|
|
||||||||
MUCOSAL BIOLOGY
1Nashville VA Medical Center, and the Department of Surgery, Epithelial Biology Program, Vanderbilt-Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, Tennessee; 2Department of Gastrointestinal Surgery, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan; 3Augusta VA Medical Center and Department of Pathology and Institute of Molecular Medicine and Genetics, Medical College of Georgia, Augusta, Georgia; 4Department of Medicine, University of Massachusetts School of Medicine, Worcester, Massachusetts
Submitted 12 April 2004 ; accepted in final form 13 September 2004
| ABSTRACT |
|---|
|
|
|---|
hyperplasia; trefoil proteins; metaplasia; spasmolytic polypeptide; transdifferentiation
80 days in parietal cells and 200 days in chief cells (17, 20).
The process of differentiation of specific cell lineages from the progenitor zone is regulated by both hormonal and paracrine regulators, including transforming growth factor (TGF)-
(5, 36), histamine (24, 32), and gastrin (8, 25). Metallothionein-TGF-
transgenic mice demonstrate expansion of the surface cell compartment of fundic glands along with a marked decrease in parietal cell and chief cell numbers (3, 12). Wheras histamine decarboxylase-deficient mice have relatively normal gastric lineage profiles (39), mice with targeted H2-histamine receptor knock out demonstrate foveolar hyperplasia and hypersecretion of TGF-
(24, 32).
Gastrin is the hormone most associated with lineage differentiation in the stomach (8, 15). The CCK-B/gastrin receptor is expressed in parietal and enterochromaffin-like (ECL) cells (4, 38), and gastrin stimulates the secretory function as well as the production of these cell lineages (23, 33, 40). Elevated levels of serum gastrin induce expansion of parietal cell numbers in patients with gastrinoma (30). Actin-gastrin transgenic mice, which demonstrate gastrin levels in excess of 500 pg/ml, develop foveolar hyperplasia and small-sized parietal cells without significant increases in the number of the parietal cells (26, 29). Insulin-gastrin transgenic mice are also hypergastrinemic and develop foveolar hyperplasia early in life (41). Gastrin-deficient mice have reduced fundic mucosal thickness and fewer parietal cells compared with wild-type mice (11, 25).
Recently, we have reported (13) a model for pharmacological induction of oxyntic atrophy with DMP-777. DMP-777 is a cell-permeant neutrophil elastase inhibitor, which also acts as a parietal cell-specific protonophore and specifically ablates parietal cells. Treatment of rats with DMP-777 for 3 mo induced oxyntic atrophy and expansion of the surface cell compartment as well as the emergence from the base of fundic glands of a metaplastic mucous cell lineage expressing TFF2/spasmolytic polypeptide (SPEM) (13). We have also observed SPEM in mice infected with Helicobacter felis (42), in humans with fundal predominant H. pylori gastritis (35), and in the mucosa surrounding gastric adenocarcinoma (14, 35, 45). These results support the hypothesis that loss of parietal cells may be a primary event in the evolution of the spectrum of lineage changes. Because DMP-777 causes rapid elevations in serum gastrin secondary to hypochlorhydria, histological changes caused by the DMP-777 treatment may accrue from the influences of high serum gastrin. We have now investigated alterations in cell lineages in the stomachs of both C57BL/6 mice and gastrin-deficient mice treated acutely with DMP-777. Our results demonstrate that DMP-777 treatment of wild-type mice elicits a phenotype similar to that seen in rats with acute oxyntic atrophy, acute foveolar hyperplasia, and the emergence of SPEM after 7 days of treatment. In contrast, whereas DMP-777 treatment in gastrin-deficient mice does cause a loss of parietal cells, no foveolar hyperplasia is observed and SPEM is induced after only 1 day of treatment. The results indicate that gastrin exerts a major influence on the response of the gastric mucosa to acute oxyntic atrophy.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DMP-777, formulated at a concentration of 2% as a suspension in 0.5% methylcellulose, was a gift of DuPont Pharmaceuticals. C57BL/6 mice (8 wk of age) and gastrin-deficient mice (8 wk of age) were administrated DMP-777 orally as a gavage (350 mg/kg) once daily. Groups of six mice each were killed before starting drug administration and after 1, 3, 7, 10, and 14 days of drug administration. Additionally, groups of six mice each received 14 days of DMP-777 treatment and were then killed 14 days after stopping drug administration (recovery period). For all mice, 2 h before death, 5-bromo-2'-deoxyuridine (BrdU; 200 mg/kg) in saline was injected intraperitoneally. At necropsy, the mice were perfused with 4% paraformaldehyde through the left ventricle for 10 min under anesthesia with avertin. The stomachs were excised, opened along the greater curvature, and 2-mm-wide strips parallel to the lesser curvature were taken, embedded in paraffin, and cut into 5-µm sections. Replicate sections were stained with hematoxylin and eosin (H&E) as well as diastase-resistant-periodic acid Schiff (DR-PAS).
Serum gastrin measurement. Blood was collected from the right ventricle of six mice treated with DMP-777 for 0, 1,7, and 14 days, after which time the mice were killed under anesthesia. The serum was isolated following centrifugation of the blood and was kept frozen until the time of the measurement. Serum gastrin was measured using a gastrin assay kit (Gastrin RIA kit II, Abott Japan, Tokyo, Japan).
In situ hybridization. The cRNA probe for TFF2 was constructed and labeled as previously described (31). Briefly, linearized template DNA (1 µg) was incubated for 2 h at 37°C in a buffer containing 10 mM DTT, 1 mM digoxigenin-11-NTP (Boehringer-Mannheim; Mannheim, Germany), and 40 U of T7 or Sp6 RNA polymerase. Sense cRNA probe of the same length as the antisense probe was also synthesized to determine specificity. Probe concentrations were estimated by agarose gel electrophoresis. C57BL/6 male mice and gastrin-deficient mice treated with DMP-777 or control gavage were perfusion fixed through left ventricle puncture for 10 min with 4% paraformaldehyde in PBS (pH 7.4) with RNASecure (Ambion), and the stomachs were excised, postfixed in fixative for 2 h, embedded in optimum cutting temperature compound (Sakura Finetek, CA) and frozen on dry ice. Cryostat sections (10 µm) were cut and postfixed in fixative for 2 h. The sections were dried for 20 min and immersed in methanol at 20°C overnight. Sections were treated with an acetylation solution (1.2% triethanolamine and 0.25% acetic anhydride) to block endogenous phosphatases. After being washed with PBS, the sections were prehybridized at 60°C for 60 min with hybridization solution containing 50% formamide, 5x sodium citrate saline (SSC; pH 7.0), 25 µg/ml yeast RNA, 0.5 mg/ml sheared salmon sperm DNA, and 5x Denhardts solution, followed by hybridization at 60°C for 16 h with the probes (1.5 µg/ml) diluted into the hybridization solution. The sections were washed in 5x SSC at 60°C for 1 min, in 0.2% SSC at 60°C for 1 h, and then at room temperature for 5 min, and then in a solution containing 1.16% maleic acid and 0.9% NaCl, adjusted to pH 7.5 using NaOH, for 5 min. Blocking was performed with blocking solution containing 2% blocking reagent (Roche, Indianapolis, IN), 0.1% Tween-20, and 10% normal goat serum at room temperature for 1 h. Sections were incubated overnight at 4°C with anti-digoxigenin antibody (Roche) diluted 1:5,000 in the blocking solution. The sections were washed in PBS containing 0.1% Tween-20 for 15 min four times and three times for 5 min each in 100 mM Tris (pH 9.5) containing 50 mM MgCl2, 100 mM NaCl, 0.1% Tween-20, and 1 mM Levamisol. Chromogen was developed at room temperature for 2 h to overnight with BM Purple AP substrate (Roche). The chromogen development was terminated by washing the slides in PBS. The sections were counterstained with nuclear fast red, dehydrated, penetrated, and mounted in Cytoseal XYL.
Quantitative real-time PCR. RNA was isolated from laser-capture microdissected deep fundic glandular cells from both C57BL/6 and gastrin-deficient mice treated with DMP-777 for 0, 1, or 7 days (3 animals at each treatment day). Ten thousand microdissected cells were collected from the deep cells of fundic glands from each animal, and total RNA was isolated using a Picopure RNA isolation kit (Arcturus). Reverse transcription was performed by mixing the 10.5 µl of extracted RNA with 250 ng of random hexamer primers (Promega) and incubating for 10 min at 70°C and termination on ice. The denatured RNA mixture was then mixed with 4 µl of 5x first-strand buffer, 2 µl of 2-deoxynucleotide 5'-triphosphate mix (10 mM each), 2 µl of 100 mM DTT, and 1 µl of PowerScriptRT (BD Biosciences) and incubated for 90 min at 42°C. The transcriptase was inactivated by incubation at 70°C for 15 min.
Quantitative real-time PCR was performed with a three-step method using the iCycler iQ real-time PCR detection system (Bio-Rad Laboratories, Hercules, CA). Each reaction was carried out in a 50-µl mixture consisting of iQ SYBRgreen Supermix (Bio-Rad Laboratories), additional MgCl2 for a final MgCl2 concentration of 4.0 mM, 0.2 µM of each primer, and 1 µl of template cDNA. The sense and the antisense primers were designed to cross exon-intron boundaries to avoid amplification from contaminating DNA (GAPDH sense: GGCATTGCTCTCAATGACAA; GAPDH antisense: GCCTCTCTTGCTCAGTGTCC; TFF2 sense: TGCTTTGATCTTGGATGCTG; TFF2 antisense: GGAAAAGCAGCAGTTTCGAC; IF sense: CTTGGCCCTGACCTGTATGT; IF antisense: TAGGTTGCTCAGGTGTCACG). All primer pairs were optimized to amplify only a single band with amplification curves in real-time PCR consistent with efficient amplification under the reaction conditions. The PCR conditions were as follows: 95°C for 3 min, followed by 50 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s.
Quantification of cDNA template in each sample was determined using the comparative threshold cycle (CT) method. Levels requiring 36 or more cycles to achieve threshold were considered nondetectable. Real-time PCR CT data were converted to a relative fold change using the comparative method with GAPDH signal as the normalizer for each sample. The GAPDH CT was subtracted from the CT for the marker of interest, giving the
CT for each marker. To compare the relative gene expression between two samples, the
CT for the reference sample was subtracted from the
CT for the sample of interest, which yielded the 
CT. The fold change of expression between two samples was calculated using the formula: fold change = 2
Ct. The SD for each
CT was calculated, and the range for fold change was calculated using 
CT ± 1 SD. The P values corresponding to each comparison were determined using the Mann-Whitney U-test to compare the mean
CT between the two samples.
Immunohistochmistry. Murine monoclonal anti-H/K-ATPase IgG (a gift from Dr. Adam Smolka, Medical University of South Carolina, Charleston, SC), murine monoclonal anti-hTFF2 IgM (a gift from Dr. Nicholas Wright, Cancer UK, London, England), and rabbit polyclonal anti-human IF (a gift from Dr. David Alpers, Washington University, St. Louis, MO) were used as markers to identify parietal cells, mucous neck cells, and chief cells in fundic glands, respectively. For immunohistochemistry of anti-H/K-ATPase and anti-hTFF2, deparaffinized sections were blocked using blocking serum provided in the HistoMouse staining kit (Zymed, South San Francisco, CA). Sections were incubated with a primary antibody (1:1,000 and 1:100 for anti-H/K-ATPase and anti-hTFF2, respectively) overnight at 4°C. Indirect immunohistochemical detection was then performed through incubation with biotinylated secondary antibodies and alkaline phosphatase-conjugated streptavidin (Vectastain ABC KIT, Vector Laboratories, Burlingame, CA). Chromogen was developed with Vector Red (Vector Laboratories).
For immunohistochemistry with anti-IF, deparaffinized sections were blocked with 1.5% normal goat serum and incubated with a primary antibody (1:1,000) overnight at 4°C followed by incubation with a biotinylated second antibody and alkaline phosphatase-conjugated streptavidin. Chromogen was developed with Vector Red.
For immunohistochemistry of BrdU, a BrdU staining kit (Zymed) was used following the recommended instructions. In brief, sections were incubated in 0.25% trypsin for 10 min, followed by blocking of endogenous peroxidase activity with 3% H2O2. After incubation with a blocking serum, sections were incubated with biotinylated murine monoclonal anti-BrdU overnight at 4°C followed by incubation with horseradish peroxidase-conjugated streptavidin. Chromogen was developed with diaminobenzidine (Biogenex, San Ramon, CA).
For all immunostaining, the sections were counterstained with Gills hematoxylin and mounted. Sections were viewed and photographed on a Zeiss Axiophot bright-field microscope equipped with an Axiovision digital imaging system.
Immunofluorescence. For double staining with anti-TFF2 and anti-IF, deparaffinized sections were blocked with blocking serum provided in the mouse on mouse (MOM) staining kit (Vector) and incubated with anti-hTFF2 (1:100) and anti-human IF (1:1,000) at the same time overnight at 4°C, followed by incubation with Cy2-labeled anti-rabbit IgG and Cy3-labeled anti-mouse IgM. After being washed with PBS, sections were labeled with 50 µg/ml 4,6-diamino-2-phenylindole (DAPI) in 50 mM sodium phosphate for 10 min and mounted using Prolong antifade (Molecular Probes). Sections were viewed and photographed on a Zeiss Axiophot fluorescence microscope, and digital images were captured using a SPOT digital charge-coupled device camera.
Cell indexes. To quantitate cell numbers in the gastric mucosa, a section on the anterior side of the stomach that showed fundic glands was chosen from each animal. Ten fundic glands were chosen from each section visualized at x400 on a Zeiss Axiophot microscope, and PAS-positive cells, hTFF-positive cells, IF-positive cells, H/K-ATPase-positive cells, and BrdU-positive nuclei were counted and expressed as cells per gland. TFF2 and IF double immunofluorescent staining cells were counted in overlayed images using Adobe Photoshop.
Statistics. The differences in cell numbers were evaluated by ANOVA with post hoc comparison of significant means with Dunnetts test.
| RESULTS |
|---|
|
|
|---|
Serum gastrin. In rats, DMP-777 elicited a rapid rise in serum gastrin (13). Serum gastrin was measured to evaluate the effects of DMP-777 treatment in mice. Serum gastrin levels in gastrin knockout mice were not detectable either before or after treatment with DMP-777 (data not shown). The mean serum gastrin in wild-type mice without treatment with DMP-777 was 75.8 pg/ml (Fig. 1). After 1 day of treatment of DMP-777, the mean serum gastrin of wild-type mice rose to 350.7 pg/ml. Gastrin levels increased to 540.3 pg/ml after 7 days of treatment and remained elevated to 518.2 pg/ml after 14 days of treatment (Fig. 1).
|
-subunit of the H/K-ATPase (37). In wild-type mice, parietal cell numbers decreased to 28% of control mice after only 1 day of treatment and further declined to 1315% of control after 3 days of DMP-777 treatment (Fig. 2). The remaining parietal cells often appeared vacuolated and were scattered through the middle portion of the gland (Fig. 2). Whereas parietal cell numbers appeared to recover somewhat between 7 and 14 days of treatment, the parietal cell mass was still significantly reduced compared with control. After cessation of DMP-777 treatment, oxyntic atrophy was completely reversed. Parietal cell numbers increased, and after 14 days of recovery, we observed significantly increased numbers of parietal cells (Fig. 2).
|
Surface mucous cells. To evaluate surface mucous cells, we stained sections for DR-PAS (Fig. 3). In wild-type mice, during the drug-treatment period, DR-PAS-positive cells increased rapidly with DMP-777 administration and were significantly increased compared with the control mice after only 1 day of treatment (Fig. 3). Foveolar hyperplasia reached a maximum after 3 days of DMP-777 administration with a 219% increase in DR-PAS-positive cells over control mice. The surface cell numbers remained significantly elevated throughout the 14 days of treatment (Fig. 3). Foveolar hyperplasia was completely reversible, and withdrawal of drug led to a decline in DR-PAS-positive cells to somewhat smaller numbers compared with the control mice 14 days after cessation of treatment.
|
Labeling of S-phase proliferating cells. BrdU staining was used to assess proliferating cell lineages. In wild-type mice, BrdU-positive nuclei increased dramatically after only 1 day of DMP-777 treatment and remained significantly elevated throughout the drug-treatment period in wild-type mice (Fig. 4A). After 3 days of drug treatment, BrdU-labeled cells were mostly present in the midgland region deep to regions of foveolar hyperplasia (Fig. 4A). However, BrdU-labeled cells were also apparent in the deep portions of the mucosa (Fig. 4). By 7 days of treatment with DMP-777, the BrdU labeling index reached 612% of the level in control mice (Fig. 4B). On days 10 and 14, BrdU-labeled cells were present throughout the basal regions of the gland extending up the glands to the regions of foveolar hyperplasia (Fig. 4A). Fourteen days after cessation of DMP-777 treatment, the BrdU labeling index decreased back toward control levels, and there was a complete loss of BrdU labeling cells from the basal cells of fundic glands.
|
IF immunoreactive cells. In the normal murine gastric mucosa, expression of IF is confined to chief cells (6). DMP-777 treatment caused a significant decrease in the number of IF-positive cells after 1, 3, and 7 days of drug administration with 62, 31, and 40% of control numbers, respectively (Fig. 5). However, by 10 days of treatment, the number of IF immunoreactive cells increased but remained significantly different from control numbers. As expected, IF-positive cells were located at the base of the mucosa in the untreated animals (Fig. 5A), and the immunoreactive cells observed at days 10 and 14 of treatment also were located at the base of the mucosa.
|
TFF2-expressing cell lineages. TFF2 is expressed in the normal gastric mucosa in mucous neck cells located in the middle portion of the fundic glands (12). In wild-type mice, treatment with DMP-777 caused an initial decline in the numbers of TFF2-positive cells after 1 day of drug administration (Fig. 6A). By 3 days of treatment, there was a noticeable loss of normally staining mucous neck cells (Fig. 6). However, TFF2-positive cell numbers increased after 7 days of treatment. After 10 and 14 days of treatment, the number of TFF2 immunoreactive cells had increased significantly to 189 and 234% of control levels, respectively (Fig. 6B). The TFF2 immunoreactive cells were located at the base of the glands and displayed more intense staining similar to that seen for TFF2 staining of Brunners gland or deep antral gland cells consistent with the SPEM cell phenotype (Fig. 6A). By 14 days of treatment, we observed glands where up to 50% of the gland length was dominated by intensely stained TFF2-expressing cells. After withdrawal of drug treatment for 14 days, both the number of TFF2 staining cells and the pattern of staining returned to the morphological appearance of normal mucous neck cells (Fig. 6).
|
TFF2 and IF double immunostaining cells. We have recently noted that cells at the base of glands containing SPEM display dual expression of both IF and TFF2 (44). We therefore used dual immunofluorescence labeling to examine staining for TFF2 and IF in wild-type and gastrin-deficient mice treated with DMP-777. Figure 7 demonstrates that few cells in the normal mucosa of wild-type mice showed any dual staining. When quantitated, we observed only 0.28 dual-stained cells per gland in untreated mice (Fig. 7B). When a dual staining cell was observed, it was located at the junction between the mucous neck cell and chief cell zones (Fig. 7A). In contrast, after 7 days of DMP-777 treatment, we observed an increased number of cells with dual staining for both IF and TFF2. By days 10 and 14 of treatment, there were a significant number of dual-labeled cells per gland (3.95 and 2.5, respectively; Fig. 7). In contrast with the normal mucosa, in the 10- and 14-day-treated mice, the dual staining was present in cells located at the base of glands (Fig. 7). Dual fluorescence staining demonstrated that TFF2 and IF were in different vesicle populations in the dual-staining cells (Fig. 7A). In addition, whereas IF staining localized to the apical region of chief cells, in IF/TFF2 dual-staining cells, IF staining vesicles were more diffusely distributed throughout the cytoplasm. Most of the IF immunoreactive cells were also immunostained for TFF2. However, cells expressing only TFF2 but maintaining the same SPEM morphology extended into the middle region of the glands. After the 14 days of recovery from treatment, dual-staining cells disappeared from the deep fundic glands and their numbers declined to control levels (Fig. 7).
|
|
|
| DISCUSSION |
|---|
|
|
|---|
, amphiregullin, and heparin-binding EGF (1, 2, 28). Thus the loss of parietal cells may eliminate important agents required for appropriate differentiation of deeper gland lineages, such as mucous neck and chief cells, as well as increase the serum gastrin level as a result of hypochlorhydria. In the present investigation, to distinguish the effects of hypergastrinemia during oxyntic atrophy, we have used detailed cell-lineage analysis to clarify the effects of DMP-777 administration to C57BL/6 mice and to gastrin-deficient mice. The results demonstrate that although gastrin is required for the induction of foveolar hyperplasia, gastrin is not required for the induction of SPEM following acute loss of parietal cells. These findings differentiate the processes of foveolar hyperplasia and mucous cell metaplasia and establish the multifactorial regulation of gastric lineage differentiation associated with oxyntic atrophy.
Foveolar hyperplasia is caused by gastrin.
The drug-induced loss of parietal cells in C57BL/6 mice was accompanied by an immediate increase of serum gastrin associated with foveolar hyperplasia. However, in gastrin-deficient mice, the number of PAS-positive foveolar cells was not changed at all throughout the treatment and the recovery periods. These results suggest that the foveolar hyperplasia induced by DMP-777 treatment was caused by hypergastrinemia in response to hypochlorhydria. Previous investigations (26, 29, 41) have reported foveolar hyperplasia of less-differentiated pit cells in hypergastrinemic mice. TFF1, which is secreted from foveolar cells in the stomach, is under transcriptional control by gastrin (22). DMP-777 treatment caused a rapid rise in serum gastrin as well as the rapid onset of foveolar hyperplasia. This rapid response appears appropriate for the short-lived surface cells differentiating from the normal progenitor zone as the first adaptation of the mucosa to the loss of parietal cells. In humans, foveolar hyperplasia is one of the mucosal pathologies associated with oxyntic atrophy (7, 34). Foveolar hyperplasia is often associated with oxyntic atrophy following either chronic H. pylori infection or in Ménétriers disease patients (43). The general lack of hypergastrinemia in most Ménétriers disease patients is thought to be due to a TGF-
-induced increase in somatostatin secretion leading to suppression of gastrin release (46). Thus, whereas previous studies have associated hypergastrinemia with foveolar hyperplasia (26, 29, 41), the present investigations are the first to provide direct evidence that gastrin is responsible for the rapid emergence of foveolar hyperplasia in the setting of parietal cell loss and achlorhydria.
Oxyntic atrophy-induced mucous cell metaplasia. In addition to foveolar hyperplasia, a number of investigations has noted an association of goblet cell intestinal metaplasia with oxyntic atrophy in humans (9). We did not observe any goblet cell metaplasia in the stomachs of DMP-777-treated mice. Indeed, in contrast with humans, goblet cell-type intestinal metaplasia is not commonly seen in rodents. Nevertheless, as in rats (13), at the bases of gastric glands, we did observe the development of mucous cell metaplasia that displayed the characteristics of Brunners gland or deep antral gland cells. This SPEM lineage developed subsequent to the establishment of oxyntic atrophy after 7 days of drug administration in C57BL/6 mice. However, SPEM was present after only 1 day of DMP-777 treatment in gastrin knockout mice. The data suggest that the absence of gastrin and/or foveolar hyperplasia promote the early development of SPEM. In addition to the rapid emergence of the SPEM lineage in gastrin-deficient mice, we observed an early increase in the number of cells doubly immunoreactive for both TFF2 and IF. DMP-777 treatment also elicited a rapid induction of TFF2 mRNA expression in the deep fundic gland cells of gastrin-deficient mice treated with only one dose of DMP-777. In the wild-type gastric mucosa, TFF2 mRNA is expressed predominantly in progenitor cells, whereas protein is expressed in mucous neck cells (12, 31). In contrast, SPEM cells show high levels of both TFF2 mRNA and TFF2 protein (31). Because the emergence of SPEM was not associated with a significant increase in proliferation (BrdU-positive cells), the SPEM may originate from transdifferentiation of chief cells. Previous investigations (20) have suggested that chief cells have a long lifetime. Karam and Leblond (20) reported that chief cells were differentiated from mucous neck cells in the normal fundic gland. In untreated wild-type and gastrin-deficient mice, we observed few cells with dual staining for IF and TFF2, and TFF2 mRNA was nearly undetectable in microdissected deep glandular cells. The pattern of a loss of IF-expressing cells followed by the emergence of SPEM and dual IF/TFF2-staining cells in wild-type C57BL/6 mice also supports the notion of transdifferentiation.
Still, in wild-type C57BL/6 mice, the SPEM lineage emerged coincident with the observation of basally located BrdU-positive proliferative cells that appeared separate from the normal proliferative zone. We also observed a similar basally located BrdU-labeled cell population in rats treated with DMP-777 (13). We have previously suggested that SPEM might originate from a cryptic progenitor population located at the base of fundic glands. This basal progenitor zone position is similar to that observed in the gastric antrum. Indeed, the patten of foveolar hyperplasia and expansion of a basally located TFF2-expressing mucous cell population is consistent with a phenotype of "antralization." Such a cryptic progenitor cell could be a remnant of mucosal cells from development before the emergence of parietal cells. Under this model, factors secreted from parietal cells would normally suppress the proliferation of the cryptic progenitor cells. Nevertheless, we can rationalize both of the stated models if transdifferentiation of chief cells, in the absence of factors normally secreted by parietal cells, leads to a basally located cell population with proliferative capacity.
Whereas the presence of gastrin significantly altered the changes in cell lineages associated with treatment with DMP-777, it had a less prominent influence on the recovery from treatment. Previous investigations (15, 16) have suggested that gastrin levels regulate parietal cell mass. Indeed, the gastric mucosa of gastrin knockout mice does show a general attenuation of most of the mucosal cell lineages (11, 25). Still, in both wild-type and gastrin-deficient mice, the cessation of treatment was associated with a significant overshoot in the numbers of parietal cells. These results indicate that gastrin is not the only stimulator of parietal cell differentiation. In wild-type mice, other lineages recovered to levels similar to those in untreated mice. However, in gastrin-deficient mice, we still observed significant increases in SPEM and decreases in chief cell numbers 14 days after removal of drug treatment. These results indicate that a combined influence of parietal cells and gastrin are required for proper differentiation of chief cells. These findings are consistent with those of Li et al. (27), who demonstrated that loss of differentiated parietal cells in H/K-diphtheria toxin mice also cause a reduction in chief cell numbers. In addition, Franic et al. (10) have reported that H/K-ATPase
-subunit-deficient mice completely lost chief cells. The identity of key differentiation factors secreted by parietal cells remains to be determined.
Implications of the association of SPEM with oxyntic atrophy. Because parietal cell loss is associated with gastric cancer, an understanding of the changes in the gastric mucosa attendant with oxyntic atrophy is critical. In humans, a number of mucosal pathologies including SPEM is associated with oxyntic atrophy. In C57BL/6 mice, chronic infection with H. felis leads to profound oxyntic atrophy and SPEM (31, 42). Further evidence suggests that gastric cancer in H. felis-infected mice develops from SPEM (41). It remains to be determined whether eradication of Helicobacter infection can reverse all of the changes of oxyntic atrophy including SPEM. Nevertheless, the results here demonstrated that the emergence of SPEM is part of the normal response to oxyntic atrophy. It is tempting to speculate that a combination of foveolar hyperplasia and SPEM are part of a coordinated response to local injury in the fundic mucosa. Under this paradigm, the conversion of this acute response to a chronic condition especially under the influence of chronic inflammation could then predispose the mucosa to pathophysiological consequences including neoplasia.
In summary, DMP-777 treatment rapidly induced parietal cell loss in mice. In wild-type mice, the gastric mucosa responded to the loss of parietal cells with rapid expansion of surface cell numbers (foveolar hyperplasia), hypergastrinemia, and the induction of a TFF2 expressing mucous cell metaplasia (SPEM) after 7 days of treatment. Oxyntic atrophy in gastrin-deficient mice was accompanied by rapid induction of SPEM after only one dose of DMP-777 without foveolar hyperplasia. The results suggest that the expression of foveolar hyperplasia following loss of parietal cells is dependent on gastrin. However, the absence of gastrin did not prevent the emergence of SPEM following DMP-777 treatment. Rather, the absence of gastrin promoted the rapid emergence of SPEM in response to oxyntic atrophy, likely from transdifferentiation of chief cells. All of these findings support the concept that dynamic hormonal and paracrine influences control the differentiation of cell lineages in the gastric fundic mucosa.
| GRANTS |
|---|
|
|
|---|
Dr. Lee was supported by a Department of Veterans Affairs Merit Review.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* S. Nomura and H. Yamaguchi contributed equally to this work. ![]()
| REFERENCES |
|---|
|
|
|---|
in the pathogenesis of Menetriers disease: supportive evidence from humans and transgenic mice. Gastroenterology 103: 19501963, 1992.[Web of Science][Medline]
-subunit- and gastrin-deficient mice. Am J Physiol Gastrointest Liver Physiol 281: G1502G1511, 2001.
. Growth Factors 13: 111119, 1996.[Web of Science][Medline]
This article has been cited by other articles:
![]() |
S. P. Tu, A. L. Chi, W. Ai, S. Takaishi, Z. Dubeykovskaya, M. Quante, J. G. Fox, and T. C. Wang p53 inhibition of AP1-dependent TFF2 expression induces apoptosis and inhibits cell migration in gastric cancer cells Am J Physiol Gastrointest Liver Physiol, August 1, 2009; 297(2): G385 - G396. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Takaishi, S. Tu, Z. A. Dubeykovskaya, M. T. Whary, S. Muthupalani, B. H. Rickman, A. B. Rogers, N. Lertkowit, A. Varro, J. G. Fox, et al. Gastrin Is an Essential Cofactor for Helicobacter-Associated Gastric Corpus Carcinogenesis in C57BL/6 Mice Am. J. Pathol., July 1, 2009; 175(1): 365 - 375. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nozaki, V. Weis, T. C. Wang, A. Falus, and J. R. Goldenring Altered gastric chief cell lineage differentiation in histamine-deficient mice Am J Physiol Gastrointest Liver Physiol, June 1, 2009; 296(6): G1211 - G1220. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. J. Capoccia, W. J. Huh, and J. C. Mills How form follows functional genomics: gene expression profiling gastric epithelial cells with a particular discourse on the parietal cell Physiol Genomics, April 10, 2009; 37(2): 67 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zavros, M. Waghray, A. Tessier, L. Bai, A. Todisco, D. L. Gumucio, L. C. Samuelson, A. Dlugosz, and J. L. Merchant Reduced Pepsin A Processing of Sonic Hedgehog in Parietal Cells Precedes Gastric Atrophy and Transformation J. Biol. Chem., November 16, 2007; 282(46): 33265 - 33274. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Nitsche, S. Ramamoorthy, M. Sareban, N. Pausawasdi, and A. Todisco Functional role of bone morphogenetic protein-4 in isolated canine parietal cells Am J Physiol Gastrointest Liver Physiol, September 1, 2007; 293(3): G607 - G614. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. G. Ramsey, J. M. Doherty, C. C. Chen, T. S. Stappenbeck, S. F. Konieczny, and J. C. Mills The maturation of mucus-secreting gastric epithelial progenitors into digestive-enzyme secreting zymogenic cells requires Mist1 Development, January 1, 2007; 134(1): 211 - 222. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lopez-Diaz, K. L. Hinkle, R. N. Jain, Y. Zavros, C. S. Brunkan, T. Keeley, K. A. Eaton, J. L. Merchant, C. S. Chew, and L. C. Samuelson Parietal cell hyperstimulation and autoimmune gastritis in cholera toxin transgenic mice Am J Physiol Gastrointest Liver Physiol, May 1, 2006; 290(5): G970 - G979. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ogawa, S. Nomura, A. Varro, T. C. Wang, and J. R. Goldenring Altered metaplastic response of waved-2 EGF receptor mutant mice to acute oxyntic atrophy Am J Physiol Gastrointest Liver Physiol, April 1, 2006; 290(4): G793 - G804. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |