AJP - GI Track the topics, authors and articles important to you
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 288: G496-G500, 2005; doi:10.1152/ajpgi.00167.2004
0193-1857/05 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (15)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Radanovic, T.
Right arrow Articles by Biber, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Radanovic, T.
Right arrow Articles by Biber, J.

MUCOSAL BIOLOGY

Regulation of Intestinal Phosphate Transport I. Segmental expression and adaptation to low-Pi diet of the type IIb Na+-Pi cotransporter in mouse small intestine

Tamara Radanovic, Carsten A. Wagner, Heini Murer, and Jürg Biber

Institute of Physiology, University Zürich, Zürich, Switzerland

Submitted 16 April 2004 ; accepted in final form 21 October 2004


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The Na+-Pi cotransporter NaPi-IIb (SLC34A2) has been described to be involved in mouse small intestinal absorption of Pi and to be regulated by a number of hormones and metabolic factors. However, a possible segmental expression of NaPi-llb in small intestine has not been addressed so far. Here, we describe that the NaPi-IIb cotransporter is highly abundant in the ileum of mouse small intestine, whereas it is almost absent in the duodenum and in the jejunum. Na+-Pi cotransport studies with isolated brush border membranes confirmed that NaPi-IIb cotransport is highest in the ileum. Upregulation by a low-phosphate diet of NaPi-IIb and NaPi-IIb cotransport was observed both in the jejunum and the ileum. Furthermore, evidence is provided that a low-phosphate diet provokes an increase of the NaPi-IIb mRNA abundance along the entire small intestine. These data suggest that in mouse small intestine, phosphate is absorbed transcellulary by an Na+-dependent pathway in the ileum, whereas in the duodenum and jejunum, this pathway is of minimal importance. Furthermore, we conclude that along the entire mouse small intestine, low-phosphate diet affects transcription and/or the stability of NaPi-IIb mRNA.

enterocytes; sodium-inorganic phosphate cotransport; phosphate diet


IN MONOGASTRIC ANIMALS, the small intestine represents the unique site where Pi enters the body. For intestinal Pi absorption, both transcellular and paracellular pathways have been described and considered. Transcellular Pi flux is regulated by a variety of hormones and metabolic factors, whereas the paracellular pathway appears to be dependent on the magnitude of electrochemical gradients across the intestinal epithelium. This later transport pathway is still controversial and may predominate at high intraluminal concentrations of Pi, such as during the intake of a meal (for reviews, see Refs. 5, 7, 14).

Transcellular intestinal absorption of Pi is initiated by a sodium-dependent transport of Pi across the apical (brush border) membrane as has been demonstrated with intact tissue preparations or isolated brush border membrane vesicles (BBMV) (5, 7). Independent of the technique and species used, the apparent Km value for Pi was reported to be between 0.1 and 0.2 mM, and lowering the external pH value resulted in a modest increase of the transport rate. Furthermore, intestinal Na+-dependent absorption of Pi is regulated by a number of hormones and metabolic factors such as 1,25-dihydoxy-vitamin D3 [1,25(OH)2D] and low dietary intake of Pi (5, 7, 10, 14).

The Na+-Pi cotransporter NaPi-IIb, a member of the type II Na+-Pi cotransporter family SLC34 (16), was shown to be localized at the apical membrane of enterocytes (11). After heterologous expression of NaPi-IIb in Xenopus laevis oocytes, it has been demonstrated that NaPi-IIb-mediated Pi transport is obligatory dependent on the presence of sodium and exhibits apparent Km values of ~50 µM for Pi and 40 mM for sodium ions. On the basis of these results, it was concluded that transcellular Na+-dependent absorption of Pi in the intestine is initiated by the Na+-Pi cotransporter NaP-llb (9). The abundance of the type IIb Na+-Pi cotransporter was shown to be regulated by a low-Pi diet, 1,25(OH)2D (9, 12), glucocorticoid (1), estrogen (23), the epidermal growth factor (22), aging (21), and metabolic acidosis (17a). However, except in the latter study, a possible segmental distribution of the NaPi-llb expression along the small intestine has not been addressed. Several in vivo and in vitro studies documented that the majority of phosphate is reabsorbed in the duodenum and/or early jejunum (5, 7, 14). However, the possibility that considerable Pi absorption occurs also in the ileum has been reported as well. This was explained (e.g., in rats) by a longer dwell time when compared with the duodenal/jejunal transit (13, 14).

Here, we show that in mouse small intestine, NaPi-IIb is expressed in the ileum and that NaPi-IIb is almost absent in the duodenum and in the jejunum. Segmental expression of NaPi-IIb was confirmed by NaPi-IIb cotransport experiments using purified BBMVs, Western blot analyses, and real-time PCR. Adaptation to a low-Pi diet resulted in an increase of the abundance of NaPi-IIb protein in the jejunum and the ileum. In addition, and in contrast to earlier studies (9, 12), low-Pi diet led to an increase of the abundance of NaPi-IIb mRNA, indicating that upregulation of the NaPi-IIb protein involves a transcriptional mechanism or an increased stability of the mRNA.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animal studies. All experiments were performed with adult (10- to 12-wk old) male NMRI mice purchased from Charles River Laboratories (Germany). After arrival, the animals were fed with a normal laboratory chow. Normal drinking water was supplied ad libitum. For adaptation to dietary phosphate (Pi), animals were fed for 5 days with diets containing either high Pi (1.1%) or low Pi (0.1%; Provimi Kliba, Kaiseraugst, Switzerland). All experiments were conducted according to the guidelines of the Veterinäramt of the Kanton Zürich/Switzerland.

Isolation of BBMVs and transport studies. Small intestines were removed from animals, rinsed with ice-cold 0.9% NaCl, and inverted using a thin metal stick. The mucosa was scraped off from individual intestinal segments (duodenum = first centimeter; jejunum = 2–15 cm; and ileum = last 25 cm) or from whole small intestine and homogenized (Omnimixer, setting 6, 90 s) in 15 ml of 300 mM mannitol, 5 mM EGTA, 5 mM HEPES/Tris (pH 7.1), and 0.1 mM phenylmethylsulfonyl fluoride at 4°C. After dilution with 20 ml of cold water, BBMV were prepared by the Mg2+-precipitation technique as described (18). Final membranes were resuspended in 300 mM mannitol, 20 mM HEPES/Tris (pH 7.2) at a concentration of ~10–15 mg total protein, which was determined according to Bradford (3). Each preparation contained membranes from small intestines of three to four animals.

The transport rate of phosphate into BBMV was measured as described (10) at 25°C in the presence of inwardly directed gradients of 100 mM NaCl or 100 mM KCl and 0.3 mM K-phosphate. Phosphate uptake was determined after 90 s and after 90 min to determine the equilibrium values.

Western blot analysis. Depending on the origin, 30–60 µg of purified BBMVs were separated by 10% SDS-PAGE after denaturation, without heating, in 2% SDS, 1 mM EDTA, 10% glycerol, 85 mM Tris·HCl (pH 6.8). After transfer of separated proteins onto nitrocellulose membranes, membranes were blocked with 5 phenylmethylsulfonyl fluoride nonfat milk powder and 0.5% Triton X-100 in TBS (150 mM NaCl, 25 mM Tris·HCl, pH 7.3) for 2 h. NaPi-IIb was detected with a rabbit polyclonal antiserum raised against a synthetic peptide derived from the NH2 terminus of NaPi-IIb (11). A polyclonal anti-calbindin D9k antibody was purchased from Swant (Bellinzona, Switzerland; dilution 1:10,000). {beta}-actin, which was used as a loading control, was detected either by a staining with Ponceau rouge or by using a monoclonal anti-{beta}-actin antibody (Sigma, St. Louis, MO; dilution 1:6,000). Binding of primary antibodies was visualized with anti-rabbit or anti-mouse IgG antibodies conjugated to horseradish peroxidase (Amersham Pharmacia Biotech, Germany) and enhanced chemiluminescence (Pierce, Switzerland). Denistometric analysis was performed using the imaging system Diana III and analyzed with the Aida software (Raytest, Germany).

Immunofluorescence. For immunohistochemistry, samples (~0.5 cm) from the small intestine were taken every 5 cm (starting at the stomach pylorus) along the whole small intestine and were fixed by immersion. The fixative was composed of 3% paraformaldehyde and 0.05% picric acid in a 6:4 mixture of 0.1 M cacodylate buffer (pH 7.4, adjusted to 300 mosm/kgH2O with sucrose) and 10% hydroxyethyl starch in saline (HAES steril; Fresenius, Bad Homburg, Germany) (2). After 4 h, the samples were washed twice with PBS (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.3), frozen rapidly after cryoprotection, and stored at –80°C. Cryosections (4–5 µm) were processed for immunofluorescence as reported (6). Briefly, after pretreatment for 30 min in PBS containing 3% defatted milk powder and 0.2% Triton X-100, samples were incubated overnight at 4°C with an anti-rabbit polyclonal antibody against the NaPi-IIb protein at a dilution 1:250. Sections were then incubated for 30 min with swine anti-rabbit IgG conjugated to FITC (Dakopatts, Glostrup, Denmark) at a dilution 1:50 (room temperature). Finally, the sections were covered with coverslips using DAKO-Glycergel (Dakopatts), containing 2.5% 1,4-diazabicyclo (2.2.2.) octane (DABCO; Sigma) as a fading retardant, and analyzed on a fluorescence microscope (Nikon Eclipse TE300).

Real-time PCR. Total RNA from jejunal and ileal mucosa (~30 mg) was extracted using RNeasy Mini Kit (Qiagen, Cologne, Germany) according to manufacturer’s instructions. First-strand cDNA synthesis from total RNA was made in a reaction volume of 50 µl using TaqMan reverse transcription reagents (Applied Biosystems) with random hexamers according to the manufacturer’s instructions. Relative quantitation of NaPi-IIb mRNA was done using the ABI PRISM 7700 Sequence Detection System (Applied Biosystems) with {beta}-actin as an internal standard. The sequences of TaqMan probes (Applied Biosystems, for NaPi-IIb; Biosearch Technologies, for {beta}-actin) and primers (Applied Biosystems, for NaPi-IIb; Microsynth, Switzerland for {beta}-actin) were as follows: 5'-(6-FAM) TGGTCAGAGAGAGACAC (BHQ-1)-3' (probe), 5'-CCTGGGACCTGCCTGAACT-3' (forward), 5'-AATGCAGAGCGTCTTCCCTTT-3' (reverse) for NaPi-IIb, and 5'-(6-FAM) CCATGAAGATCAAGATCATTGCTCCTCCT (BHQ-1)-3' (probe), 5'-GACAGGATGCAGAAGGAGATTACTG-3' (forward), 5'-CCACCGATCCACACAGAGTACTT-3' (reverse) for {beta}-actin. TaqMan probes were set across exon-exon boundaries to exclude any amplification of genomic DNA. PCR reactions in a volume of 25 µl, containing 900 nM gene specific primers and 250 nM probes, were performed using TaqMan Universal PCR Master Mix (Applied Biosystems). After incubation with uracil-N-glycosylase (2 min at 50°C) and activation of AmpliTaq Gold DNA polymerase (10 min at 95°C), the samples were amplified by 45 cycles at 95°C for 15 s and 60°C for 1 min. Relative expression was calculated according to user bulletin #2 of the ABI PRISM 7700 Sequence Detection System (available for download at http://home.appliedbiosystems.com).

Statistics. All data (means ± SD) were tested for significance by applying the unpaired Student’s t-test. Differences at the level of P < 0.05 were considered as significant.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The distribution of NaPi-IIb along the small intestine of male adult mice that were fed with a normal laboratory chow containing ~0.8% of Pi, was assessed by immunofluorescence. As illustrated in Fig. 1, strong, NaPi-IIb-related immunostaining was observed at the brush borders of enterocytes in the ileum. In the jejunum (between 5 and 15 cm), NaPi-IIb-mediated immunostaining was barely detectable, whereas in the duodenum, NaPi-llb staining was faint and often scattered. Immunoblots performed with BBMVs isolated from the different intestinal segments are shown in Fig. 2. The highest abundance of NaPi-llb was detected in BBMV derived from the ileum. In BBMV isolated from the jejunum, NaPi-llb protein was barely detectable, and in BBMV obtained from the duodenum, NaPi-llb protein could never be detected by Western blot analysis. Next, Na+/Pi uptake studies were performed using BBMV isolated from the different segments. As shown in Fig. 2, significant Na+-dependent phosphate uptake was observed only in BBMV derived from the ileum. No significant Na-dependent Pi uptake was observed in BBMV derived from the duodenum or the jejunum.



View larger version (138K):
[in this window]
[in a new window]
 
Fig. 1. Distribution of the NaPi-IIb protein along mouse small intestine. At various distances (indicated in cm) starting from the pylorus, small intestinal rings were recovered and analyzed by immunofluorescence. Strong NaPi-llb-related immunofluorescence was observed at the apical site of enterocytes in the ileum (20–45 cm), whereas in the jejunum (5–15 cm), no immunostaining was detected. In the duodenum, the staining was faint and scattered. Phase contrast images are displayed to ensure for the intactness of the brush borders. *, Nonspecific staining of goblet cells.

 


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 2. Pi uptake and NaPi-IIb abundance in brush border membrane vesicles (BBMV) isolated from the jejunum or the ileum of mouse small intestine. As indicated, Pi uptake was determined in the presence of 100 mM NaCl or KCl. In all BBMV preparations, Na+-independent Pi uptakes and equilibrium values (taken after 90 min) were similar. The data represent the means ± SD of 4 uptake determinations. Three independent experiments with similar results were performed. Significant (*P < 0.05) Na-dependent Pi uptake was observed only in BBMV derived from the ileum. The same BBMV preparations (50 µg) were analyzed by Western blot analysis for NaPi-llb and as a control for {beta}-actin. NS, not significant.

 
Intake of a diet containing low Pi content has been established as a stimulus to increase intestinal Pi absorption (5, 7). To test to which extent different phosphate diets affect the abundance of NaPi-IIb in the different intestinal segments, mice were fed for 5 days with a high-Pi diet (1.1% Pi) or a low-Pi diet (0.1% Pi). Apical membranes were prepared separately from the duodenum, the jejunum, and the ileum, and samples for immunofluorescence and real time PCR were recovered as well.

Na+-dependent uptake of Pi into BBMV isolated from the jejunum or ileum of the differently fed mice is shown in Fig. 3. In BBMV isolated from mice fed with a high-Pi diet, the rates of NaPi-IIb cotransport did not differ from the ones observed in BBMV isolated from animals fed with a normal diet (compare with Fig. 2). In both jejunal and ileal BBMV prepared from mice fed a low-Pi diet, Na+-dependent uptake of Pi was increased compared with BBMV isolated from mice fed a high-Pi diet (Fig. 3). Western blot analysis of the respective BBMV preparations is shown in Fig. 4 and demonstrates that in both jejunal and ileal BBMVs, low-Pi diet provoked an increase of the abundance of the NaPi-IIb protein. In agreement with the increase of NaPi-IIb cotransport observed in ileal BBMV, the increase of the NaPi-llb/{beta}-actin ratio was 2.7 ± 0.9 (n = 3). After adaptation to a low-Pi diet for 5 days, NaPi-llb protein could not be detected BBMV isolated from the duodenum (data not shown). In addition to male mice, BBMV were also isolated from the jejunum and ileum of female mice. On the basis of Western blots (Fig. 4A), there was no difference between the distribution patterns (jejunum vs. ileum) of the NaPi-IIb protein between males and females. Also, there was no difference in the adaptive effect of low-Pi diet between the two genders. Additionally, BBMV were analyzed for the abundance of calbindin D9k (Fig. 4B). As shown, calbindin D9k was abundant in jejunal BBMV but absent in ileal BBMV derived from animals fed a high-Pi diet. Low-Pi diet provoked an increase of calbindin D9k, which was clearly detectable in ileal BBMVs.



View larger version (11K):
[in this window]
[in a new window]
 
Fig. 3. Pi uptake into BBMV isolated from mice fed either with a high- or a low-Pi diet for 5 days. Uptake of Pi was determined in the presence of 100 mM KCl (open bars) or in the presence of 100 mM NaCl (filled bars). Means ± SD of 4 determinations are shown; 3 independent experiments were performed. Signifcant (*P < 0.05) increase of Pi uptake in the presence of NaCl was observed in both BBMV populations.

 


View larger version (35K):
[in this window]
[in a new window]
 
Fig. 4. Western blot (WB) analysis for NaPi-IIb (A) or calbindin D9k (B) with BBMV isolated from male (m) and female (f) mice fed with a high- or a low-Pi diet. Loadings were 30 µg for ileal and 65 µg for jejunal BBMV. The band of {beta}-actin [visualized with ponceau rouge (PR)] served as a loading control.

 
Real-time PCR was performed with total RNA isolated from duodenal, jejunal, and ileal mucosa. Figure 5 displays the relative abundance of NaPi-llb mRNA (ratios of NaPi-llb mRNA to {beta}-actin mRNA). The Ct values for the amplification of {beta}-actin cDNA were similar in all segments (data not shown). As illustrated, NaPi-IIb mRNA was detected in all small intestinal segments of mice fed with a high-Pi diet. The highest amount of NaPi-IIb mRNA was found in the ileum and was slightly less in the jejunum. Compared with the jejunum and ileum, the relative abundance of NaPi-llb mRNA was ~100-fold less in the duodenum. Low-Pi diet resulted in an increase of the relative abundance of NaPi-IIb mRNA in all three small intestinal segments.



View larger version (13K):
[in this window]
[in a new window]
 
Fig. 5. Real-time PCR analysis of NaPi-IIb mRNA of small intestinal mucosa of animals fed a high- or a low-Pi diet. The data represent results obtained with samples obtained from 3 different animals of each condition (open, cross-hatched, and filled bars, respectively). The relative abundance of NaPi-llb mRNA is given as the ratio of the NaPi-llb mRNA over {beta}-actin mRNA (means ± SD of 3 determinations). The Ct values for {beta}-actin were similar in all samples analyzed.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
On the basis of transepithelial Pi flux measurements and uptake studies with isolated brush border membranes (e.g., of rabbits and rats), small intestinal absorption of Pi has been reported to occur mostly in the duodenum and at the beginning of the jejunum (5, 7, 14). There is ample evidence that in these small intestinal segments, transcellular transport of Pi is initiated by a sodium-dependent transport step through the apical membrane of the enterocytes. To date, the Na+-Pi cotransporter NaPi-IIb (SLC34A2; Ref. 16) represents the only known protein that mediates Na+-dependent transport of Pi through the apical membrane of the enterocytes (11). Yet, expression of NaPi-llb along the entire small intestine has not been addressed thus far.

In this study, expression of NaPi-llb and its correlation with Na/Pi cotransport activity was assessed in the small intestine of mouse. Interestingly, the highest amount of NaPi-IIb protein was detected in the ileum, whereas in the jejunum, the content of the NaPi-IIb protein was minimal. In agreement, the highest rate of NaPi-IIb cotransport was observed in BBMV isolated from the ileum, whereas in BBMV, isolated from the jejunum, Na+-dependent transport of Pi was not measurable. Although apical NaPi-llb was detectable by immunofluorescence in the duodenum, NaPi-llb could not be detected on immunoblots. Also, no Na-dependent Pi uptake could be measured in BBMV isolated from the duodenum. Thus the described localization of NaPi-llb suggests that in mouse small intestine, transcellular, Na+-dependent absorption of Pi occurs, to a large extent, in the ileum and is only minimal in the jejunum and duodenum. These data are in agreement with Pi-flux measurements, showing that Pi absorption in mice intestine is highest in the ileum and occurs only minimally in the other segments (E. Debnam, personal communication). Interestingly, it has been shown that in rat small intestine, when considering the different transit times, Pi is absorbed to equal extents (~1/3 of ingested Pi) in the ileum and in the duodenum (13). However, rat small intestinal localization of the NaPi-llb cotransporter remains to be determined.

Different factors have been described to regulate small intestinal Pi absorption (for review, see Refs. 5, 7, 14). In recent years, it has been shown that most of these factors alter the abundance of the NaPi-IIb protein in the apical membrane of the enterocytes (1, 9, 12, 2123). Here, we show that the abundance of the NaPi-IIb protein and of NaPi-IIb cotransport is increased by a low-Pi diet in the jejunum and in the ileum. In the duodenum, no evidence for an increase of these parameters was obtained. Furthermore, and in contrast to earlier reports (9, 12), an increase of the NaPi-llb mRNA content was observed in all intestinal segments; similar findings have been reported recently (17). Whereas in the jejunum and ileum, an increase of the NaPi-llb mRNA content was paralleled by an increase of the NaPi-llb protein, for reasons that cannot be explained, such a parallism could not be observed in the duodenum.

The effect of a low-Pi diet on NaPi-IIb mRNA suggests that the regulation of intestinal Pi absorption occurs via a transcriptional mechanism or via an increased stability of NaPi-IIb mRNA. Currently, neither the signal(s) nor the mechanism(s) leading to an increased amount of NaPi-IIb mRNA is known. Regulation of small intestinal NaPi-IIb cotransport by a low-Pi diet is assumed to be dependent on the stimulation of the renal 25-hydroxyvitamin-D3-1{alpha}-hydroxylase activity and the resulting increase of the serum concentration of 1,25(OH)2D (5, 19). Consequently, an increase of NaPi-IIb mRNA may be explained by a transcriptional regulation that involves the vitamin D receptor (VDR), similar to what was described for calbindin D9k (15). Indeed, upregulation of the latter by a low-Pi diet was detectable in ileal BBMV (see Fig. 4B). However, an involvement of VDR in the regulation by low-Pi diet of NaPi-IIb in intestine has recently been challenged because it was shown that upregulation of NaPi-IIb protein and mRNA was not altered in VDR-deficient mice compared with wild-type mice (4, 17). Thus, if 1,25(OH)2D acts via a nongenomic mechanism (8) or if other factors, such as, for example, FGF23 (20), may be involved in the upregulation by a low-Pi diet of intestinal Pi absorption remains to be determined.

In summary, our data demonstrate that along the mouse small intestine, the Na+-Pi cotransporter NaPi-IIb is inhomogenously expressed. The highest abundance of NaPi-IIb protein was found in the ileum, whereas in the duodenum and in the jejunum, the content of the NaPi-IIb protein was minimal or not detectable. On the basis of Na-Pi-transport studies, we conclude that in mouse small intestine, transcellular Pi reabsorption occurs to a significant amount in the ileum. Whether such segmental distribution of NaPi-IIb and Na/Pi cotransport is unique for the mouse small intestine or may also be present in other species remains to be analyzed.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Financial support was provided by Swiss National Funds Grant 31–61438.00 (to J. Biber).


    ACKNOWLEDGMENTS
 
The authors are grateful to E. Hänseberger for help in the preparation of the cryostat sections.


    FOOTNOTES
 

Address for reprint requests and other correspondence: J. Biber, Institute of Physiology, Univ. Zürich, Winterthurerstrasse 190, CH-8057 Zürich (E-mail: JuergBiber{at}access.unizh.ch)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Arima K, Hines ER, Kiela PR, Drees JB, Collins JF, and Gishan FK. Glucocorticoid regulation and glycosylation of mouse intestinal type IIb Na-Pi-cotransporter during ontogeny. Am J Physiol Gastrointest Liver Physiol 283: G426–G434, 2002.[Abstract/Free Full Text]
  2. Bacic D, Schulz N, Biber J, Kaislling B, Murer H, and Wagner CA. Involvement of the MAPK-kinase pathway in the PTH mediated regulation of the proximal tubule type lla Na+/Pi cotransporter in mouse kidney. Pflügers Arch 446: 52–60, 2003.[ISI][Medline]
  3. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 7: 248–254, 1976.[CrossRef]
  4. Capuano P, Radanovic T, Wagner CA, Bacic D, Kato S, Uchiyama Y, St-Arnoud R, Murer H, and Biber J. Intestinal and renal adaptation to a low Pi-diet of type ll Na-Pi-cotransporters in VDR and 1{alpha}-OHase deficient mice. Am J Physiol. In press, 2005.
  5. Cross HS, Debiec H, and Peterlik M. Mechanisms and regulation of intestinal phosphate absorption. Miner Electrolyte Metab 16: 115–124, 1990.[ISI][Medline]
  6. Custer M, Lötscher M, Biber J, Murer H, and Kaissling B. Expression of Na-Pi cotransport in rat kidney: localization by RT-PCR and immunohistochemistry. Am J Physiol Renal Fluid Electrolyte Physiol 266: F767–F774, 1994.[Abstract/Free Full Text]
  7. Danisi G and Murer H. Inorganic phosphate absorption in small intestine. Handbook of Physiology. Bethesda, MD: Am Physiol Soc, 1991, vol. IV, sect. 6, chapt. 12, p. 323–336.
  8. Falkenstein E, Tillmann HC, Christ M, Feuring M, and Wehling M. Multiple actions of steroid hormones-a focus on rapid, nongenomic effects. Pharmacol Rev 52: 513–556, 2000.[Abstract/Free Full Text]
  9. Hattenhauer O, Traebert M, Murer H, and Biber J. Regulation of small intestinal Na-phosphate cotransporter (NaPi type IIb) by dietary phosphate intake. Am J Physiol Gastrointest Liver Physiol 277: G756–G762, 1999.[Abstract/Free Full Text]
  10. Hildmann B, Storelli C, Danisi G, and Murer H. Regulation of Na+-Pi cotransport by 1,25-dihydroxyvitamin D3 in rabbit duodenal brush-border membranes. Am J Physiol Gastrointest Liver Physiol 242: G533–G539, 1982.[Abstract/Free Full Text]
  11. Hilfiker H, Hattenhauer O, Traebert M, Forster I, Murer H, and Biber J. Characterization of a new murine type II sodium-phosphate cotransporter expressed in mammalian small intestine. Proc Natl Acad Sci USA 95: 14564–14569, 1998.[Abstract/Free Full Text]
  12. Katai K, Miyamoto K, Kishida S, Segawa H, Nii T, Tanaka H, Tani Y, Arai H, Tatsumi S, Morita K, Taketani Y, and Takeda E. Regulation of intestinal Na-dependent phosphate cotransporters by a low-phosphate diet and 1,25-dihydroxyvitamin D3. Biochem J 343: 705–712, 1999.
  13. Kayne LH, Argenio DZ, Meyer JH, Hu MS, and Jamgotchian DB. Analysis of segmental phosphate absorption in intact rat: A compartmental analysis approach. J Clin Invest 91: 915 -922, 1993.[ISI][Medline]
  14. Kayne LH, Pham PC, Pham PT, and Lee DBN. Intestinal absorption of phosphate. In: Textbook of Nephrology (4th ed.), edited by Massry, SG, and Glassock RJ, 2001, p. 355–362.
  15. Li YC, Pirro AE, and Demay MB. Analysis of vitamin D-dependent calcium-binding protein messenger ribonucleic acid expression in mice lacking the vitamin D receptor. Endocrinology 139: 847–851, 1998.[Abstract/Free Full Text]
  16. Murer H, Forster I, and Biber J. The sodium phosphate cotransporter family SLC34. Pflügers Arch 447: 763–767, 2004.[CrossRef][ISI][Medline]
  17. Segawa H, Kaneko I, Yamanaka S, Ito M, Kuwahata M, Inoue Y, Kato S, and Miyamoto K. Intestinal Na/Pi cotransporter adaptation to dietary Pi content in vitamin D-receptor (VDR) null mice. Am J Physiol Renal Physiol 287: F39–F47, 2004.[Abstract/Free Full Text]
  18. Stauber A, Radanovic T, Stange G, Murer H, Wagner CA, and Biber J. Regulation of intestinal phosphate transport. II. Metabolic acidosis stimulates Na+-dependent phosphate absorption and expression of the Na+-Pi cotransporter NaPi-IIb in small intestine. Am J Physiol Gastrointest Liver Physiol 288: G501–G506, 2005.[Abstract/Free Full Text]
  19. Stieger B and Murer H. Heterogeneity of brush border membrane vesicles from rat small intestine prepared by a precipitation method using Mg/ETGA. Eur J Biochem 135: 95–101, 1983.[ISI][Medline]
  20. Tanaka Y and DeLuca HF. The control of 25-hydroxyvitamin D metabolism by inorganic phosphate. Arch Biochem Biophys 154: 566–574, 1973.[CrossRef][ISI][Medline]
  21. Yamashita T, Hasegawa H, Yamazaki Y, Kawata T, Urakawa I, Shimada T, Takeuchi Y, Fujita T, Fukumoto S, and Nagano N. Involvement of FGF2–23 in abnormal vitamin D and mineral metabolism associated with renal insufficiency (Abstract). J Am Soc Nephrol 13: 284A, 2002.
  22. Xu H, Bai L, Collins JF, and Gishan FK. Age-dependent regulation of rat intestinal type IIb sodium-phosphate cotransporter by 1,25-(OH)2 vitamin D3. Am J Physiol Cell Physiol 282: C487–C493, 2002.[Abstract/Free Full Text]
  23. Xu H, Collins JF, Bai L, Kiela PR, and Gishan FK. Regulation of the human sodium-phosphate cotransporter NaPi-llb gene promoter by epidermal growth factor. Am J Physiol Cell Physiol 280: C628–C636, 2001.[Abstract/Free Full Text]
  24. Xu H, Uno JK, Inoue M, Xu L, Drees JB, Collins JF, and Gishan FK. Regulation of intestinal NaPi-IIb cotransporter gene expression by estrogen. Am J Physiol Gastrointest Liver Physiol 285: G1317–G1324, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Am. Soc. Nephrol.Home page
J. Marks, L. J. Churchill, E. S. Debnam, and R. J. Unwin
Matrix Extracellular Phosphoglycoprotein Inhibits Phosphate Transport
J. Am. Soc. Nephrol., December 1, 2008; 19(12): 2313 - 2320.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Clin. Nutr.Home page
S. Kirchner, A. Muduli, D. Casirola, K. Prum, V. Douard, and R. P Ferraris
Luminal fructose inhibits rat intestinal sodium-phosphate cotransporter gene expression and phosphate uptake
Am. J. Clinical Nutrition, April 1, 2008; 87(4): 1028 - 1038.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J. F. Collins, Z. Hu, P. N. Ranganathan, D. Feng, L. M. Garrick, M. D. Garrick, and R. W. Browne
Induction of arachidonate 12-lipoxygenase (Alox15) in intestine of iron-deficient rats correlates with the production of biologically active lipid mediators
Am J Physiol Gastrointest Liver Physiol, April 1, 2008; 294(4): G948 - G962.
[Abstract] [Full Text] [PDF]


Home page
Nephrol Dial TransplantHome page
C. A. Wagner, J. Biber, and H. Murer
What goes in must come out the small intestine modulates renal phosphate excretion
Nephrol. Dial. Transplant., December 1, 2007; 22(12): 3411 - 3412.
[Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
L. V. Virkki, J. Biber, H. Murer, and I. C. Forster
Phosphate transporters: a tale of two solute carrier families
Am J Physiol Renal Physiol, September 1, 2007; 293(3): F643 - F654.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
K. B. Williams and H. F. DeLuca
Characterization of intestinal phosphate absorption using a novel in vivo method
Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1917 - E1921.
[Abstract] [Full Text] [PDF]


Home page
Poult. Sci.Home page
K. Huber, R. Hempel, and M. Rodehutscord
Adaptation of epithelial sodium-dependent phosphate transport in jejunum and kidney of hens to variations in dietary phosphorus intake.
Poult. Sci., November 1, 2006; 85(11): 1980 - 1986.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
J. Marks, S. K. Srai, J. Biber, H. Murer, R. J. Unwin, and E. S. Debnam
Intestinal phosphate absorption and the effect of vitamin D: a comparison of rats with mice
Exp Physiol, May 1, 2006; 91(3): 531 - 537.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
L. V. Virkki, H. Murer, and I. C. Forster
Voltage Clamp Fluorometric Measurements on a Type II Na+-coupled Pi Cotransporter: Shedding Light on Substrate Binding Order
J. Gen. Physiol., April 24, 2006; 127(5): 539 - 555.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. Stauber, T. Radanovic, G. Stange, H. Murer, C. A. Wagner, and J. Biber
Regulation of Intestinal Phosphate Transport II. Metabolic acidosis stimulates Na+-dependent phosphate absorption and expression of the Na+-Pi cotransporter NaPi-IIb in small intestine
Am J Physiol Gastrointest Liver Physiol, March 1, 2005; 288(3): G501 - G506.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (15)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Radanovic, T.
Right arrow Articles by Biber, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Radanovic, T.
Right arrow Articles by Biber, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2005 by the American Physiological Society.