|
|
||||||||
MUCOSAL BIOLOGY
Institute of Physiology, University Zürich, Zürich, Switzerland
Submitted 16 April 2004 ; accepted in final form 21 October 2004
| ABSTRACT |
|---|
|
|
|---|
enterocytes; sodium-inorganic phosphate cotransport; phosphate diet
Transcellular intestinal absorption of Pi is initiated by a sodium-dependent transport of Pi across the apical (brush border) membrane as has been demonstrated with intact tissue preparations or isolated brush border membrane vesicles (BBMV) (5, 7). Independent of the technique and species used, the apparent Km value for Pi was reported to be between 0.1 and 0.2 mM, and lowering the external pH value resulted in a modest increase of the transport rate. Furthermore, intestinal Na+-dependent absorption of Pi is regulated by a number of hormones and metabolic factors such as 1,25-dihydoxy-vitamin D3 [1,25(OH)2D] and low dietary intake of Pi (5, 7, 10, 14).
The Na+-Pi cotransporter NaPi-IIb, a member of the type II Na+-Pi cotransporter family SLC34 (16), was shown to be localized at the apical membrane of enterocytes (11). After heterologous expression of NaPi-IIb in Xenopus laevis oocytes, it has been demonstrated that NaPi-IIb-mediated Pi transport is obligatory dependent on the presence of sodium and exhibits apparent Km values of
50 µM for Pi and 40 mM for sodium ions. On the basis of these results, it was concluded that transcellular Na+-dependent absorption of Pi in the intestine is initiated by the Na+-Pi cotransporter NaP-llb (9). The abundance of the type IIb Na+-Pi cotransporter was shown to be regulated by a low-Pi diet, 1,25(OH)2D (9, 12), glucocorticoid (1), estrogen (23), the epidermal growth factor (22), aging (21), and metabolic acidosis (17a). However, except in the latter study, a possible segmental distribution of the NaPi-llb expression along the small intestine has not been addressed. Several in vivo and in vitro studies documented that the majority of phosphate is reabsorbed in the duodenum and/or early jejunum (5, 7, 14). However, the possibility that considerable Pi absorption occurs also in the ileum has been reported as well. This was explained (e.g., in rats) by a longer dwell time when compared with the duodenal/jejunal transit (13, 14).
Here, we show that in mouse small intestine, NaPi-IIb is expressed in the ileum and that NaPi-IIb is almost absent in the duodenum and in the jejunum. Segmental expression of NaPi-IIb was confirmed by NaPi-IIb cotransport experiments using purified BBMVs, Western blot analyses, and real-time PCR. Adaptation to a low-Pi diet resulted in an increase of the abundance of NaPi-IIb protein in the jejunum and the ileum. In addition, and in contrast to earlier studies (9, 12), low-Pi diet led to an increase of the abundance of NaPi-IIb mRNA, indicating that upregulation of the NaPi-IIb protein involves a transcriptional mechanism or an increased stability of the mRNA.
| METHODS |
|---|
|
|
|---|
Isolation of BBMVs and transport studies.
Small intestines were removed from animals, rinsed with ice-cold 0.9% NaCl, and inverted using a thin metal stick. The mucosa was scraped off from individual intestinal segments (duodenum = first centimeter; jejunum = 215 cm; and ileum = last 25 cm) or from whole small intestine and homogenized (Omnimixer, setting 6, 90 s) in 15 ml of 300 mM mannitol, 5 mM EGTA, 5 mM HEPES/Tris (pH 7.1), and 0.1 mM phenylmethylsulfonyl fluoride at 4°C. After dilution with 20 ml of cold water, BBMV were prepared by the Mg2+-precipitation technique as described (18). Final membranes were resuspended in 300 mM mannitol, 20 mM HEPES/Tris (pH 7.2) at a concentration of
1015 mg total protein, which was determined according to Bradford (3). Each preparation contained membranes from small intestines of three to four animals.
The transport rate of phosphate into BBMV was measured as described (10) at 25°C in the presence of inwardly directed gradients of 100 mM NaCl or 100 mM KCl and 0.3 mM K-phosphate. Phosphate uptake was determined after 90 s and after 90 min to determine the equilibrium values.
Western blot analysis.
Depending on the origin, 3060 µg of purified BBMVs were separated by 10% SDS-PAGE after denaturation, without heating, in 2% SDS, 1 mM EDTA, 10% glycerol, 85 mM Tris·HCl (pH 6.8). After transfer of separated proteins onto nitrocellulose membranes, membranes were blocked with 5 phenylmethylsulfonyl fluoride nonfat milk powder and 0.5% Triton X-100 in TBS (150 mM NaCl, 25 mM Tris·HCl, pH 7.3) for 2 h. NaPi-IIb was detected with a rabbit polyclonal antiserum raised against a synthetic peptide derived from the NH2 terminus of NaPi-IIb (11). A polyclonal anti-calbindin D9k antibody was purchased from Swant (Bellinzona, Switzerland; dilution 1:10,000).
-actin, which was used as a loading control, was detected either by a staining with Ponceau rouge or by using a monoclonal anti-
-actin antibody (Sigma, St. Louis, MO; dilution 1:6,000). Binding of primary antibodies was visualized with anti-rabbit or anti-mouse IgG antibodies conjugated to horseradish peroxidase (Amersham Pharmacia Biotech, Germany) and enhanced chemiluminescence (Pierce, Switzerland). Denistometric analysis was performed using the imaging system Diana III and analyzed with the Aida software (Raytest, Germany).
Immunofluorescence.
For immunohistochemistry, samples (
0.5 cm) from the small intestine were taken every 5 cm (starting at the stomach pylorus) along the whole small intestine and were fixed by immersion. The fixative was composed of 3% paraformaldehyde and 0.05% picric acid in a 6:4 mixture of 0.1 M cacodylate buffer (pH 7.4, adjusted to 300 mosm/kgH2O with sucrose) and 10% hydroxyethyl starch in saline (HAES steril; Fresenius, Bad Homburg, Germany) (2). After 4 h, the samples were washed twice with PBS (140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4, pH 7.3), frozen rapidly after cryoprotection, and stored at 80°C. Cryosections (45 µm) were processed for immunofluorescence as reported (6). Briefly, after pretreatment for 30 min in PBS containing 3% defatted milk powder and 0.2% Triton X-100, samples were incubated overnight at 4°C with an anti-rabbit polyclonal antibody against the NaPi-IIb protein at a dilution 1:250. Sections were then incubated for 30 min with swine anti-rabbit IgG conjugated to FITC (Dakopatts, Glostrup, Denmark) at a dilution 1:50 (room temperature). Finally, the sections were covered with coverslips using DAKO-Glycergel (Dakopatts), containing 2.5% 1,4-diazabicyclo (2.2.2.) octane (DABCO; Sigma) as a fading retardant, and analyzed on a fluorescence microscope (Nikon Eclipse TE300).
Real-time PCR.
Total RNA from jejunal and ileal mucosa (
30 mg) was extracted using RNeasy Mini Kit (Qiagen, Cologne, Germany) according to manufacturers instructions. First-strand cDNA synthesis from total RNA was made in a reaction volume of 50 µl using TaqMan reverse transcription reagents (Applied Biosystems) with random hexamers according to the manufacturers instructions. Relative quantitation of NaPi-IIb mRNA was done using the ABI PRISM 7700 Sequence Detection System (Applied Biosystems) with
-actin as an internal standard. The sequences of TaqMan probes (Applied Biosystems, for NaPi-IIb; Biosearch Technologies, for
-actin) and primers (Applied Biosystems, for NaPi-IIb; Microsynth, Switzerland for
-actin) were as follows: 5'-(6-FAM) TGGTCAGAGAGAGACAC (BHQ-1)-3' (probe), 5'-CCTGGGACCTGCCTGAACT-3' (forward), 5'-AATGCAGAGCGTCTTCCCTTT-3' (reverse) for NaPi-IIb, and 5'-(6-FAM) CCATGAAGATCAAGATCATTGCTCCTCCT (BHQ-1)-3' (probe), 5'-GACAGGATGCAGAAGGAGATTACTG-3' (forward), 5'-CCACCGATCCACACAGAGTACTT-3' (reverse) for
-actin. TaqMan probes were set across exon-exon boundaries to exclude any amplification of genomic DNA. PCR reactions in a volume of 25 µl, containing 900 nM gene specific primers and 250 nM probes, were performed using TaqMan Universal PCR Master Mix (Applied Biosystems). After incubation with uracil-N-glycosylase (2 min at 50°C) and activation of AmpliTaq Gold DNA polymerase (10 min at 95°C), the samples were amplified by 45 cycles at 95°C for 15 s and 60°C for 1 min. Relative expression was calculated according to user bulletin #2 of the ABI PRISM 7700 Sequence Detection System (available for download at http://home.appliedbiosystems.com).
Statistics. All data (means ± SD) were tested for significance by applying the unpaired Students t-test. Differences at the level of P < 0.05 were considered as significant.
| RESULTS |
|---|
|
|
|---|
0.8% of Pi, was assessed by immunofluorescence. As illustrated in Fig. 1, strong, NaPi-IIb-related immunostaining was observed at the brush borders of enterocytes in the ileum. In the jejunum (between 5 and 15 cm), NaPi-IIb-mediated immunostaining was barely detectable, whereas in the duodenum, NaPi-llb staining was faint and often scattered. Immunoblots performed with BBMVs isolated from the different intestinal segments are shown in Fig. 2. The highest abundance of NaPi-llb was detected in BBMV derived from the ileum. In BBMV isolated from the jejunum, NaPi-llb protein was barely detectable, and in BBMV obtained from the duodenum, NaPi-llb protein could never be detected by Western blot analysis. Next, Na+/Pi uptake studies were performed using BBMV isolated from the different segments. As shown in Fig. 2, significant Na+-dependent phosphate uptake was observed only in BBMV derived from the ileum. No significant Na-dependent Pi uptake was observed in BBMV derived from the duodenum or the jejunum.
|
|
Na+-dependent uptake of Pi into BBMV isolated from the jejunum or ileum of the differently fed mice is shown in Fig. 3. In BBMV isolated from mice fed with a high-Pi diet, the rates of NaPi-IIb cotransport did not differ from the ones observed in BBMV isolated from animals fed with a normal diet (compare with Fig. 2). In both jejunal and ileal BBMV prepared from mice fed a low-Pi diet, Na+-dependent uptake of Pi was increased compared with BBMV isolated from mice fed a high-Pi diet (Fig. 3). Western blot analysis of the respective BBMV preparations is shown in Fig. 4 and demonstrates that in both jejunal and ileal BBMVs, low-Pi diet provoked an increase of the abundance of the NaPi-IIb protein. In agreement with the increase of NaPi-IIb cotransport observed in ileal BBMV, the increase of the NaPi-llb/
-actin ratio was 2.7 ± 0.9 (n = 3). After adaptation to a low-Pi diet for 5 days, NaPi-llb protein could not be detected BBMV isolated from the duodenum (data not shown). In addition to male mice, BBMV were also isolated from the jejunum and ileum of female mice. On the basis of Western blots (Fig. 4A), there was no difference between the distribution patterns (jejunum vs. ileum) of the NaPi-IIb protein between males and females. Also, there was no difference in the adaptive effect of low-Pi diet between the two genders. Additionally, BBMV were analyzed for the abundance of calbindin D9k (Fig. 4B). As shown, calbindin D9k was abundant in jejunal BBMV but absent in ileal BBMV derived from animals fed a high-Pi diet. Low-Pi diet provoked an increase of calbindin D9k, which was clearly detectable in ileal BBMVs.
|
|
-actin mRNA). The Ct values for the amplification of
-actin cDNA were similar in all segments (data not shown). As illustrated, NaPi-IIb mRNA was detected in all small intestinal segments of mice fed with a high-Pi diet. The highest amount of NaPi-IIb mRNA was found in the ileum and was slightly less in the jejunum. Compared with the jejunum and ileum, the relative abundance of NaPi-llb mRNA was
100-fold less in the duodenum. Low-Pi diet resulted in an increase of the relative abundance of NaPi-IIb mRNA in all three small intestinal segments.
|
| DISCUSSION |
|---|
|
|
|---|
In this study, expression of NaPi-llb and its correlation with Na/Pi cotransport activity was assessed in the small intestine of mouse. Interestingly, the highest amount of NaPi-IIb protein was detected in the ileum, whereas in the jejunum, the content of the NaPi-IIb protein was minimal. In agreement, the highest rate of NaPi-IIb cotransport was observed in BBMV isolated from the ileum, whereas in BBMV, isolated from the jejunum, Na+-dependent transport of Pi was not measurable. Although apical NaPi-llb was detectable by immunofluorescence in the duodenum, NaPi-llb could not be detected on immunoblots. Also, no Na-dependent Pi uptake could be measured in BBMV isolated from the duodenum. Thus the described localization of NaPi-llb suggests that in mouse small intestine, transcellular, Na+-dependent absorption of Pi occurs, to a large extent, in the ileum and is only minimal in the jejunum and duodenum. These data are in agreement with Pi-flux measurements, showing that Pi absorption in mice intestine is highest in the ileum and occurs only minimally in the other segments (E. Debnam, personal communication). Interestingly, it has been shown that in rat small intestine, when considering the different transit times, Pi is absorbed to equal extents (
1/3 of ingested Pi) in the ileum and in the duodenum (13). However, rat small intestinal localization of the NaPi-llb cotransporter remains to be determined.
Different factors have been described to regulate small intestinal Pi absorption (for review, see Refs. 5, 7, 14). In recent years, it has been shown that most of these factors alter the abundance of the NaPi-IIb protein in the apical membrane of the enterocytes (1, 9, 12, 2123). Here, we show that the abundance of the NaPi-IIb protein and of NaPi-IIb cotransport is increased by a low-Pi diet in the jejunum and in the ileum. In the duodenum, no evidence for an increase of these parameters was obtained. Furthermore, and in contrast to earlier reports (9, 12), an increase of the NaPi-llb mRNA content was observed in all intestinal segments; similar findings have been reported recently (17). Whereas in the jejunum and ileum, an increase of the NaPi-llb mRNA content was paralleled by an increase of the NaPi-llb protein, for reasons that cannot be explained, such a parallism could not be observed in the duodenum.
The effect of a low-Pi diet on NaPi-IIb mRNA suggests that the regulation of intestinal Pi absorption occurs via a transcriptional mechanism or via an increased stability of NaPi-IIb mRNA. Currently, neither the signal(s) nor the mechanism(s) leading to an increased amount of NaPi-IIb mRNA is known. Regulation of small intestinal NaPi-IIb cotransport by a low-Pi diet is assumed to be dependent on the stimulation of the renal 25-hydroxyvitamin-D3-1
-hydroxylase activity and the resulting increase of the serum concentration of 1,25(OH)2D (5, 19). Consequently, an increase of NaPi-IIb mRNA may be explained by a transcriptional regulation that involves the vitamin D receptor (VDR), similar to what was described for calbindin D9k (15). Indeed, upregulation of the latter by a low-Pi diet was detectable in ileal BBMV (see Fig. 4B). However, an involvement of VDR in the regulation by low-Pi diet of NaPi-IIb in intestine has recently been challenged because it was shown that upregulation of NaPi-IIb protein and mRNA was not altered in VDR-deficient mice compared with wild-type mice (4, 17). Thus, if 1,25(OH)2D acts via a nongenomic mechanism (8) or if other factors, such as, for example, FGF23 (20), may be involved in the upregulation by a low-Pi diet of intestinal Pi absorption remains to be determined.
In summary, our data demonstrate that along the mouse small intestine, the Na+-Pi cotransporter NaPi-IIb is inhomogenously expressed. The highest abundance of NaPi-IIb protein was found in the ileum, whereas in the duodenum and in the jejunum, the content of the NaPi-IIb protein was minimal or not detectable. On the basis of Na-Pi-transport studies, we conclude that in mouse small intestine, transcellular Pi reabsorption occurs to a significant amount in the ileum. Whether such segmental distribution of NaPi-IIb and Na/Pi cotransport is unique for the mouse small intestine or may also be present in other species remains to be analyzed.
| GRANTS |
|---|
|
|
|---|
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
-OHase deficient mice. Am J Physiol. In press, 2005.
This article has been cited by other articles:
![]() |
Y. Sabbagh, S. P. O'Brien, W. Song, J. H. Boulanger, A. Stockmann, C. Arbeeny, and S. C. Schiavi Intestinal Npt2b Plays a Major Role in Phosphate Absorption and Homeostasis J. Am. Soc. Nephrol., November 1, 2009; 20(11): 2348 - 2358. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Y. Renkema, A. Velic, H. B. Dijkman, S. Verkaart, A. W. van der Kemp, M. Nowik, K. Timmermans, A. Doucet, C. A. Wagner, R. J. Bindels, et al. The Calcium-Sensing Receptor Promotes Urinary Acidification to Prevent Nephrolithiasis J. Am. Soc. Nephrol., August 1, 2009; 20(8): 1705 - 1713. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Chen, H. Xu, J. Dong, J. Li, and F. K. Ghishan Tumor necrosis factor-alpha impairs intestinal phosphate absorption in colitis Am J Physiol Gastrointest Liver Physiol, April 1, 2009; 296(4): G775 - G781. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Marks, L. J. Churchill, E. S. Debnam, and R. J. Unwin Matrix Extracellular Phosphoglycoprotein Inhibits Phosphate Transport J. Am. Soc. Nephrol., December 1, 2008; 19(12): 2313 - 2320. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kirchner, A. Muduli, D. Casirola, K. Prum, V. Douard, and R. P Ferraris Luminal fructose inhibits rat intestinal sodium-phosphate cotransporter gene expression and phosphate uptake Am. J. Clinical Nutrition, April 1, 2008; 87(4): 1028 - 1038. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Collins, Z. Hu, P. N. Ranganathan, D. Feng, L. M. Garrick, M. D. Garrick, and R. W. Browne Induction of arachidonate 12-lipoxygenase (Alox15) in intestine of iron-deficient rats correlates with the production of biologically active lipid mediators Am J Physiol Gastrointest Liver Physiol, April 1, 2008; 294(4): G948 - G962. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Wagner, J. Biber, and H. Murer What goes in must come out the small intestine modulates renal phosphate excretion Nephrol. Dial. Transplant., December 1, 2007; 22(12): 3411 - 3412. [Full Text] [PDF] |
||||
![]() |
L. V. Virkki, J. Biber, H. Murer, and I. C. Forster Phosphate transporters: a tale of two solute carrier families Am J Physiol Renal Physiol, September 1, 2007; 293(3): F643 - F654. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. B. Williams and H. F. DeLuca Characterization of intestinal phosphate absorption using a novel in vivo method Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1917 - E1921. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Huber, R. Hempel, and M. Rodehutscord Adaptation of epithelial sodium-dependent phosphate transport in jejunum and kidney of hens to variations in dietary phosphorus intake. Poult. Sci., November 1, 2006; 85(11): 1980 - 1986. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Marks, S. K. Srai, J. Biber, H. Murer, R. J. Unwin, and E. S. Debnam Intestinal phosphate absorption and the effect of vitamin D: a comparison of rats with mice Exp Physiol, May 1, 2006; 91(3): 531 - 537. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. V. Virkki, H. Murer, and I. C. Forster Voltage Clamp Fluorometric Measurements on a Type II Na+-coupled Pi Cotransporter: Shedding Light on Substrate Binding Order J. Gen. Physiol., April 24, 2006; 127(5): 539 - 555. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Stauber, T. Radanovic, G. Stange, H. Murer, C. A. Wagner, and J. Biber Regulation of Intestinal Phosphate Transport II. Metabolic acidosis stimulates Na+-dependent phosphate absorption and expression of the Na+-Pi cotransporter NaPi-IIb in small intestine Am J Physiol Gastrointest Liver Physiol, March 1, 2005; 288(3): G501 - G506. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |