|
|
||||||||
INFLAMMATION/IMMUNITY/MEDIATORS
1Departments of Physiology, 2Obstetrics and Gynecology, 3Surgery, 4Internal Medicine, and 5Pediatrics, Virginia Commonwealth University, Richmond, Virginia 23298
Submitted 25 April 2003 ; accepted in final form 19 November 2003
| ABSTRACT |
|---|
|
|
|---|
B, a transcription factor for IL-8 that is activated by oxidative stress. In this study, we examined two mechanisms whereby LA, the dietary precursor for arachidonic acid (AA), could increase the production of IL-8 via activation of AA pathways: 1) by generation of reactive oxygen species by the AA-pathway enzymes to activate NF-
B or 2) by AA metabolites. Normal and Crohn's HISM cells were exposed to LA, oxidizing solution (Ox), or oxidizing solution enriched with LA (OxLA). Exposure of cells to Ox or OxLA induced oxidative stress as determined by thiobarbituric acid reactive substances. In normal cells, Ox but not LA activated NF-
B as determined by transfection experiments and Western blot. In Crohn's cells, NF-
B was spontaneously activated and was not further activated by Ox or LA. In contrast, TNF-
markedly increased activation of NF-
B in both normal and Crohn's cells. These results indicated that LA did not increase IL-8 by activating NF-
B, so we evaluated the second mechanism of an effect of AA metabolites. In normal cells, OxLA, but not LA, markedly stimulated IL-8, whereas in Crohn's cells, both OxLA and LA stimulated IL-8. OxLA, also stimulated production of AA metabolites leukotriene B4 (LTB4), PGE2, and thromboxane B2 (TXB2) by normal and Crohn's cells. To determine whether AA metabolites mediated the IL-8 response, cells were treated with OxLA plus indomethacin (Indo), a cyclooxygenase inhibitor, and nordihydroguaiaretic acid (NDGA), a lipoxygenase inhibitor. Both Indo and NDGA blocked the IL-8 response to OxLA. To determine more specifically a role for AA metabolites, AA was used. Similar to OxLA, OxAA stimulated production of IL-8 and AA metabolites. Pinane thromboxane, a selective thromboxane synthase inhibitor and receptor blocker, inhibited OxAA stimulation of TXB2 and IL-8 in a dose-response manner. MK886, a selective 5-lipoxygenase inhibitor, inhibited OxAA stimulation of LTB4 and IL-8 also in a dose-response manner. Analysis of specific gene products by RT-PCR demonstrated that HISM cells expressed receptors for both thromboxane and LTB4. We conclude that AA metabolites mediated the IL-8 response to LA in HISM cells. Both cyclooxygenase and lipoxygenase pathways were involved. LA did not increase IL-8 by activating NF-
B, but NF-
B appeared to be involved, because LA increased IL-8 only in situations where NF-
B was activated, either spontaneously in Crohn's cells or by Ox in normal cells. We speculate that AA metabolites increased IL-8 production by enhancing NF-
B-dependent transcription of IL-8.
NF-
B; leukotriene B4; prostaglandin E2; thromboxane
Leukocytes infiltrate into tissue in response to chemotactic signals produced by the tissue. The most potent chemotactic signaling molecules are chemokines (23). Chemokines play a major role in inflammation. The
-chemokine IL-8 is chemotactic for neutrophils (23). IL-8 may play an important role in Crohn's disease. Several studies indicate that mucosa contains significantly more IL-8 in patients with active inflammatory bowel disease than in normal control subjects (5, 9, 16, 25, 28).
Recently, we reported (31) that smooth muscle cells isolated from the stricture of a Crohn's patient spontaneously secreted higher quantities of IL-8 than normal cells. In another study, we observed a ninefold increase in IL-8 secretion when smooth muscle cells isolated from the stricture of Crohn's patients were exposed to linoleic acid (LA) (1). This effect was specific for LA and did not occur with oleic acid and was also blocked by antioxidants, implicating a role for oxidative stress. Given that smooth muscle cells comprise the mass of the stricture in Crohn's patients, IL-8 production by these cells could play an important role in inflammation by recruiting neutrophils to the stricture.
Because LA is a common dietary fatty acid, understanding the mechanism responsible for the LA-induced effect on IL-8 could have clinical significance. LA is the precursor for arachidonic acid (AA) and its metabolites, so the effect of LA to stimulate IL-8 could be by activation of the AA pathways. The AA metabolites are synthesized via two major enzymatic pathways: 1) cyclooxygenase, leading to prostaglandins and thromboxanes, and 2) 5-lipoxygenase, leading to leukotrienes. The cyclooxygenase and lipoxygenase enzymes generate reactive oxygen species (ROS) when activated (19).
IL-8 is regulated by NF-
B, a transcription factor that activates genes involved in inflammatory and immune responses (3, 4). NF-
B is present in the cytosol as two subunits, p65 and p50, bound to inhibitory-
B (I
B). On activation, the subunits dissociate from I
B and enter the nucleus where they bind to NF-
B binding sites to enhance expression of inflammatory genes. Oxidants are effective inducers of NF-
B activation (4, 43, 44, 50), whereas AA metabolites have been shown to enhance NF-
B-dependent transcription (2, 17, 37). We hypothesized that LA might increase IL-8 production by one of two mechanisms: 1) by activating AA pathway enzymes to generate ROS to activate NF-
B or 2) by AA pathway metabolites (Fig. 1).
|
| MATERIALS AND METHODS |
|---|
|
|
|---|
Tissues for isolation of human intestinal smooth muscle cells from normal and Crohn's patients were obtained from Medical College of Virginia Hospitals of Virginia Commonwealth University Health System (Richmond, VA). This study was approved by the Virginia Commonwealth University Office of Research Subjects Protection. Normal jejunal tissue was obtained from patients undergoing gastric bypass operations. Tissue from the jejunum was used preferentially because it is relatively free of gastrointestinal microorganisms. Crohn's tissue was taken from the specimens of strictured bowel (ileum or colon) that were resected for surgical reasons and were pathological specimens.
Human Intestinal Smooth Muscle Cells
Isolation of human intestinal smooth muscle cells. Human intestinal smooth muscle (HISM) cells were isolated as previously described (13). When confluent after 34 wk in culture, the smooth muscle cells were released from the plates by trypsinization (0.25% trypsin-EDTA) and frozen. To freeze the cells, 200 µl of dimethylsulfoxide (Sigma, St. Louis, MO) were added to 1.0 ml of cell suspension (1 x 105 cells) to keep cell integrity during freezing. The cells were transferred to 1.5-ml cryotubes in 1-ml aliquots and stored in liquid nitrogen.
Culture conditions. To prepare the cells for each experiment, one cryotube was removed from liquid nitrogen and thawed in a 37°C water bath. One milliliter of the cell suspension (1 x 105 cells) was added into a 100-mm culture dish containing 10 ml DMEM supplemented with 20% FBS. Cells were allowed to grow to confluence for 34 wk. Meticulous attention was paid to ensure true smooth muscle cell phenotype for each batch of cells by screening for a panel of smooth muscle cytoskeletal proteins by immunoblot (
-smooth muscle isoactin, tropomyosin, calponin, h-caldesmon, and metavinculin). Cells were used within three to six passages of isolation to preclude cell dedifferentiation from confounding the results. Stability of phenotype of the cells after passage was indicated not only by screening for smooth muscle cytoskeletal proteins but also by maintenance of spontaneous activation of NF-
B in Crohn's cells and retention of their remarkable ability to produce IL-8 in response to LA.
NF-
B Activation
Transient transfection and dual luciferase reporter assay system. To examine the activation of NF-
B in HISM cells, transient transfection studies were done with a pGL3 luciferase reporter construct containing the NF-
B binding region of the human IL-8 promoter upstream from the firefly luciferase gene. Transfection of this reporter construct into the cells allowed determination as to whether a particular treatment activated NF-
B, because activation of the NF-
B binding site of the reporter would result in expression of firefly luciferase with an increase in luminescence. Development of this reporter construct, designated BF2, was previously described (12). The identity of the NF-
B binding site on BF2 was confirmed using a BF2 mutant, which was created by site-directed mutagenesis, to introduce a four-point transversion mutation into the native NF-
B site. For validation, negative controls received plasmid bearing the luciferase gene but lacking an upstream promoter (pGL3-basic), whereas positive controls received a plasmid (pGL3-SV40) bearing the strong viral promoter SV40 linked to (luc+). pRL-TK, which contains a weak herpes simplex virus thymidine kinase promoter region upstream from Renilla luciferase gene, was cotransfected as a control for the transfection procedure. pRL-TK produced a low level of luminescence. Luminescence produced by BF2 was indexed to luminescence produced by pRL-TK.
HISM cells were seeded into 24-well cell culture plates (Costar, Corning, NY) at a density of 40,000 cells/well. Cells were grown for 72 h in DMEM supplemented with 10% FBS. The cells reached a state of 50% confluence at the end of the incubation period. The BF2 construct and pRL-TK plasmid were transfected into the cells using Effectene (Qiagen, Valencia, CA) for 6 h. Cells were washed with phosphate buffered saline and then incubated in DMEM with the following treatments for 16 h according to the protocol supplied by the manufacturer for the transfection reagents: 1) pGL-basic (plasmid control); 2) BF2 mutant (control for specificity of the BF2 construct); 3) BF2 construct; 4) BF2 + LA (2045 µM); 5) BF2 + Ox; and 6) BF2 + TNF-
(1 ng/ml). Each treatment was done in triplicate. The luminescence output of lysed cells was quantified by using a commercially available dual luciferase reporter assay (Promega, Madison, WI). Firefly and Renilla luciferases were measured sequentially for each sample. Luminescence was recorded on a luminometer (Lumat LB9501, Berthold). Results were expressed as relative light units (RLU).
NF-
B and I
B Western blot analysis. Normal HISM cells and HISM cells from Crohn's patients were grown to confluence in DMEM and 10% FBS in 100-mm-diameter culture dishes (Nunc, Naperville, IL). When the cells reached 100% confluence, they were placed in DMEM without serum for 24 h so they would become quiescent before starting treatments. Cells were treated with LA (90 µM) and incubated for 10, 30, and 60 min and 4 and 24 h. Control cells were incubated with DMEM. After treatment, cells were placed on ice, washed twice with cold phosphate buffered saline, and then resuspended in lysis buffer (10 ml 1 M HEPES per liter, 0.75 g/l KCl, 0.037 g/l EDTA, 0.046 g/l EGTA, 0.084 g/l NaF). Cells were scraped into 1.5-ml tubes and vortexed at maximum speed for 10 s. The cell homogenate was centrifuged for 5 min at 6,000 g at 4°C. The supernatant was removed and stored at -70°C as cytoplasmic extracts. The nuclear pellet was resuspended in 50 µl of cold buffer (20 ml 1 M HEPES per liter, 22.77 g/l NaCl, 0.37 g/l EDTA, 0.468 g/l EGTA, 0.084 g/l NaF) and vortexed for 10 s. The nuclear extracts were centrifuged at 50,000 g for 1 h at 4°C. The supernatant was removed and stored at -70°C as nuclear extracts. Total protein content of the supernatant was determined by Coomassie blue dye binding method. Twenty-five micrograms of total cellular protein were fractionated in a denaturing 10% SDS-PAGE at 25 mA. The nitrocellulose membrane was incubated with polyclonal antibody directed against the p65 subunit of NF-
B (1:1,000, Santa Cruz Biotechnology, Santa Cruz, CA) for 23 h with rotational shaking at room temperature. I
B was also analyzed in the cytosol fraction using a polyclonal antibody directed against I
B
(1:100, Santa Cruz Biotechnology). The blots were washed three times for 15 min, and proteins were detected using an Amersham enhanced chemiluminescence system with Hyperfilm MP (Amersham, Arlington Heights, IL).
LA and AA Experiments
For the LA experiments, HISM cells were seeded in 100-mm culture dishes and grown to confluence in DMEM with 10% FBS. Cells were then placed into DMEM without serum for 24 h to allow them to become quiescent before beginning any experimental treatments. Cells were incubated for 24 h with the following treatments: 1) DMEM; 2) oxidizing solution (Ox; containing hypoxanthine, 0.9 mM plus xanthine oxidase, 0.004 U/ml + ferrous sulfate, 50 µM); 3) LA (90 µM); 4) Ox enriched with LA (OxLA); 5) OxLA plus indomethacin (Indo; 50 µM), a cyclooxygenase inhibitor; or 6) OxLA plus nordihydroguaiaretic acid (NDGA; 10 µM), a lipoxygenase inhibitor. Data were expressed per milligram of protein.
For the AA experiments, HISM cells were seeded in 24-well culture plates and grown to confluence in DMEM with 10% FBS. Cells were then placed into DMEM without serum for 24 h. Cells were incubated for 24 h with 1) DMEM; 2) AA (5 µM); 3) Ox enriched with AA (OxAA); 4) OxAA plus MK886 (0.251.0 µM), a selective 5-lipoxygenase inhibitor; or 5) OxAA plus pinane thromboxane A2 (PTA2; 0.35 µM), a thromboxane synthase inhibitor and thromboxane receptor blocker. Data were expressed per milliliter.
Indomethacin and NDGA were purchased from Sigma. LA and PTA2 were purchased from Cayman Chemical. MK886 was purchased from Calbiochem (San Diego, CA). LA, Indo, NDGA, PTA2, and MK886 were initially diluted in 100% ethanol and then diluted to final concentration in DMEM. Final concentrations of ethanol were <0.5%. Vehicle controls were run with ethanol to ensure these small amounts of ethanol did not affect cell function.
Cells and media were collected from the culture dishes after 24 h of exposure to the experimental treatments. Cells were rinsed with phosphate buffered saline, harvested, centrifuged for 5 min at 1,000 g, suspended in 1 ml of double distilled water, and stored at -20°C. HISM cells were homogenized for analysis of thiobarbituric acid reactive substances (TBARS) and protein.
Leukotriene B4 and Thromboxane Receptor Analysis
RT-PCR was used to assess gene expression of receptors for leukotriene B4 (LTB4) and thromboxane in HISM cells. Primers were designed to yield amplicons of
200 bp using SeqWeb version 2.0.2. Gene-specific sense and antisense primer pairs were designed from the nucleotide sequence for Homo sapiens LTB4 receptor (LTB-R) (GenBank accession no. BC004545
[GenBank]
) and for human thromboxane A2 (TxA2) receptor (TX-R; GenBank accession no. U27325
[GenBank]
). Gene specificity was determined by entering the sequences of the sense and antisense primers and the PCR products into the BLAST program of the National Center for Biotechnology Information (Washington, DC). The gene-specific pairs used were LTB-R (sense primer 5'-281attggcatcagcttccaac299-3' and antisense primer 5'-478ttctgcatccttttcaggatac457-3') and TX-R (sense primer 5'-331ctggtcctcaccgacttcct350-3' and antisense primer 5'-525gatacccaggtagcgctctg506-3'). Primers were synthesized by Sigma-Genosys (The Woodlands, TX). The amplicons generated by RT-PCR were verified for specificity by sequencing by the Nucleic Acids Research Facility of Virginia Commonwealth University Medical Center.
Total cellular RNA was extracted from confluent HISM cells using an RNeasy Mini kit according to the procedure provided by the manufacturer (Qiagen). The RNA fraction was collected and used to synthesize cDNA for RT-PCR of gene expression. First-strand cDNA synthesis was performed using 10 µl of RNA purified with an RNeasy minicolumn, 3 µg/1 µl of random primers (mostly hexamers) in 28 µl water at 65°C for 5 min. To this reaction was added 10 µl of 10x reaction buffer (200 mM Tris·HCl, pH 8.4, 500 mM KCl), 5 µl 10 mM dNTP mix composed of 10 mM each of deoxyadenosine triphosphate, deoxythymidine triphosphate, deoxyguanidine triphosphate, and deoxycytidine triphosphate, and 1 µl SuperScript II RT (200 U). Reagents were purchased from Invitrogen (Carlsbad, CA). One microliter of RNasin ribonuclease inhibitor (40 units, Promega) was also added to inhibit RNases. This mixture was incubated at 37°C for 1 h.
First-strand cDNA was used as a template for the PCR amplification of LTB-R or TX-R. The reaction mixture consisted of 10x PCR buffer (5 µl), 10 mM dNTP mixture (1 µl), 50 mM MgCl2 (1.5 µl), 10 µM each of sense and antisense primer mix (1 µl), first-strand cDNA (2 µl), 1.0 unit platinium Taq DNA polymerase (0.2 µl), and water (39 µl). PCR amplifications were carried out using a PTC-200 DNA Engine (MJ Research, Watertown, MA) with the following conditions: denaturation and enzyme activation at 94°C for 5 min, then amplification using a "touchdown" protocol with denaturing at 94°C for 30 s, and annealing from 60 to 52°C in half-degree increment cycles for 30 s each with extension at 72°C for 30 s. Multiple cycles were performed at each annealing temperature (the first 8 cycles were repeated once, the last 8 were repeated twice for a total of 40 cycles). Final extension was at 72°C for 5 min and maintenance of the reaction was at 4°C after cycling. Products were analyzed by 1.5% agarose gel electrophoresis and visualized by ethidium bromide staining using molecular weight standards.
Assays
IL-8 concentrations were determined by enzyme immunoassay (EIA) using commercially available reagents: anti-human IL-8 monoclonal capture antibody, biotinylated anti-human IL-8 detection antibody, and recombinant human IL-8 (R&D Systems, Minneapolis, MN). LTB4, PGE2, and TXB2, the stable metabolite of TxA2, were analyzed by commercially available EIA kits (R&D Systems). Oxidative stress was assessed by measurement of TBARS, which primarily reflects malondialdehyde, a breakdown product of lipid peroxides (18). HISM cell viability under experimental conditions was determined by the thiazolyl blue tetrazolium bromide (MTT) cell growth and viability assay as previously described (29). The amount of protein of HISM cell homogenates was measured by Coomassie plus blue dye binding method (Pierce, Rockford, IL).
Statistical Analysis
Data were analyzed by one-way analysis of variance with Fisher's protected least significant difference post hoc test. A probability level of P < 0.05 was considered to be statistically significant. Data are presented as means ± SE. A statistical computer software program was used for analysis (StatView, Abacus Concepts, Berkeley, CA).
| RESULTS |
|---|
|
|
|---|
B Activation
To test the first hypothesis that LA induces IL-8 production by activating NF-
B, transient transfection experiments were conducted with an NF-
B reporter construct, BF2. Positive and negative controls were used to validate the transfection protocol. Both normal and Crohn's HISM cells readily took up the reporter construct (BF2) during the 6-h transfection (Fig. 2). As expected, neither normal nor Crohn's HISM cells transfected with pGL3-Basic (plasmid negative control) showed any appreciable firefly luciferase activity (RLU). Unstimulated Crohn's cells exhibited significant spontaneous NF-
B activation compared with normal cells as evidenced by significantly higher RLU by cells transfected with BF2. Treatment with LA (BF2 + LA) did not increase NF-
B activation in either normal or Crohn's HISM cells over spontaneous activity. Subjecting cells to oxidative stress (BF2 + Ox) significantly increased NF-
B activation in normal cells to the same extent as endogenous activity in Crohn's cells. In contrast, subjecting Crohn's cells to oxidative stress did not further increase NF-
B activity over unstimulated cells. TNF-
significantly increased NF-
B activation in both normal and Crohn's cells compared with control. Cells transfected with the BF2 mutant showed no appreciable firefly luciferase activity, indicating specificity of the BF2 reporter construct for NF-
B activation.
|
Western blot analysis was used to confirm the results of the transfection experiments. As shown in Fig. 3, the intensity of the bands of the p65 subunit of NF-
B was much stronger in the cytosolic than in the nuclear extracts obtained from normal cells, whereas cytosolic and nuclear extracts obtained from Crohn's cells showed the same level of intensity, indicating activation and translocation of NF-
B from the cytosol to the nucleus in the Crohn's cells. Treatment with LA did not increase the nuclear fraction of NF-
B in either normal or Crohn's cells. Intensities of the bands for I
B were detectable in normal HISM cells but barely detectable in Crohn's HISM cells. LA had no effect on the intensity of the I
B bands in either normal or Crohn's cells, indicating that LA did not cause I
B degradation (Fig. 4).
|
|
Verification of Oxidative Stress
To verify that Ox and OxLA were inducing oxidative stress, the cellular levels of TBARS were analyzed. TBARS primarily reflect malondialdehyde, a breakdown product of lipid peroxides (18), and are commonly used as a measure of oxidative stress. We have previously shown that TBARS highly correlate with 8-isoprostane for media samples and so accurately reflect lipid peroxidation (49). TBARS were significantly higher in normal and Crohn's cells exposed to either Ox or OxLA compared with DMEM control or LA (Fig. 5). Crohn's OxLA was significantly higher than normal OxLA or Crohn's Ox. Indo did not inhibit the stimulatory effect of OxLA on TBARS. NDGA reduced the amount of TBARS produced by OxLA in Crohn's cells, but the level was still significantly higher than DMEM control. These data demonstrate that the oxidizing solution induced oxidative stress, which was especially pronounced by OxLA in Crohn's cells.
|
LA and IL-8
To test the second hypothesis that AA metabolites were mediators of the IL-8 response to LA, studies were done with LA and AA pathway inhibitors. Indo was used to inhibit synthesis of cyclooxygenase metabolites, and NDGA was used to inhibit synthesis of lipoxygenase metabolites. Treatment of HISM cells with LA caused a marked 27-fold increase in IL-8 secretion by Crohn's cells but not normal cells (Fig. 6). The oxidizing solution alone did not affect IL-8, but in conjunction with LA (i.e., OxLA), it increased IL-8 of normal cells to the levels observed in Crohn's cells treated with LA. Treatment of Crohn's cells with OxLA did not increase IL-8 over that of treatment with LA alone. The AA pathway inhibitors were evaluated with OxLA, because OxLA increased IL-8 in both normal and Crohn's HISM cells. Both Indo and NDGA inhibited the ability of OxLA to increase IL-8, implicating AA metabolites in the IL-8 response to LA.
|
LA and AA Metabolites
To determine whether LA stimulated production of AA metabolites, representative metabolites were measured. OxLA stimulated production of both lipoxygenase (LTB4) and cyclooxygenase (PGE2, TXB2) metabolites (Fig. 7). OxLA significantly increased the production of LTB4 by both normal and Crohn's cells compared with LA alone or compared with the DMEM controls. Treatment of normal or Crohn's cells with NDGA significantly inhibited the ability of OxLA to stimulate LTB4 production, but Indo did not.
|
Treatment of normal or Crohn's cells with either LA or OxLA resulted in a significant increase in the production of PGE2 compared with the DMEM controls. PGE2 production was reduced significantly when normal or Crohn's cells were treated with OxLA plus Indo. NDGA did not significantly inhibit the ability of OxLA to increase PGE2 either in normal or Crohn's cells.
TXB2 concentrations in the media of normal and Crohn's cells exposed to LA were two- to threefold higher than the DMEM controls (Fig. 7). OxLA caused a marked sevenfold increase in TXB2 secretion by normal cells and a fourfold increase by Crohn's cells. Treatment with Indo significantly inhibited the ability of OxLA to stimulate TXB2. Treatment with NDGA also inhibited TXB2.
AA and IL-8
To determine more specifically the role for AA metabolites in mediating the IL-8 response, normal HISM cells were incubated with AA, OxAA, OxAA plus PTA2, a selective thromboxane synthase inhibitor, and OxAA plus MK886, a selective 5-lipoxygenase inhibitor. Similar to OxLA, OxAA stimulated production of IL-8 as well as TXB2 (Fig. 8), PGE2 (data not shown), and LTB4 (Fig. 9). PTA2 inhibited in a dose-response manner the increases in TXB2 and IL-8 production induced by OxAA (Fig. 8). MK886 inhibited LTB4 and IL-8 production induced by OxAA also in a dose-response manner (Fig. 9).
|
|
LTB4 and Thromboxane Receptors in HISM Cells
To ensure that HISM cells could respond to LTB4 and thromboxane, we assessed gene expression of receptors for LTB4 and TxA2. Figure 10 shows the gel electrophoresis of the RT-PCR products amplified using specific primers for LTB-R and TX-R. PCR products were present at the appropriate molecular weights for each receptor. Sequencing verified that the PCR products amplified were the desired sequence. Controls run without HISM cell cDNA were negative (data not shown). Therefore, it was concluded that HISM cells expressed transcripts corresponding to the receptors for both LTB4 and TxA2.
|
| DISCUSSION |
|---|
|
|
|---|
B to increase transcription of the IL-8 gene. The other hypothesis was that LA stimulated production of AA metabolites, which enhanced IL-8 production.
To test the first hypothesis, we exposed normal and Crohn's HISM cells that were transfected with an NF-
B construct (BF2) to Ox or LA. In normal cells, Ox but not LA activated NF-
B. In Crohn's cells, NF-
B was spontaneously activated and was not further activated by LA or Ox. These results were confirmed by Western blot analysis. Spontaneous activation of NF-
B in Crohn's cells was demonstrated by the strong intensity of the bands of the p65 subunit in the nuclear extract. Treatment of normal cells with LA did not induce translocation of NF-
B from the cytosol to the nucleus, and treatment of Crohn's cells did not induce further translocation. There was no change in the intensity of the bands of cytosolic extracts vs. nuclear extracts when normal or Crohn's cells were treated with LA compared with untreated controls. The levels of the cytosolic NF-
B inhibitory binding protein I
B were also not affected by LA. These results do not support the first hypothesis that LA induces the activation of NF-
B to increase IL-8.
In contrast to LA, TNF-
significantly activated NF-
B in both normal and Crohn's cells. Several studies in Crohn's disease showed that mononuclear cells and macrophages isolated from the lamina propria expressed high levels of TNF-
(6, 41) and IL-1
(24, 30, 32). Inflamed colonic mucosa obtained from patients with active Crohn's disease spontaneously produced increased amounts of TNF-
, IL-6, and IL-1
compared with normal mucosa (8, 21, 39, 40). These cytokines are known to activate NF-
B (4) and are potential candidates for the spontaneous activation of NF-
B in Crohn's disease. Van Dullemen et al. (48) successfully treated established colitis in Crohn's patients by using an anti-TNF-
monoclonal antibody, which suggests a role for TNF-
in Crohn's disease.
The second hypothesis we tested was that AA metabolites mediated the IL-8 response to LA. There is evidence that AA metabolites of both the cyclooxygenase and lipoxygenase pathways affect IL-8 transcription by enhancing the action of NF-
B. In colon and intestinal epithelial cells, PGE2 enhances the transcriptional potential of the p65 subunit of NF-
B, PGE2 synergizes with TNF-
to promote IL-8 gene expression, and inhibition of COX-2 blocks nuclear accumulation of NF-
B (37). In endothelial cells, expression of leukocyte cell adhesion molecules induced by thromboxane is augmented by NF-
B (17). In human bronchial epithelial cells, LTB4 mediates histamine activation of NF-
B and increased expression of IL-8 (2).
Enhancement of NF-
B may explain why AA metabolites can mediate every step of inflammation (47) and thus may play an important role in the inflammation of Crohn's disease. Increased levels of AA in the intestinal mucosa and plasma of patients with Crohn's disease have been documented (7, 10, 11, 35, 36). The increased levels of AA in the intestinal mucosa of Crohn's patients is accompanied by an increase in phospholipase A2 (PLA2) levels and activity (26, 27, 33, 34), and there is increased COX-2 expression in the colonic epithelium (46). In active Crohn's disease, the colonic mucosa synthesizes large amounts of prostaglandins, thromboxane, and leukotrienes (14, 15, 20, 45). Increased synthesis of TXB2 is related to a significant reduction in the prostacyclin-to-thromboxane ratio even in areas of the mucosa without inflammation (14). Increased synthesis of LTB4 was suggested to play an important role because it is chemotactic for leukocytes (22).
To test the second hypothesis that AA metabolites are mediators of LA's enhancement of IL-8 production, we incubated normal and Crohn's HISM cells with Ox, LA, OxLA, and OxLA plus Indo to inhibit the cyclooxygenase pathway and OxLA plus NDGA to inhibit the lipoxygenase pathways. Exposure of cells to Ox or OxLA induced oxidative stress, as evidenced by increased cellular levels of TBARS. Crohn's cells were especially susceptible to oxidative stress induced by OxLA demonstrated by markedly higher levels of TBARS than normal cells. Oxidative stress alone (Ox) did not stimulate IL-8 production, but the combination of oxidative stress and LA (OxLA) did stimulate IL-8 production in normal and Crohn's cells. LA alone did not stimulate IL-8 production in normal cells, but it did in Crohn's cells. Therefore, LA increased the production of IL-8 only in situations where NF-
B was activated, either spontaneously in Crohn's cells or by Ox in normal cells. Inhibition of either the cyclooxygenase pathway with Indo or the lipoxygenase pathways with NDGA inhibited the ability of OxLA to increase IL-8, suggesting that AA metabolites were involved in the IL-8 response to LA.
To determine whether LA stimulated the production of AA metabolites, we measured representative cyclooxygenase (PGE2 and TXB2) and lipoxygenase (LTB4) metabolites. There was no difference in the spontaneous production of these metabolites between normal and Crohn's HISM cells except for TXB2, which was twofold higher in Crohn's cells. OxLA markedly stimulated the production of all three of these eicosanoids. Indo inhibited the ability of OxLA to stimulate the production of PGE2 and TXB2, and NDGA inhibited the production of LTB4. An unexpected observation was that NDGA also inhibited OxLA's ability to stimulate TXB2. NDGA is reported to be a specific inhibitor of the lipoxygenase enzymes.
To determine more specifically a role for AA metabolites, studies were done with AA. AA alone did not significantly stimulate IL-8, but when combined with oxidative stress (OxAA) there was a marked increase in IL-8. OxAA also stimulated PGE2, TXB2, and LTB4. The results with AA were similar to those with LA, and similar to LA, AA only stimulated IL-8 in situations in which NF-
B was activated. Treatments with specific AA pathway inhibitors were similar to the LA experiments with Indo and NDGA. Treatment with varying doses of PTA2, a selective thromboxane synthase inhibitor and receptor blocker, inhibited stimulation of TXB2 and IL-8 production by OxAA in a dose-response manner. MK886, a selective 5-lipoxygenase inhibitor, inhibited OxAA stimulation of LTB4 and IL-8 also in a dose-response manner.
To determine whether HISM cells contained receptors for LTB4 and thromboxane that could mediate their action on IL-8, we assessed gene expression. Analysis of specific gene products by RT-PCR revealed that HISM cells expressed receptors for both LTB4 and TxA2.
In summary, these data provide strong evidence that AA metabolites mediate the IL-8 response to LA in HISM cells. Both cyclooxygenase and lipoxygenase pathways are involved. Although LA does not increase IL-8 by activating NF-
B, NF-
B appears to be involved, because LA increased IL-8 only in situations in which NF-
B was activated either spontaneously in Crohn's cells or by inducing oxidative stress in normal cells. We speculate that LA increases IL-8 production by stimulating AA metabolites that enhance NF-
B-dependent transcription of IL-8. These data suggest that dietary restriction of LA, antioxidant supplementation, and treatment with AA pathway inhibitors may be beneficial for treating Crohn's patients.
| ACKNOWLEDGMENTS |
|---|
This work was supported in part by National Institute of Health Grants HL-069851 (to S. W. Walsh), HL-61359 (to A. A. Fowler III), GM-58530 (to D. R. Yager), and DK-34151 (to M. F. Graham).
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
B and IL-8 in human bronchial epithelial cells. Am J Physiol Lung Cell Mol Physiol 274: L1030-L1039, 1998.
B and I
B proteins: new discoveries and insights. Annu Rev Immunol 14: 649-683, 1996.[CrossRef][ISI][Medline]
B: a pivotal transcription factor in chronic inflammatory diseases. N Engl J Med 336: 1066-1071, 1997.
-producing cells in the intestinal mucosa of children with inflammatory bowel disease. Gastroenterology 106: 1455-1466, 1994.[ISI][Medline]
B binding to DNA: effects on endothelial function. Biochem Cell Biol 77: 201-208, 1999.[CrossRef][ISI][Medline]
by mononuclear cells isolated from mucosa with active ulcerative colitis of Crohn's disease. Gut 30: 835-838, 1989.
B-mediated spontaneous interleukin-8 secretion. J Interferon Cytokine Res 21: 349-359, 2001.[CrossRef][ISI][Medline]
B family members in patients with inflammatory bowel disease. Ann NY Acad Sci 859: 149-159, 1998.
B by COX-2: roles of different prostaglandins. J Biol Chem 276: 38658-38664, 2001.
interleukin-1 beta, and interleukin-6 by morphologically normal intestinal biopsies from patients with Crohn's disease. Gut 39: 684-689, 1996.
, IL-6, and IL-1
by isolated lamina propria mononuclear cells from patients with ulcerative colitis and Crohn's disease. Clin Exp Immunol 94: 174-181, 1993.[ISI][Medline]
B transcription factor and HIV-1. EMBO J 10: 2247-2258, 1991.[ISI][Medline]
This article has been cited by other articles:
![]() |
F. Biasi, C. Mascia, and G. Poli The contribution of animal fat oxidation products to colon carcinogenesis, through modulation of TGF-{beta}1 signaling Carcinogenesis, May 1, 2008; 29(5): 890 - 894. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hinton, A. Gutsol, and S. Dakshinamurti Thromboxane hypersensitivity in hypoxic pulmonary artery myocytes: altered TP receptor localization and kinetics Am J Physiol Lung Cell Mol Physiol, March 1, 2007; 292(3): L654 - L663. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. H. C. Serezani, D. M. Aronoff, S. Jancar, and M. Peters-Golden Leukotriene B4 mediates p47phox phosphorylation and membrane translocation in polyunsaturated fatty acid-stimulated neutrophils J. Leukoc. Biol., October 1, 2005; 78(4): 976 - 984. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Ducale, S. I. Ward, T. Dechert, and D. R. Yager Regulation of hyaluronan synthase-2 expression in human intestinal mesenchymal cells: mechanisms of interleukin-1{beta}-mediated induction Am J Physiol Gastrointest Liver Physiol, September 1, 2005; 289(3): G462 - G470. [Abstract] [Full Text] [PDF] |
||||
| |||||||