-7 M) for 24 h, and luciferase activity was determined. The results are presented as fold increase compared with unstimulated cells. The results represent the mean of at least 3 independent experiments. B: an identical experiment was performed but with the cells harvested after 4 h of stimulation. C: electromobility shift assays were performed using the -180 to -165 region as a probe (WT) in the presence of 200-fold excess of the WT or the above mutant sequence (mut) competitor or of an antibody to CREB. D: electromobility shift assays were performed using a consensus CRE sequence and competed with a 200-fold excess of either the -180 to -165 region of WT PRE (as above), a mutant PRE (PREM, as above), WT CRE, or mutant CRE (CREBM) as competitor. Finally, the anti-CREB antibody, which failed to supershift the PRE band, was appropriately effective in supershifting the CRE band.

 

The region between -180 and -165 on the hHDC promoter was then subcloned into the enhancerless PT81 luciferase construct and conferred PACAP responsiveness (Fig. 6A). A further PT81 construct (HDC180–165M) mutating the -177 to -170 region (-177 TTTCAAGG -170) also lost PACAP responsiveness (Fig. 6A). Similar results were obtained with each of these constructs after 4 h of PACAP stimulation (Fig. 6B).

EMSAs were then performed using the -180 to -165 region as a PACAP-response element (PRE) probe. This revealed that nuclear protein(s) obtained from nuclear extracts from PACAP-stimulated PC12-GAS cells bound to this region (Fig. 6C). Additionally, the binding of nuclear proteins to the WT probe could be blocked by addition of cold WT competitor but not by cold mutant inhibitor (Fig. 6C). Addition of an anti-CREB antibody did not result in a supershift, suggesting that CREB is not the transcription factor involved in binding the PRE. These data are supported by a further EMSA that demonstrated that the antibody appropriately supershifts a band representing a CRE-consensus sequence oligonucleotide incubated with nuclear extract from PACAP-stimulated cells (Fig. 6D). Moreover, binding to the CRE probe (AGAGATTGCCTGACGTCAGAGAGCTAGTGACGTAA) could be competed away from nuclear extract proteins using an excess of WT cold CRE but not by PRE nor by mutants of either CRE or PRE, denoted CREM (AGAGATTGCCTGTGGTCAGAGAGCTAGTGACGTAA) and PREM (oligonucleotide as in HDC180–165M above; Fig. 6D). Together, these data demonstrate that the PRE is clearly not a CRE.


    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
In this paper, we show that PACAP causes an increase in HDC gene promoter activity in a dose- and time-dependent manner, and we demonstrate that this regulation uses wholly different promoter elements and partly differing signaling pathways to those employed by gastrin.

PACAP can stimulate HDC gene expression through both PKA- and PKC-dependent signaling pathways, as has been shown for other PACAP-mediated events (2, 5, 6, 29). This likely reflects the fact that the PAC1 receptor is pleomorphic, coupling to different heterotrimeric G protein assemblies to allow parallel activation of both PKA- and PKC-dependent signal-transduction cascades (18).

Activation of both the PKC- and PKA-dependent pathways by PACAP results in stimulation of HDC gene promoter activity by 4–6 h, with a second peak of HDC gene expression seen at 24 h. Whereas the early activation of HDC gene expression can be blocked by either H89 or H7 or by chronic PKC downregulation, only the relatively specific PKA antagonist H89 can fully inhibit the late persistence of HDC promoter activation. Given that any of the inhibitors alone blocks the early response, it is clear that early crosstalk exists between signaling cascades, perhaps particularly predictable if simultaneously coactivated by a pleomorphic receptor such as PAC1 and as previously demonstrated by others (12). However, this also appears to be true for gastrin, but important differences from PACAP remain. In particular, data obtained using the specific MEK1 inhibitor PD-98059 show that the late persistent effect of PACAP is, in part, counterbalanced by subsequent tonic inhibition following ERK activation, but it appears that that gastrin does not recruit this particular mechanism. In keeping with this, it has been noted that Ras exerts a tonic negative effect in time and magnitude on both adenyl cyclase and phospholipase C pathways in other aspects of PC12 cell function, which is overcome by PACAP stimulation (29). The situation is further complex, because cAMP-elevating agents have been shown to induce MAP kinase phosphatase-1 in PC12 cells (3).

Serial HDC promoter deletion constructs have identified a palindromic cis-acting regulatory element at -177 CCTGCAGG -170 that mediates PACAP responsiveness. Mutation of this region abrogated PACAP responsiveness, and subcloning of this region into a heterologous thymidine kinase minimal promoter conferred PACAP responsiveness. EMSA revealed that nuclear transcription factor(s) can bind this region in PC12-GAS cells. However, an anti-CREB antibody failed to affect the binding of nuclear proteins to the PRE, suggesting that the nuclear transcription factor involved in mediating PACAP responsiveness is not CREB. This is reminiscent of results recently reported with gastrin stimulation of Cre elements that are not dependent on binding of known CREB family members (37).

These results are in contrast with our prior studies elucidating the three GAS-REs located in the +1 to +48 region of the first nontranslated exon of HDC previously reported and activated via PKC in AGS cells. The -125 hHDC-luc construct and the specific GAS-RE promoter elements remain gastrin and PKC responsive in PC12 cells, but, pivotally, they do not confer any responsiveness to PACAP or forskolin at 24 h, entirely in agreement with the other data. Hence, the current data demonstrate the presence of separate cis-acting elements targeted by PKA and PKC, respectively, perhaps underpinning, in part, the biphasic time course observed.

Both PKC and PKA have been implicated in the regulation of multiple genes with effects on growth, differentiation, and proliferation (12). The CGRP promoter has been shown to have discrete elements on which parallel PKA and MEK1-dependent pathways act, which would be activated by different membrane receptors in PC12 cells (8). Recent data have also suggested that a composite effect of PKA and PKC may reduce apoptosis (17).

Another novel point raised by our study is that the late response in gastrin induction of the HDC promoter is also PKA dependent. Prior studies looking at gastrin induction of the HDC promoter via PKC did not assess the effect of PKA inhibitors (15, 16, 31). However, recently, it has been shown that gastrin can induce the PKA pathway in AR4–2J cells and in so doing can stimulate CRE-promoter elements (37); although as in our study, the as yet unidentified transcription factor involved is not a known member of the CREB family of transcription factors.

The induction of HDC gene promoter activity by PACAP further solidifies its important role in ECL cell function. The activation of the PKA-signaling pathway by PACAP may be important in cellular differentiation. It has been reported that PACAP-induced PKA activation results in a more differentiated phenotype in PC-12 cells (6) and PACAP-enhanced BrdU incorporation with ~100-fold greater potency than amidated gastrin in dispersed Mastomys ECL-cells (20).

Thus we show that PACAP is an important peptidergic stimulus for a key regulated ECL cell function, resulting in an almost two-fold greater stimulation of HDC gene expression than does gastrin in our new model. This may reflect the added value of adopting an aminergic endocrine cell line as a model. These findings, coupled with the fact that PACAP results in much higher proliferation rates in ECL cells than does gastrin (20), would support the notion that PACAP is an important regulator of the long-term maintenance of a differentiated and functional ECL cell population. PACAP could indeed be the neurotransmitter substrate for the vagal contribution to ECL physiology. Gastrin may normally be more simply linked to the transient effects of a meal, although playing a different role in persistent hypergastrinemia (14).

In summary, the neural influences exerted on ECL secretory function and proliferation are likely to be mediated by PACAP, and the effects of PACAP on HDC expression are both complementary to and distinct from those of gastrin.


    DISCLOSURES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 
This study was supported by grants from National Institute of Diabetes and Digestive and Kidney Diseases to T. J. Koh (K08 DK-02545–05 and R03-DK60225–02) and T. C. Wang (5 RO1 DK-48077–06). J. T. McLaughlin was supported by a United Kingdom MRC traveling fellowship and by the Digestive Disorders Foundation's first Senior Clinical Fellowship.


    FOOTNOTES
 

Address for reprint requests and other correspondence: T. C. Wang, Gastroenterology Division, Gladys Smith Martin Professor of Medicine, Univ. of Massachusetts Medical Center, Lazare Research Bldg., Rm. 208, 364 Plantation St., Worcester, MA 01605–2324 (E-mail: Timothy.Wang{at}UMassmed.Edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 DISCLOSURES
 REFERENCES
 

  1. Axelson J, Ekelund M, Hakanson R, and Sundler F. Gastrin and the vagus interact in the trophic control of the rat oxyntic mucosa. Regul Pept 22: 237-243, 1988.[CrossRef][Web of Science][Medline]
  2. Barrie AP, Clohessy AM, Buensuceso CS, Rogers MV, and Allen JM. Pituitary adenylyl cyclase-activating peptide stimulates extracellular signal-regulated kinase 1 or 2 (ERK1/2) activity in a Ras-independent, mitogen-activated protein kinase/ERK kinase 1- or 2-dependent manner in PC12 cells. J Biol Chem 272: 19666-19671, 1997.[Abstract/Free Full Text]
  3. Burgun C, Esteve L, Humblot N, Aunis D, and Zwiller J. Cyclic AMP-elevating agents induce the expression of MAP kinase phosphatase-1 in PC12 cells. FEBS Lett 484: 189-193.
  4. Cavallaro S, D'Agata V, Guardabasso V, Travali S, Stivala F, and Canonico PL. Differentiation induces pituitary adenylate cyclase-activating polypeptide receptor expression in PC-12 cells. Mol Pharmacol 48: 56-62, 1995.[Abstract]
  5. Corbitt J, Vivekananda J, Wang SS, and Strong R. Transcriptional and posttranscriptional control of tyrosine hydroxylase gene expression during persistent stimulation of pituitary adenylate cyclase-activating polypeptide receptors on PC12 cells: regulation by protein kinase A-dependent and protein kinase A-independent pathways. J Neurochem 71: 478-486, 1998.[Web of Science][Medline]
  6. Deutsch PJ and Sun Y. The 38-amino acid form of pituitary adenylate cyclase-activating polypeptide stimulates dual signaling cascades in PC12 cells and promotes neurite outgrowth. J Biol Chem 267: 5108-5113, 1992.[Abstract/Free Full Text]
  7. Dimaline R and Sandvik AK. Histidine decarboxylase gene expression in rat fundus is regulated by gastrin. FEBS Lett 281: 20-22, 1991.[CrossRef][Web of Science][Medline]
  8. Freeland, K, Liu YZ, and Latchman DS. Distinct signalling pathways mediate the cAMP response element (CRE)-dependent activation of the calcitonin gene-related peptide gene promoter by cAMP and nerve growth factor. Biochem J 345: 233-238, 2000.
  9. Friis-Hansen L, Sundler F, Li Y, Gillespie PJ, Saunders TL, Greenson JK, Owyang C, Rehfeld JF, and Samuelson LC. Impaired gastric acid secretion in gastrin-deficient mice. Am J Physiol Gastrointest Liver Physiol 274: G561-G568, 1998.[Abstract/Free Full Text]
  10. Hannibal J, Ekblad E, Mulder H, Sundler F, and Fahrenkrug J. Pituitary adenylate cyclase activating polypeptide (PACAP) in the gastrointestinal tract of the rat: distribution and effects of capsaicin or denervation. Cell Tissue Res 291: 65-79, 1998.[CrossRef][Web of Science][Medline]
  11. Hannibal J and Fahrenkrug J. Pituitary adenylate cyclase-activating polypeptide in intrinsic and extrinsic nerves of the rat pancreas. Cell Tissue Res 299: 59-70, 2000.[CrossRef][Web of Science][Medline]
  12. Hansen TO, Rehfeld JF, and Nielsen FC. Cyclic AMP-induced neuronal differentiation via activation of p38 mitogen-activated protein kinase. J Neurochem 75: 1870-1877, 2000.[CrossRef][Web of Science][Medline]
  13. Hersey SJ and Sachs G. Gastric acid secretion. Physiol Rev 75: 155-189, 1995.[Free Full Text]
  14. Higham AD, Dimaline R, Varro A, Attwood S, Armstrong G, Dockray GJ, and Thompson DG. Octreotide suppression test predicts beneficial outcome from antrectomy in a patient with gastric carcinoid tumor. Gastroenterology 114: 817-822, 1998.[CrossRef][Web of Science][Medline]
  15. Hocker M, Henihan RJ, Rosewicz S, Riecken EO, Zhang Z, Koh TJ, and Wang TC. Gastrin and phorbol 12-myristate 13-acetate regulate the human histidine decarboxylase promoter through Raf-dependent activation of extracellular signal-regulated kinase-related signaling pathways in gastric cancer cells. J Biol Chem 272: 27015-27024, 1997.[Abstract/Free Full Text]
  16. Hocker M, Zhang Z, Fenstermacher DA, Tagerud S, Chulak M, Joseph D, and Wang TC. Rat histidine decarboxylase promoter is regulated by gastrin through a protein kinase C pathway. Am J Physiol Gastrointest Liver Physiol 270: G619-G633, 1996.[Abstract/Free Full Text]
  17. Huang NK, Lin YW, Huang CL, Messing RO, and Chern Y. Activation of protein kinase A and atypical protein kinase C by A(2A) adenosine receptors antagonizes apoptosis due to serum deprivation in PC12 cells. J Biol Chem 276: 13838-13846, 2001.[Abstract/Free Full Text]
  18. Journot L, Spengler D, Pantaloni C, Dumuis A, Sebben M, and Bockaert J. The PACAP receptor: generation by alternative splicing of functional diversity among G protein-coupled receptors in nerve cells. Semin Cell Biol 5: 263-272, 1994.[CrossRef][Medline]
  19. Langhans N, Rindi G, Chiu M, Rehfeld J.F, Ardman B, Beinborn M, and Kopin AS. Abnormal gastric histology and decreased acid production in cholecystokinin-B/gastrin receptor-deficient mice. Gastroenterology 112: 280-286, 1997.[Web of Science][Medline]
  20. Lauffer JM, Modlin IM, Hinoue T, Kidd M, Zhang T, Schmid SW, and Tang LH. Pituitary adenylate cyclase activating polypeptide (PACAP) modulates gastric enterochromaffin-like cell proliferation in rats. Gastroenterology 116: 623-635, 1999.[CrossRef][Web of Science][Medline]
  21. Lauffer JM, Modlin IM, and Tang LH. Biological relevance of pituitary adenylate cyclase-activating polypeptide (PACAP) in the gastrointestinal tract. Regul Pept 84: 1-12, 1999.[CrossRef][Web of Science][Medline]
  22. Lindstrom E, Bjorkqvist M, Boketoft A, Chen D, Zhao CM, Kimura K, and Hakanson R. Neurohormonal regulation of histamine and pancreastatin secretion from isolated rat stomach ECL cells. Regul Pept 71: 73-86, 1997.[CrossRef][Web of Science][Medline]
  23. Lloyd KC, Raybould HE, Tache Y, and Walsh JH. Role of gastrin, histamine, and acetylcholine in the gastric phase of acid secretion in anesthetized rats. Am J Physiol Gastrointest Liver Physiol 262: G747-G755, 1992.[Abstract/Free Full Text]
  24. Miyata A, Jiang L, Stibbs HH, and Arimura A. Chemical characterization of vasoactive intestinal polypeptide-like immunoreactivity in ovine hypothalamus and intestine. Regul Pept 38: 145-154, 1992.[CrossRef][Web of Science][Medline]
  25. Moller M, Fahrenkrug J, and Hannibal J. Innervation of the rat pineal gland by pituitary adenylate cyclase-activating polypeptide (PACAP)immunoreactive nerve fibres. Cell Tissue Res 296: 247-257, 1999.[CrossRef][Web of Science][Medline]
  26. Moller K and Sundler F. Expression of pituitary adenylate cyclase activating peptide (PACAP) and PACAP type I receptors in the rat adrenal medulla. Regul Pept 63: 129-139, 1996.[CrossRef][Web of Science][Medline]
  27. Mungan Z, Hammer RA, Akarca US, Komaki G, Ertan A, and Arimura A. Effect of PACAP on gastric acid secretion in rats. Peptides 16: 1051-1056, 1995.[CrossRef][Web of Science][Medline]
  28. Noto T, Nagasaki M, and Endo T. Role of vagus nerves and gastrin in the gastric phase of acid secretion in male anesthetized rats. Am J Physiol Gastrointest Liver Physiol 272: G335-G339, 1997.[Abstract/Free Full Text]
  29. Osipenko ON, Barrie AP, Allen JM, and Gurney AM. Pituitary adenylyl cyclase-activating peptide activates multiple intracellular signaling pathways to regulate ion channels in PC12 cells. J Biol Chem 275: 16626-16631, 2000.[Abstract/Free Full Text]
  30. Prinz C, Kajimura M, Scott DR, Mercier F, Helander HF, and Sachs G. Histamine secretion from rat enterochromaffin-like cells. Gastroenterology 105: 449-461, 1993.[Web of Science][Medline]
  31. Raychowdhury R, Fleming JV, McLaughlin JT, Bulitta CJ, and Wang TC. Identification and characterization of a third gastrin response element (GAS-RE3) in the human histidine decarboxylase gene promoter. Biochem Biophys Res Commun 297: 1089-1095, 2002.[CrossRef][Web of Science][Medline]
  32. Reimer M, Moller K, Sundler F, Hannibal J, Fahrenkrug J, and Kanje M. Increased expression, axonal transport and release of pituitary adenylate cyclase-activating polypeptide in the cultured rat vagus nerve. Neuroscience 88: 213-222, 1999.[CrossRef][Web of Science][Medline]
  33. Sandvik AK and Waldum HL. CCK-B (gastrin) receptor regulates gastric histamine release and acid secretion. Am J Physiol Gastrointest Liver Physiol 260: G925-G928, 1991.[Abstract/Free Full Text]
  34. Stenquist B. Studies on vagal activation of gastric acid secretion in man. Acta Physiol Scand Suppl 465: 1-31, 1979.[Medline]
  35. Sundler F, Ekblad E, Absood A, Hakanson R, Koves K, and Arimura A. Pituitary adenylate cyclase activating peptide: a novel vasoactive intestinal peptide-like neuropeptide in the gut. Neuroscience 46: 439-454, 1992.[CrossRef][Web of Science][Medline]
  36. Taupenot L, Mahata SK, Wu H, O'Connor DT. Peptidergic activation of transcription and secretion in chromaffin cells. Cis and trans signaling determinants of pituitary adenylyl cyclase-activating polypeptide (PACAP). J Clin Invest 1998: 863-876.
  37. Thommesen L, Hofsli E, Paulssen RH, Anthonsen MW, and Laegreid A. Molecular mechanisms involved in gastrin-mediated regulation of cAMP-responsive promoter elements. Am J Physiol Endocrinol Metab 281: E1316-E1325, 2001.[Abstract/Free Full Text]
  38. Vaudry D, Gonzalez BJ, Basille M, Yon L, Fournier A, and Vaudry H. Pituitary adenylate cyclase-activating polypeptide and its receptors: from structure to functions. Pharmacol Res 52: 269-324, 2000.[CrossRef]
  39. Yanagisawa K, Yang H, Walsh JH, and Tache Y. Role of acetylcholine, histamine and gastrin in the acid response to intracisternal injection of TRH analog, RX 77368, in the rat. Regul Pept 27: 161-170, 1990.[CrossRef][Web of Science][Medline]
  40. Zeng N, Athmann C, Kang T, Lyu RM, Walsh JH, Ohning GV, Sachs G, and Pisegna JR. PACAP type I receptor activation regulates ECL cells and gastric acid secretion. J Clin Invest 104: 1383-1391, 1999.[Web of Science][Medline]
  41. Zeng N, Walsh JH, Kang T, Helander KG, Helander HF, and Sachs G. Selective ligand-induced intracellular calcium changes in a population of isolated gastric endocrine cells. Gastroenterology 110: 1835-1846, 1996.[CrossRef][Web of Science][Medline]
  42. Zhang Z, Hocker M, Koh TJ, and Wang TC. The human histidine decarboxylase promoter is regulated by gastrin and phorbol 12-myristate 13-acetate through a downstream cis-acting element. J Biol Chem 271: 14188-14197, 1996.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Physiol. Rev.Home page
H. L. Haas, O. A. Sergeeva, and O. Selbach
Histamine in the Nervous System
Physiol Rev, July 1, 2008; 88(3): 1183 - 1241.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
W. Ai, H. Zheng, X. Yang, Y. Liu, and T. C. Wang
Tip60 functions as a potential corepressor of KLF4 in regulation of HDC promoter activity
Nucleic Acids Res., September 25, 2007; 35(18): 6137 - 6149.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
W. Ai, Y. Liu, and T. C. Wang
Yin yang 1 (YY1) represses histidine decarboxylase gene expression with SREBP-1a in part through an upstream Sp1 site
Am J Physiol Gastrointest Liver Physiol, June 1, 2006; 290(6): G1096 - G1104.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/1/G51    most recent
00169.2002v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by McLaughlin, J. T.
Right arrow Articles by Wang, T. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by McLaughlin, J. T.
Right arrow Articles by Wang, T. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2004 by the American Physiological Society.