Am J Physiol Gastrointest Liver Physiol 288: G175-G181, 2005.
First published September 30, 2004; doi:10.1152/ajpgi.00396.2004
0193-1857/05 $8.00
MUCOSAL BIOLOGY
NF1 transcriptional factor(s) is required for basal promoter activation of the human intestinal NaPi-IIb cotransporter gene
Hua Xu,
Jennifer K. Uno,
Michael Inouye,
James F. Collins, and
Fayez K. Ghishan
Departments of Pediatrics, Physiology, and Nutritional Sciences, Steele Memorial Children's Research Center, University of Arizona Health Sciences Center, Tucson, Arizona
Submitted 8 August 2004
; accepted in final form 27 September 2004
 |
ABSTRACT
|
|---|
The human intestinal type IIb Na+-Pi cotransporter (hNaPi-IIb) gene promoter lacks a TATA box and has a high GC content in the 5'-flanking region. To understand the mechanism of hNaPi-IIb gene transcription, the current study was performed to characterize the minimal promoter region and transcriptional factor(s) necessary to activate gene expression in human intestinal cells (Caco-2). With the use of progressively shorter promoter constructs, a minimal promoter extending from bp 58 to +15 was identified and shown to direct high levels of hNaPi-IIb cotransporter expression in Caco-2 cells. Gel mobility shift assays (GMSAs) indicated that two regions could be bound by nuclear proteins from Caco-2 cells: region A at bp 26/23 and region B at bp 44/35. The introduction of mutations in region A abolished promoter activity, whereas mutations in region B had no effect. Deletion mutants of the same regions showed identical results. Furthermore, DNase I footprinting experiments confirmed the observation made by GMSAs. Additional studies, which used a specific nuclear factor 1 (NF1) antiserum, demonstrated that NF1 protein(s) binds to the minimal promoter at region A. These results indicated that the NF1 protein(s) is required to activate the basal transcription of hNaPi-IIb gene under normal growth conditions. This study has thus identified a new target gene in the small intestinal epithelium that is directly regulated by NF1 transcriptional factor(s).
type IIb sodium-phosphate cotransporter; Slc34a2; Caco-2 cells; nuclear factor 1
REGULATION OF Pi homeostasis is vital for maintaining optimal physiological conditions for body development and maintenance of bone health. Type II Na+-Pi cotransporters (NaPi-II) are largely responsible for renal and intestinal transport of Pi in the human body, with the IIa and IIb isoforms being most important in the kidney and intestine, respectively. The NaPi-IIa cotransporter is localized on the brush-border membrane of the renal proximal tubules and is regulated by dietary Pi levels (6, 28, 30), parathyroid hormone (15, 21), and 1,25(OH)2-vitamin D3 (27). The NaPi-IIb cotransporter is localized on the apical membrane of intestinal enterocytes and is also regulated by dietary Pi levels and vitamin D3 (11, 12, 32). In addition, recent studies have shown that other physiological factors influence intestinal Pi uptake by altering NaPi-IIb cotransporter gene expression. For example, EGF and glucocorticoids decrease NaPi-IIb gene expression, which corresponds to a decrease in intestinal Na-dependent Pi absorption (3, 34). Conversely, vitamin D3 (11, 32) and estrogen (36) stimulate NaPi-IIb gene expression, which corresponds to an increase in intestinal Na-dependent Pi absorption.
We recently (34) cloned the human NaPi-IIb (hNaPi-IIb) cotransporter gene promoter and characterized its regulation by EGF in human intestinal Caco-2 cells. These experiments resulted in the identification of an EGF-responsive element in the hNaPi-IIb proximal promoter (35). In addition, it was determined that the hNaPi-IIb gene promoter does not have a typical TATA box. However, there is a GC-rich region present within the proximal promoter region located 181 bp upstream of the transcription initiation site. A cluster of transcriptional factor binding motifs, including motifs for the nuclear factor 1 (NF1) protein family, was found within 100 bp of the proximal promoter region. NF1 has been reported to interact with basal transcription factors, such as human transcriptional initiation factor (TFIIB) and yeast TATA box-binding protein (TBP) (16, 17), to activate transcription. Thus the NF1 site located in the hNaPi-IIb promoter might be especially important in basal regulation of this gene.
NF1 transcription factors are ubiquitously expressed in most tissues and possess a constitutive DNA-binding capability. NF1 proteins were originally identified from adenovirus as a DNA replication factor (20), and their binding sites have been subsequently found in a large number of gene-regulatory regions both in viral and cellular genes (8). The NF1 gene family contains four different but highly related genes: NF1A, NF1B, NF1C, and NF1X. Each of these genes encodes multiple proteins resulting from alternative polyadenylation sites, splicing, and promoter usage. The DNA-binding domain is located in the NH2 terminus of NF1 proteins and is highly conserved in all four NF1 proteins, whereas the COOH-terminal transactivation domain is variable (8).
In the present study, we identified the minimal functional promoter of the hNaPi-IIb cotransporter gene and examined the roles of NF1 proteins in its basal promoter activation. Functional analysis of promoter activity in Caco-2 cells demonstrated that NF1 protein(s) is essential for the activation of hNaPi-IIb gene transcription. This finding will likely have significant future implications in our understanding of the molecular mechanisms of hNaPi-IIb gene regulation.
 |
MATERIALS AND METHODS
|
|---|
Cell culture.
Human intestinal epithelial cells (Caco-2) were purchased from the American Type Culture Collection (Rockville, MD) and were cultured according to supplier guidelines. Caco-2 cells were cultured at 37°C in a 95% air-5% CO2 atmosphere. Media and other reagents used for cell culture were purchased from Irvine Scientific (Irvine, CA), unless otherwise indicated.
Construction of reporter plasmids.
Reporter plasmids used in this study were derived from pGL3-Basic (Promega, Madison, WI), which contains the firefly luciferase reporter gene. For deletion constructs (pGL3/119bp, pGL3/58bp, and pGL3/19bp), varying lengths of the hNaPi-IIb promoter were PCR amplified by using the same reverse primer and different forward primers containing overhanging sequences for SacI. These PCR products were then ligated into a SacI-XmaI-digested pGL3-Basic plasmid and sequenced. All deletion constructs ended at +15 bp of the hNaPi-IIb gene on the 3' end.
Binding sequence mutations were introduced by PCR-based site-directed mutagenesis. The desired promoter region was PCR amplified by using primers containing the desired mutated sequences or deleted sequences. Restriction enzyme digestion was then used to replace the wild-type promoter sequences with the PCR fragments containing mutated sequences. All mutant constructs (pGL3/A4 and pGL3/B4) and deletion constructs (pGL3/Del-A and pGL3/Del-B) were confirmed by sequencing on both strands.
Transient transfection and functional promoter analysis.
Caco-2 cells were cultured in 24-well plates. When cells reached 7080% confluence, hNaPi-IIb promoter/reporter constructs and control plasmids were transfected into cells by liposome-mediated transfection (34). Promoter reporter gene assays were performed using the Dual Luciferase assay kit according to the manufacturer's instructions (Promega). Luciferase activities were measured with a luminometer (Femtomaster FB 12; Berthold Detection System, Pforzheim, Germany). Renilla luciferase activity driven by pRL-CMV (Promega) was used as an internal control to calculate the relative luciferase activity.
Preparation of nuclear extracts for gel mobility shift assays.
Nuclear extracts were prepared by a previously described method from Caco-2 cells (35). Synthetic, double-stranded oligonucleotides were designed to cover the promoter region from 58 bp to 13 bp. DNA oligonucleotides were end labeled with [
-32P]ATP, and 5 µg of nuclear extract was incubated with 1 ng of labeled probe in gel mobility shift assay (GMSA) binding buffer containing 10 mM HEPES (pH 7.5), 1 mM EDTA, 50 mM NaCl, 1 mM dithiothreitol, and 50 µg/ml poly(dI-dC). After incubation at room temperature for 2030 min, the mixture was electrophoresed on a 6% polyacrylamide gel in 0.5x Tris-boric acid-EDTA buffer. Gels were subsequently dried and exposed to X-ray film. For competition experiments, 100- to 500-fold molar excess of unlabeled oligos was added to the reaction mixture before adding labeled oligo probes. For supershift assays, 4 µg of a rabbit polyclonal antibody raised against a recombinant protein corresponding to amino acids 1300 from the NH2 terminus of human NF1 or nonspecific rabbit IgG (Santa Cruz Biotechnology, Santa Cruz, CA) was added to the reaction mixtures.
DNase I footprinting on plasmid.
DNase I footprinting was performed by a previously described method (19). Briefly, the DNA-protein interaction reaction was performed at room temperature for 20 min by mixing 25 µg nuclear protein with 100 ng pGL3/58bp plasmid DNA in GMSA binding buffer (40 µl total volume). DNase I digestion was then performed following the protocol from the Core Footprinting System (Promega). Primer extension was then used to amplify the DNA footprinting products. DNA sequencing was performed by using fmol DNA cycle sequencing system (Promega). pGL3/58bp plasmid DNA was used as the template for DNA sequencing. RV3 primer was used for both DNA footprinting and sequencing reactions. The RV3 primer is located 5' of the subcloning site in the pGL3-Basic vector.
RT-PCR detection of NF1 expression.
mRNA was isolated from Caco-2 cells with the Micro FastTrack mRNA purification kit (Invitrogen). Full-length human NF1 family cDNAs were amplified under standard PCR conditions with primers listed in Table 1. These primers were designed from the highly conserved regions between NF1 subfamilies. The PCR-amplified human NF1 cDNAs were subcloned into pCR2.1 vector (Invitrogen) and confirmed by sequencing on both DNA strands.
Western blot analysis.
Forty micrograms of nuclear protein was loaded on 8% SDS-PAGE gels. Proteins were then blotted onto a nylon membrane for immunoblot analysis. First, NF1 antibody raised against the DNA-binding domain of the human NF1 protein (at the NH2-terminal amino acid residues 1300) was used to detect all NF1 subfamilies. Then, for NF1A protein detection, NF1A antibody raised against the COOH terminus at amino acid residues 478492 of the human NF1A protein was used. For NF1B protein detection, NF1B antibody raised against the COOH terminus at amino acid residues 327341 of the human NF1B2 protein was used. All NF1-related antibodies were purchased from Santa Cruz Biotechnology. A 1:5,000 dilution of these NF1 antibodies was used in these experiments. Western blot detection was performed with the BM chemiluminescence Western blotting kit (mouse/rabbit) (Roche Diagnostics).
Statistical analysis.
ANOVA post hoc tests (StatView 5.0.1; SAS Institute, Cary, NC) were used to compare values of the experimental data. P values of <0.05 were considered significant.
 |
RESULTS
|
|---|
Identification of minimal promoter and basal cis-elements of the hNaPi-IIb cotransporter gene.
Our previous studies have shown that the functional promoter of hNaPi-IIb gene contains 181 bp upstream of the transcriptional initiation site (34). In the present study, we made further deletion constructs to determine the minimal promoter region necessary to drive hNaPi-IIb gene transcription. Three constructs were made containing various lengths of the hNaPi-IIb promoter upstream of the transcription initiation site. The constructs were then transfected into Caco-2 cells, which endogenously express hNaPi-IIb (34). The construct pGL3/58bp, which contains 58 bp of the hNaPi-IIb promoter sequence, showed promoter activity similar to both the pGL3/181bp and pGL3/119bp constructs (Fig. 1). However, the shortest construct, pGL3/19bp, which includes only 19 bp of the promoter sequences and 15 bp within the transcriptional unit, was inactive. These results suggest that the promoter sequences between bp 58 and 19 are critical for trans-activation of the hNaPi-IIb gene.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 1. Identification of the minimal human (h) NaPi-IIb gene promoter by deletion analysis. Deletion constructs were cotransfected with pRL-CMV plasmid, and dual luciferase activity of these constructs was measured in Caco-2 cells 48 h after transfection. Relative luciferase activity was calculated as a ratio of luciferase activity (driven by hNaPi-IIb promoter) over the renilla luciferase activity [driven by cytomegalovirus (CMV) promoter]. Values are means ± SD of duplicate data from 6 experiments. *P < 0.001 for constructs pGL3/58bp (58), pGL3/119bp (119), and pGL3/181bp (181) vs. construct pGL3/19bp (19) and empty vector pGL3-Basic (B).
|
|
Identification of the DNA-protein interaction region on the basal promoter of hNaPi-IIb gene.
To determine where DNA-protein interactions occur on the minimal functional promoter region of the hNaPi-IIb gene, GMSA experiments were performed using oligos covering various regions. Three oligos (A, B, and C) homologous to the promoter region from 58 bp to 13 bp were designed. Oligo A covered the promoter region from bp 37 to 13, whereas oligos B and C covered the promoter region from bp 50 to 26 and 58 to 40, respectively. As shown in Fig. 2, strong DNA-protein interactions were detected with radiolabeled oligos A and B. In the presence of excess unlabeled oligos, these bands were significantly reduced or eliminated.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 2. Identification of DNA-protein interaction regions by gel mobility shift assays (GMSAs). 32P-labeled double-stranded oligonucleotides covering the proximal promoter region (58 bp/13 bp; sequences shown at top) were incubated with 5 µg of Caco-2 cell nuclear extract in the presence or absence of a 100-fold molar excess of unlabeled specific oligonucleotides. Image (bottom) is representative of 4 independent experiments. FP, free probe.
|
|
Identification of the DNA-protein interaction region on oligo A.
To further elucidate the specific DNA sequences involved in the DNA-protein interaction within oligo A, three mutants were designed. GMSAs with radiolabeled oligo A were performed in the presence of excess amounts of mutant oligos A1, A2, or A3. As shown in Fig. 3, DNA-protein interactions are detected with radiolabeled oligo A. However, in the presence of unlabeled oligo A, A2, or A3, the DNA-protein interaction was abolished. These results indicate that these mutant oligos are also capable of interacting with nuclear protein. Furthermore, in the presence of unlabeled oligo A1, the DNA-protein interaction could not be competed, as illustrated by the shifted bands seen in Fig. 3 (lane A1). This suggests that the altered sequences in oligo A1 are the site of nuclear protein binding. To further identify the precise DNA sequences important for protein binding within oligo A, mutant oligos A4 and A5 were produced. Both mutants altered wild-type DNA sequence CC at positions 25/24 to either TT or AA, respectively. GMSA using mutants A4 and A5 showed the same pattern that was detected with mutant A1. These results suggest that the essential sequences for nuclear protein binding on the hNaPi-IIb basal promoter region A is CC at position 25/24 bps.

View larger version (76K):
[in this window]
[in a new window]
|
Fig. 3. Identification of DNA-protein interactions on promoter region (37 bp/13 bp) by GMSAs. A 32P-labeled double-stranded oligonucleotide (oligo A) covering the proximal promoter region (37 bp/13 bp; top) was incubated with 5 µg of Caco-2 cell nuclear extract in the presence or absence of a 100-fold molar excess of unlabeled mutant oligonucleotides (oligos A1, A2, A3, A4, and A5). Bold characters indicate the mutated regions. Image (bottom) is representative of 4 independent experiments. SC, specific complex; NE, nuclear extract.
|
|
Identification of the DNA-protein interaction region on oligo B.
To further identify specific DNA sequences involved in the DNA-protein interaction within oligo B, three mutants were designed to cover different regions of oligo B. GMSAs with radiolabeled oligo B were performed in the presence of unlabeled mutant oligos B1, B2, or B3. As shown in Fig. 4, DNA-protein interactions are detected with radiolabeled oligo B. In the presence of unlabeled oligo B and B1, the DNA-protein interaction was abolished. These results indicate that the mutant B1 is still capable of interacting with nuclear protein. However, in the presence of unlabeled oligo B3, the DNA-protein interaction could not be competed, as illustrated by the shifted bands (lane B3). In addition, the DNA-protein interaction was decreased in the presence of unlabeled B2 (lane B2). This suggests that the mutation on oligo B3 removed sequences necessary for nuclear protein binding. To further identify the precise binding sequences within oligo B, mutant oligo B4 was produced. This mutant altered wild-type sequence GG to TT at position 41/40 bps. GMSA using mutant B4 showed the same pattern that was detected with mutant B3. This result suggests that the essential sequences for nuclear protein binding on the hNaPi-IIb basal promoter region B is GG at position 41/40 bps.

View larger version (79K):
[in this window]
[in a new window]
|
Fig. 4. Identification of DNA-protein interactions on promoter region (50 bp/26 bp) by GMSAs. A 32P-labeled double-stranded oligonucleotide (oligo B) covering the proximal promoter region (50 bp/26 bp; top) was incubated with 5 µg of Caco-2 cell nuclear extract in the presence or absence of a 100-fold molar excess of unlabeled mutant oligonucleotides (oligos B1, B2, B3, and B4). Bold characters indicate the mutated regions. Image (bottom) is representative of 4 independent experiments.
|
|
Functional characterization of the involvement of the DNA-protein interaction regions on hNaPi-IIb gene promoter activation.
To verify the functional necessity of the nuclear protein-binding regions, mutant constructs (pGL3/A4 and pGL3/B4) and deletion constructs (pGL3/Del-A and pGL3/Del-B) were transfected into Caco-2 cells. Mutant construct pGL3/A4 altered wild-type sequence CC to TT at position 25/24 bps, whereas mutant construct pGL3/B4 altered wild-type sequence GG to TT at position 41/40 bps. Deletion construct pGL3/Del-A removed wild-type sequence GCC at position 26/24 bp, and deletion construct pGL3/Del-B removed wild-type sequence GGG at position 41/39 bp. Mutant construct pGL3/A4 effectively reduced promoter activity to background levels as seen in pGL3/19bp, whereas mutant construct pGL3/B4 was unable to alter promoter activity and displayed activity similar to pGL3/58bp. Similar results were also observed when deletion mutant constructs pGL3/Del-A and pGL3/Del-B were used (Fig. 5).

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 5. Functional characterization of the involvement of the DNA-protein interaction regions on hNaPi-IIb basal transcriptional activation. Mutation constructs (A4 and B4) and deletion constructs (Del-A and Del-B) were cotransfected with pRL-CMV vector, and dual luciferase activity of these constructs was measured in Caco-2 cells 48 h after transfection. Relative luciferase activity was calculated by the ratio of luciferase activity (driven by hNaPi-IIb promoter) over renilla luciferase activity (driven by CMV promoter). Values are means ± SD of duplicate data from 6 experiments. *P < 0.001 for constructs pGL3/58bp (58), pGL3/B4 (B4), and pGL3/Del-B (Del-B) vs. constructs pGL3/19bp (19), pGL3/A4 (A4), and pGL3/Del-A (Del-A).
|
|
Identification of the nuclear protein involved in promoter activation.
GMSAs and functional promoter studies revealed that the basal promoter region 26/24 bp is necessary for activating hNaPi-IIb gene expression. The MatInspector program (http://www.genomatix.de) was used to search for potential transcriptional factor binding motifs in the basal promoter region of the hNaPi-IIb gene. This search yielded a potential binding site for NF1 at this site. Thus supershifts with NF1 antibodies were performed to determine whether the protein binding to this region belonged to the NF1 superfamily. Competition studies using NF1 consensus oligos (TTTGGATTGAAGCCAATATGATAA; bold indicates core sequences for NF1 protein binding) were also done to confirm the interaction between Caco-2 nuclear protein(s) and consensus NF1 binding sequences. In the presence of Caco-2 nuclear protein and radiolabeled oligo A, DNA-protein interactions were detected. This interaction could be diminished by unlabeled oligo A but not by the unlabeled oligo A4 (which had the 26/24 bp region mutated). NF1 antiserum (a blocking antibody that recognizes all NF1 family members) blocked the DNA-protein interaction, whereas control IgG had no effect on the DNA-protein interaction (Fig. 6A). Furthermore, in the presence of unlabeled NF1 consensus oligos, the DNA-protein interaction was significantly reduced (Fig. 6B). These results suggested that the trans-acting factor involved in the interaction with the hNaPi-IIb basal promoter belongs to the NF1 family.
Expression of NF1 family proteins in Caco-2 cells by PCR and Western blot.
GMSAs and functional data indicated that hNaPi-IIb basal promoter activation requires an NF1 factor(s); thus we sought to characterize expression of NF1 genes in Caco-2 cells by RT-PCR using NF1 subfamily-specific primers. RT-PCR results indicated that all four NF1 genes (NF1A, NF1B, NF1C, and NF1X) were expressed in Caco-2 cells (Fig. 7A). Western blot analyses using both a nonspecific NF1 antibody (NF1) and subfamily-specific NF1 antibodies (NF1A, NF1B) confirmed expression of multiple NF1 proteins in Caco-2 cells (Fig. 7B).

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 7. NF1 expression in Caco-2 cells. A: RT-PCR identification of multiple NF1 genes expressed in Caco-2 cells by using NF1 subfamily-specific primers. mRNA was isolated from Caco-2 cells. RT reactions were performed by using standard procedures. The full-length NF1 family cDNAs were PCR amplified with NF1 cDNA-specific primers. B: Western blot analysis of multiple NF1 proteins expressed in Caco-2 cell nuclear extracts. Forty micrograms of nuclear protein was loaded on 8% SDS-PAGE gels. Proteins were then blotted on a nylon membrane for immunoblot analysis. Various NF1 antibodies (1:5,000 dilution) were used to detect NF1 family proteins. Image is representative of 4 independent experiments. NF1 indicates an NF1 family antibody that reacts with multiple NF1 isoforms. NF1A and NF1B are specific for their isoforms.
|
|
Confirmation of the protein-DNA interaction by DNase I footprinting.
To further confirm the DNA-protein interaction region on the basal promoter of the hNaPi-IIb gene, DNase I footprinting experiments were conducted. As shown in Fig. 8, three regions on the hNaPi-IIb promoter were protected by nuclear proteins isolated from Caco-2 cells. The first region, identified as the GCCA region (26/23 bp), correlated with the region A identified by GMSAs using radiolabeled oligo A. The second region, identified as the GGCG region (41/38 bp), correlated with the region B identified by GMSAs using radiolabeled oligo B. The third region might correlate with the region observed in oligo C.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 8. DNase I footprinting analysis of DNA-protein interactions within the proximal region of the hNaPi-IIb gene. A DNA-protein interaction reaction was performed at room temperature for 20 min in the presence of 20 µg nuclear protein and 100 ng pGL3/58bp plasmid DNA. DNase I digestion was performed after the binding reaction. Primer extension was performed to amplify DNase I footprinting products. A DNA sequencing reaction was performed to generate a sequencing ladder from pGL3/58bp plasmid DNA. The primers used for both DNase I footprinting and the DNA sequencing reaction are RV3 primer, which is located upstream of the subcloning site on pGL3-Basic vector. Protected regions are shown in sidelined sequences. A and G, sequencing reaction products; NE, Caco-2 nuclear extracts.
|
|
 |
DISCUSSION
|
|---|
Previous work from our laboratory has shown that the NaPi-IIb cotransporter is highly expressed in small intestine (33), and its gene expression is regulated by various physiological factors. Our studies have shown that EGF (34), vitamin D3 (32), and estrogen (36) can regulate NaPi-IIb gene expression at the transcriptional level. These studies have also identified potential promoter regions that respond to these factors to increase or decrease the expression of the NaPi-IIb gene. Thus unlike the NaPi-IIa gene, which is expressed predominantly in kidney and regulated mainly by protein trafficking, transcriptional regulation of the NaPi-IIb gene is important.
In the present study, we analyzed the basal transcriptional activation of the hNaPi-IIb gene in Caco-2 cells under normal growth conditions. Studies using various lengths of the hNaPi-IIb promoter indicated that the minimal promoter required for activation of gene expression is contained within 58 bp upstream of the transcriptional start site. GMSAs identified the presence of DNA-protein interactions among the promoter regions A and B at positions 25/20 bp and 45/36 bp, respectively. This observation was also supported by DNase I footprinting assays in which the same regions were protected from DNase I digestion by nuclear proteins isolated from Caco-2 cells. The additional protected region (region C) identified by DNase I footprinting assays might correlate with the observation from GMSAs with labeled oligo C. We do not, however, believe that this region is important for basal promoter function, because only mutations in region A completely abolished promoter activity.
Transfection studies with mutant promoter constructs demonstrated that DNA sequences at position 26/25 bp of the hNaPi-IIb gene promoter are critical for basal gene transcription in Caco-2 cells, whereas DNA sequences at promoter region 41/40 bp are not required. Additional transfection studies implementing deletion mutations in regions A and B confirmed these observations and showed that only deletions in the 26/24 bp region were able to abolish promoter activity. Together, these results suggested that DNA sequences (GCC) within region A of the hNaPi-IIb promoter at position 26/24 bp are critical for promoter activation of the hNaPi-IIb gene under normal growth conditions.
A transcriptional factor binding motif search using the minimal promoter region of the hNaPi-IIb gene suggested a potential NF1 binding site at the promoter region 26/23 bps. Supershifts with an anti-NF1 family blocking antibody diminished the DNA-protein interaction within this promoter region. Moreover, unlabeled NF1 consensus sequences mixed with labeled oligo A were able to compete for nuclear protein binding. These results suggest that there is an NF1 binding site involved in basal promoter activity of the hNaPi-IIb gene.
NF1 factors were initially discovered as part of an adenovirus DNA replication complex but have recently been implicated in the transcriptional regulation of various cellular and viral genes (8, 20). Four NF1 genes (NF1A, NF1B, NF1C, and NF1X) have been identified in chicken (18, 23), hamster (7), mouse (5, 10, 13), rat (37), and human (2, 22). The NF1 proteins have been found to play essential roles in mammalian development, and therefore loss of these proteins has severe consequences. NF1A gene knockout mice show severe neuroanatomic defects and die within 24 h of birth (24). NF1B gene knockout mice display similar lethal defects, most likely due to the loss of lung development (9). Lastly, NF1C gene knockout mice present with severe postnatal tooth development defects that eventually lead to premature death of the animal (26).
Because multiple NF1 proteins are expressed in mammalian cells, we determined the NF1 expression pattern in Caco-2 cells by RT-PCR with NF1 subfamily cDNA-specific primers. Our data demonstrated that the four family members of the NF1 cDNA could be detected in Caco-2 cells. Western blot analysis with an NF1 antibody also confirmed that multiple NF1 proteins are expressed in Caco-2 cells. These data indicate the presence of multiple NF1 isoforms in intestinal epithelial cells. This agrees with earlier observations that NF1 proteins are ubiquitously expressed in most tissue types, including epithelial cells (1, 8).
Although there are four genes encoding NF1 proteins, the NH2-terminal region of the NF1 proteins is highly conserved. This NH2-terminal region is responsible for DNA binding, dimerization, and adenovirus replication. All NF1 proteins recognize the core binding sequence GCCA (8). NF1 proteins regulate gene expression via stimulating and/or repressing gene transcription. Several genes have been shown to be regulated by NF1 proteins, including the myelin basic protein (13), the liver-specific serum albumin, and
-fetoprotein genes (4, 29), the CYP2A3 gene (31), the IDHC gene (14), and the androgen receptor gene (25). In our present work, we found not only the presence of an NF1 binding site in the hNaPi-IIb gene basal promoter region but also that NF1 protein(s) is required to activate the basal transcription of the hNaPi-IIb gene in Caco-2 cells.
In summary, our studies show that the upstream 58 bp DNA sequences are required for activation of hNaPi-IIb gene expression in Caco-2 cells. In addition, NF1 protein interaction with the basal promoter region is critical for activation the hNaPi-IIb gene. This work has thus identified the hNaPi-IIb gene as a new target gene directly regulated by NF1 protein in the intestine.
 |
GRANTS
|
|---|
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant R01-DK-33209.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: F. K. Ghishan, Dept. of Pediatrics, Steele Memorial Children's Research Center, 1501 N. Campbell Ave., Tucson, AZ 85724 (E-mail: fghishan{at}peds.arizona.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Apt D, Chong T, Liu Y, and Bernard HU. Nuclear factor I and epithelial cell-specific transcription of human papillomavirus type 16. J Virol 67: 44554463, 1993.[Abstract/Free Full Text]
- Apt D, Liu Y, and Bernard HU. Cloning and functional analysis of spliced isoforms of human nuclear factor I-X: interference with transcriptional activation by NFI/CTF in a cell-type specific manner. Nucleic Acids Res 22: 38253833, 1994.[Abstract/Free Full Text]
- Arima K, Hines ER, Kiela PR, Drees JB, Collins JF, and Ghishan FK. Glucocorticoid regulation and glycosylation of mouse intestinal type IIb Na-Pi cotransporter during ontogeny. Am J Physiol Gastrointest Liver Physiol 283: G426G434, 2002.[Abstract/Free Full Text]
- Bernier D, Thomassin H, Allard D, Guertin M, Hamel D, Blaquiere M, Beauchemin M, LaRue H, Estable-Puig M, and Belanger L. Functional analysis of developmentally regulated chromatin-hypersensitive domains carrying the alpha 1-fetoprotein gene promoter and the albumin/alpha 1-fetoprotein intergenic enhancer. Mol Cell Biol 13: 16191633, 1993.[Abstract/Free Full Text]
- Chaudhry AZ, Lyons GE, and Gronostajski RM. Expression patterns of the four nuclear factor I genes during mouse embryogenesis indicate a potential role in development. Dev Dyn 208: 313325, 1997.[CrossRef][Web of Science][Medline]
- Collins JF, Bulus N, and Ghishan FK. Sodium-phosphate transporter adaptation to dietary phosphate deprivation in normal and hypophosphatemic mice. Am J Physiol Gastrointest Liver Physiol 268: G917G924, 1995.[Abstract/Free Full Text]
- Gil G, Smith JR, Goldstein JL, Slaughter CA, Orth K, Brown MS, and Osborne TF. Multiple genes encode nuclear factor 1-like proteins that bind to the promoter for 3-hydroxy-3-methylglutaryl-coenzyme A reductase. Proc Natl Acad Sci USA 85: 89638967, 1988.[Abstract/Free Full Text]
- Gronostajski RM. Roles of the NFI/CTF gene family in transcription and development. Gene 249: 3145, 2000.[CrossRef][Web of Science][Medline]
- Grunder A, Ebel TT, Mallo M, Schwarzkopf G, Shimizu T, Sippel AE, and Schrewe H. Nuclear factor I-B (Nfib) deficient mice have severe lung hypoplasia. Mech Dev 112: 6977, 2002.[CrossRef][Web of Science][Medline]
- Grunder A, Qian F, Ebel TT, Mincheva A, Lichter P, Kruse U, and Sippel AE. Genomic organization, splice products and mouse chromosomal localization of genes for transcription factor nuclear factor one. Gene 304: 171181, 2003.[CrossRef][Web of Science][Medline]
- Hattenhauer O, Traebert M, Murer H, and Biber J. Regulation of small intestinal Na-Pi type IIb cotransporter by dietary phosphate intake. Am J Physiol Gastrointest Liver Physiol 277: G756G762, 1999.[Abstract/Free Full Text]
- Huber K, Walter C, Schroder B, and Breves G. Phosphate transport in the duodenum and jejunum of goats and its adaptation by dietary phosphate and calcium. Am J Physiol Regul Integr Comp Physiol 283: R296R302, 2002.[Abstract/Free Full Text]
- Inoue T, Tamura T, Furuichi T, and Mikoshiba K. Isolation of complementary DNAs encoding a cerebellum-enriched nuclear factor I family that activates transcription from the mouse myelin basic protein promoter. J Biol Chem 265: 1906519070, 1990.[Abstract/Free Full Text]
- Jethanandani P and Goldberg E. ldhc expression in non-germ cell nuclei is repressed by NF-I binding. J Biol Chem 276: 3541435421, 2001.[Abstract/Free Full Text]
- Kempson SA, Lotscher M, Kaissling B, Biber J, Murer H, and Levi M. Parathyroid hormone action on phosphate transporter mRNA and protein in rat renal proximal tubules. Am J Physiol Renal Fluid Electrolyte Physiol 268: F784F791, 1995.[Abstract/Free Full Text]
- Kim TK and Roeder RG. Proline-rich activator CTF1 targets the TFIIB assembly step during transcriptional activation. Proc Natl Acad Sci USA 91: 41704174, 1994.[Abstract/Free Full Text]
- Kim TK and Roeder RG. Transcriptional activation in yeast by the proline-rich activation domain of human CTF1. J Biol Chem 268: 2086620869, 1993.[Abstract/Free Full Text]
- Kruse U, Qian F, and Sippel AE. Identification of a fourth nuclear factor I gene in chicken by cDNA cloning: NFI-X. Nucleic Acids Res 19: 6641, 1991.[Free Full Text]
- Latchman DS. Transcription Factors: A Practical Approach. New York: Oxford University Press, 1999, p.4547.
- Nagata K, Guggenheimer RA, Enomoto T, Lichy JH, and Hurwitz J. Adenovirus DNA replication in vitro: identification of a host factor that stimulates synthesis of the preterminal protein-dCMP complex. Proc Natl Acad Sci USA 79: 64386442, 1982.[Abstract/Free Full Text]
- Pfister MF, Lederer E, Forgo J, Ziegler U, Lotscher M, Quabius ES, Biber J, and Murer H. Parathyroid hormone-dependent degradation of type II Na+/Pi cotransporters. J Biol Chem 272: 2012520130, 1997.[Abstract/Free Full Text]
- Qian F, Kruse U, Lichter P, and Sippel AE. Chromosomal localization of the four genes (NFIA, B, C, and X) for the human transcription factor nuclear factor I by FISH. Genomics 28: 6673, 1995.[CrossRef][Web of Science][Medline]
- Rupp RA, Kruse U, Multhaup G, Gobel U, Beyreuther K, and Sippel AE. Chicken NFI/TGGCA proteins are encoded by at least three independent genes: NFI-A, NFI-B and NFI-C with homologues in mammalian genomes. Nucleic Acids Res 18: 26072616, 1990.[Abstract/Free Full Text]
- Shu T, Butz KG, Plachez C, Gronostajski RM, and Richards LJ. Abnormal development of forebrain midline glia and commissural projections in Nfia knock-out mice. J Neurosci 23: 203212, 2003.[Abstract/Free Full Text]
- Song CS, Jung MH, Supakar PC, Chatterjee B, and Roy AK. Negative regulation of the androgen receptor gene promoter by NFI and an adjacently located multiprotein-binding site. Mol Endocrinol 13: 14871496, 1999.[Abstract/Free Full Text]
- Steele-Perkins G, Butz KG, Lyons GE, Zeichner-David M, Kim HJ, Cho MI, and Gronostajski RM. Essential role for NFI-C/CTF transcription-replication factor in tooth root development. Mol Cell Biol 23: 10751084, 2003.[Abstract/Free Full Text]
- Taketani Y, Segawa H, Chikamori M, Morita K, Tanaka K, Kido S, Yamamoto H, Iemori Y, Tatsumi S, Tsugawa N, Okano T, Kobayashi T, Miyamoto K, and Takeda E. Regulation of type II renal Na+-dependent inorganic phosphate transporters by 1,25-dihydroxyvitamin D3. Identification of a vitamin D-responsive element in the human NAPi-3 gene. J Biol Chem 273: 1457514581, 1998.[Abstract/Free Full Text]
- Taufiq S, Collins JF, Meaney J, and Ghishan FK. Dietary regulation of the renal sodium-phosphate (Na+/Pi) transporter during early ontogeny in the rat. Proc Soc Exp Biol Med 215: 281289, 1997.[CrossRef][Medline]
- Tilghman SM and Belayew A. Transcriptional control of the murine albumin/alpha-fetoprotein locus during development. Proc Natl Acad Sci USA 79: 52545257, 1982.[Abstract/Free Full Text]
- Werner A, Kempson SA, Biber J, and Murer H. Increase of Na/Pi-cotransport encoding mRNA in response to low Pi diet in rat kidney cortex. J Biol Chem 269: 66376639, 1994.[Abstract/Free Full Text]
- Xie Y, Madelian V, Zhang J, Ling G, and Ding X. Activation of the NPTA element of the CYP2A3 gene by NFI-A2, a nasal mucosa-selective nuclear factor 1 isoform. Biochem Biophys Res Commun 289: 12251228, 2001.[CrossRef][Web of Science][Medline]
- Xu H, Bai L, Collins JF, and Ghishan FK. Age-dependent regulation of rat intestinal type IIb sodium-phosphate cotransporter by 1,25-OH2 vitamin D3. Am J Physiol Cell Physiol 282: C487C493, 2002.[Abstract/Free Full Text]
- Xu H, Bai L, Collins JF, and Ghishan FK. Molecular cloning, functional characterization, tissue distribution, and chromosomal localization of a human, small intestinal sodium-phosphate (Na+-Pi) transporter (SLC34A2). Genomics 62: 281284, 1999.[CrossRef][Web of Science][Medline]
- Xu H, Collins JF, Bai L, Kiela PR, and Ghishan FK. Regulation of the human sodium-phosphate cotransporter NaPi-IIb gene promoter by epidermal growth factor. Am J Physiol Cell Physiol 280: C628C636, 2001.[Abstract/Free Full Text]
- Xu H, Inouye M, Hines ER, Collins JF, and Ghishan FK. Transcriptional regulation of the human NaPi-IIb cotransporter by EGF in Caco-2 cells involves c-myb. Am J Physiol Cell Physiol 284: C1262C1271, 2003.[Abstract/Free Full Text]
- Xu H, Uno JK, Inouye M, Xu L, Drees JB, Collins JF, and Ghishan FK. Regulation of intestinal NaPi-IIb cotransporter gene expression by estrogen. Am J Physiol Gastrointest Liver Physiol 285: G1317G1324, 2003.[Abstract/Free Full Text]
- Xu M, Osada S, Imagawa M, and Nishihara T. Genomic organization of the rat nuclear factor I-A gene. J Biochem (Tokyo) 122: 795801, 1997.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
H. Chen, H. Xu, J. Dong, J. Li, and F. K. Ghishan
Tumor necrosis factor-alpha impairs intestinal phosphate absorption in colitis
Am J Physiol Gastrointest Liver Physiol,
April 1, 2009;
296(4):
G775 - G781.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Hua, H. Xu, J. K. Uno, M. A. Lipko, J. Dong, P. R. Kiela, and F. K. Ghishan
Sp1 and Sp3 mediate NHE2 gene transcription in the intestinal epithelial cells
Am J Physiol Gastrointest Liver Physiol,
July 1, 2007;
293(1):
G146 - G153.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Driller, A. Pagenstecher, M. Uhl, H. Omran, A. Berlis, A. Grunder, and A. E. Sippel
Nuclear Factor I X Deficiency Causes Brain Malformation and Severe Skeletal Defects
Mol. Cell. Biol.,
May 15, 2007;
27(10):
3855 - 3867.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2005 by the American Physiological Society.