AJP - GI Add DOIs to your references at manuscript stage!
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 290: G685-G694, 2006. First published December 1, 2005; doi:10.1152/ajpgi.00404.2005
0193-1857/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/4/G685    most recent
00404.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sharma, R.
Right arrow Articles by Hecht, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sharma, R.
Right arrow Articles by Hecht, G.

INFLAMMATION/IMMUNITY/MEDIATORS

Balance of bacterial pro- and anti-inflammatory mediators dictates net effect of enteropathogenic Escherichia coli on intestinal epithelial cells

Rachna Sharma,1,* Samuel Tesfay,1,* Farol L. Tomson,1 Rajani P. Kanteti,1 V. K. Viswanathan,1 and Gail Hecht1,2

1Department of Medicine, Section of Digestive Diseases and Nutrition, University of Illinois at Chicago and 2Jesse Brown Veterans Affairs Medical Center, Chicago, Illinios

Submitted 29 August 2005 ; accepted in final form 23 November 2005


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Enteropathogenic Escherichia coli (EPEC) virulence requires a type III secretion system (TTSS) to deliver effector molecules in host cells. Although the TTSS is crucial to EPEC pathogenesis, its function in EPEC-induced inflammation is not known. The aim of this study was to investigate the role of the TTSS in EPEC-induced inflammation. HT-29 intestinal epithelial cells were infected with wild-type (WT) EPEC or select mutant strains or exposed to corresponding filter-sterilized supernatants (SN), and interleukin-8 (IL-8) secretion was determined by ELISA. EPEC SN stimulated significantly greater IL-8 production than EPEC organisms. Flagellin, as well as a TTSS-independent >50-kDa nonflagellin protein, was found to significantly contribute to this response. Dose-response studies showed that increasing concentrations of WT SN proportionally increased IL-8, whereas increasing multiplicity of infection of EPEC inversely correlated with IL-8 secretion, suggesting that EPEC dampens this host response. Infection with {Delta}escN (nonfunctional TTSS) markedly increased IL-8 compared with WT, indicating that a functional TTSS is required for this anti-inflammatory property; complementation of escN restored the attenuated response. Mutation of espB also enhanced the IL-8 response, and complementation returned IL-8 to near WT levels, suggesting involvement of this effector. The anti-inflammatory effect extends to both bacterial and host-derived proinflammatory stimuli, since prior infection with EPEC suppressed the IL-8 response to tumor necrosis factor-{alpha}, IL-1beta, and enterohemorrhagic E. coli flagellin. These findings indicate that EPEC-induced inflammation is a balance between pro- and anti-inflammatory proteins; extracellular factors, including flagellin and an unidentified TTSS-independent, >50-kDa protein, trigger inflammation while intracellular TTSS-dependent factors, including EspB, attenuate this response.

inflammation; EspB; enteropathogenic Escherichia coli; flagellin


ENTEROPATHOGENIC ESCHERICHIA COLI (EPEC) is a leading cause of infantile diarrhea in developing countries (29). EPEC colonizes the intestinal epithelial surface and intimately attaches to the surface of host cells, forming a pedestal-like structure associated with effacement of microvilli, a histopathological mucosal change known as attaching and effacing (A/E) lesion. Like several other gram-negative pathogens, EPEC encodes a type III secretion system (TTSS) that delivers effector proteins that contribute to the formation of these lesions and result in diarrheal disease (16). This system secretes proteins in the host cell cytosol through a needle-like structure (20) and is dependent on the translocating ATPase, EscN, for proper function (21). EPEC-secreted proteins include EspA, EspB, EspD, EspF, EspG, EspG2, EspH, Tir, and Map. EspB and EspD form the pore in the host cell membrane at the end of the needle-like TTSS structure, made up of EspA (52), whereas EspF, EspG, EspG2, EspH, Tir, and Map are effector proteins that are translocated in the host cell cytoplasm (12, 25, 33). The end physiological results of EPEC colonization and attachment to epithelial cells are disruption of the intestinal epithelial barrier, alterations in intestinal transport, and inflammation (18, 23, 33, 41, 43). Although significant progress has been made toward ascertaining EPEC pathogenesis, the molecular mechanisms by which it causes diarrhea are not fully known.

One consequence of EPEC infection is activation of the nuclear transcription factor NF-{kappa}B, which in turn promotes the expression of proinflammatory cytokines such as interleukin (IL)-8 (41). EPEC is noninvasive; therefore, the signaling events that trigger NF-{kappa}B activation must come from soluble factors secreted or shed by EPEC or translocated TTSS-dependent effectors. Recently, flagellin, the flagellar structural protein, has been implicated as the EPEC factor responsible for IL-8 production in T84 cells (57). There is no doubt that flagellin is a potent inflammatory molecule, since flagellin from various bacteria, including Pseudomonas aeruginosa (8, 56), enteroaggregative E. coli (9, 50), Salmonella typhimurium (14), and Shiga-toxin producing E. coli (39), have all been reported to induce IL-8 production in host cells. The proinflammatory activity of flagellin has been localized to the conserved NH2- and COOH-terminal domains of the protein (11). Flagellin interaction with its receptor, toll-like receptor 5 (TLR5), induces inflammation via an NF-{kappa}B-dependent pathway (51). TLR5 is expressed in native human epithelial cells (6) and in many cultured intestinal epithelial lines, including HT-29 cells (3).

Zhou et al. (57) showed that supernatant of EPEC grown in Luria-Bertani (LB) broth elicited high IL-8 production in T84 cells, and this response was abrogated by deletion of the flagellin gene ({Delta}fliC). However, the supernatants of EPEC grown in Dulbecco-Vogt modified Eagle medium (DMEM), associated with a downregulation of flagellin expression, also elicited an IL-8 response, albeit to a lesser degree compared with LB-grown bacterial supernatants (57). Also interesting to note was that {Delta}escN, also shown to be deficient in flagellin expression when grown in DMEM (15, 57), elicited an IL-8 response slightly more than the wild type (WT) after 18 h of incubation (57). Thus we hypothesized that EPEC possesses proinflammatory component(s) in addition to flagellin.

Although inflammation is no doubt the net effect of EPEC infection, a recent study raised the possibility that EPEC may dampen the inflammatory response of host epithelial cells. Hauf and Chakraborty (17) showed that enterohemorrhagic E. coli (EHEC) and EPEC were able to downregulate the NF-{kappa}B response to the proinflammatory cytokine tumor necrosis factor (TNF)-{alpha} in HeLa cells (17). Anti-inflammatory effectors of other enteric pathogens, such as YopJ from Yersinia spp., AvrA from S. typhimurium, and VopA from Vibrio parahaemolyticus, have been shown to inhibit signaling events upstream of NF-{kappa}B translocation (7, 13, 37, 54). Also, Bacteroides thetaiotaomicron, a nonpathogenic bacterium, stimulates nuclear export of the transcriptionally active NF-{kappa}B subunit RelA in a peroxisome proliferator-activated receptor (PPAR)-{gamma}-dependent mechanism (23). We therefore also hypothesized that, while intestinal epithelial cells elicited a proinflammatory response to an extracellular component of EPEC, EPEC may actively dampen this host response through an intracellular process. Hence, in this study, we explore the balance between pro- and anti-inflammatory effects of EPEC infection.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Bacterial strains and plasmids. EPEC {Delta}fliC (GH333) was created by the SacB counterselection method described by Merlin et al. (35). Dr. Millicent Masters (Institute for Cell and Molecular Biology, University of Edinburgh, Scotland) provided the plasmids for gene inactivation. Briefly, the fliC upstream fragment (PCR amplified using primers 5'-AAAAAATGCATGATCGCCGTTTCGTATCG and 5'-CGCTCTTGCGGCC GCTTGGAACGGTTGAGTGATCAGCGAGAG) was fused to the fliC downstream fragment (PCR amplified using primers 5'-AAAAACTCGAGGTTGCCCTATTGCCT GTG and 5'-CCGTTCCAAGCGGCCGCAAGAGCGAAAGCCAACCAGGTACCG) by crossover PCR, digested with XhoI and NsiI, and cloned into the SalI-PstI sites of pTOF24 (45) to generate pRPK24. The NotI fragment from pTOF2 (45) containing the kanamycin resistance (30) cassette was subsequently cloned into the NotI site (introduced during the crossover PCR) of pRPK24 to create pRPK25. pRPK25 was introduced into WT EPEC (E2348/69) by electroporation, and kanamycin-resistant colonies were subsequently screened for chloramphenicol sensitivity and sucrose resistance, as described previously (45). The resulting colonies were verified by colony PCR using primers 5'-AAAAAATGCATGATCGCCGTTTCGTATCG and 5'-TGCTCTTCGCGCCACTCA TC and by Western blot analysis. The deletion strains retain only the first and last 45 bp of the fliC-coding region. Full-length fliC was amplified from the EPEC chromosome using primers FliC-3 (ATGGCACAAGTCATTAATACC) and FliC-4 (TTAACCCTGCAGCAGAGACA) and cloned into pTrc2HisTOPO (Invitrogen) to generate pRPK21. For complementation studies, {Delta}fliC was transformed with pRPK21. Primers for the generation of {Delta}fliC and the complementing plasmid were designed based on EPEC genome sequences (http://www.sanger.ac.uk/Projects/Escherichia_Shigella/). Although AGT01 (Table 1) was constructed by inserting a chloramphenicol cassette in the middle of fliC, GH333 was engineered to be a gene replacement with a kanamycin marker, allowing for the near-complete deletion of fliC (15). To distinguish between AGT01 and GH333, they have been labeled as fliC::Cm and {Delta}fliC, respectively. The EPEC espC was PCR amplified from EPEC genomic DNA using the following primers: forward 5'-AAAGGATCCCTGGTGATAAAAACATTATGTG-3' and reverse 5'-AAAGAATTCGCAGTATATAAACATACTCAG-3'. The 4-kb product was cloned into the BamH1/EcoR1 site of pUC19. pUC19 containing espC or the empty pUC19 vector was transformed into commensal bacteria, HS-4, and plated on LB plates containing 100 µg/ml ampicillin. The strains were named GH273 (HS-4/pespC) and GH274 (HS-4/pUC19).


View this table:
[in this window]
[in a new window]
 
Table 1. Strains used in this study

 
Cell culture. Polarized human intestinal epithelia HT-29 cells were grown in high-glucose DMEM (Invitrogen, Carlsbad, CA) with 10% FBS (Invitrogen) at 37°C in 5% CO2 as previously described (30, 48). Although our laboratory has previously used T84 cells in studies of EPEC-induced inflammation, HT-29 cells were used for this study, since they produce a more robust IL-8 response in a 6-h infection protocol. Hep 2 cells (American Type Culture Collection, Rockville, MD) were cultured in minimum essential medium with 2 mM L-glutamine and Eagle's BSS adjusted to contain 1.5 g/l sodium bicarbonate, 0.1 mM nonessential amino acids, 1.0 mM sodium pyruvate (90%), and 10% FBS (Invitrogen) at 37°C in 5% CO2. Cells were maintained in serum- and antibiotic-free DMEM media 12–14 h before infection.

Growth of bacteria and infection of host cells. The specific strains used in these studies are listed in Table 1. Unless noted otherwise, E2348/69 was used as the standard WT EPEC in all experiments. All strains were grown overnight in LB with antibiotics and diluted 1:33 in serum-free, antibiotic-free 1:1 (vol/vol) mixture of DMEM and Ham's F-12 (Invitrogen) media supplemented with 14 mM NaHCO3, 10 mM HEPES (pH 7.4), and 0.5% mannose. The strains were grown for an additional 2 h to the same optical density reading of 0.3–0.4. Approximately 5 x 107 colony-forming units/ml in DMEM media were added to confluent monolayer cells, corresponding to a multiplicity of infection of ~50, unless otherwise indicated. Infected monolayers were incubated at 37°C in a 5% CO2 water-jacketed incubator for a total of 6 h, and, after the first hour of infection, medium was aspirated and replaced (41, 53, 55).

Bacterial supernatants. Bacteria grown to mid-log growth phase in serum-free, antibiotic-free media were centrifuged at 3,000 rpm for 10 min. The supernatant (SN) was sterilized by passing through a 0.22-µm sterile syringe filter. Host cells were treated with SNs for 6 h at 37°C in a 5% CO2 water-jacketed incubator. Heat inactivation of SNs was achieved by boiling for 15 min before treatment. Protease treatment consisted of adding proteinase K (150 µg/ml) at 60°C or trypsin (40 µg/ml) at 37°C for 2 h followed by boiling for 15 min. For TCA precipitation, SNs were incubated with 0.02% deoxycholic acid for 15 min at room temperatures, followed by the addition of 6% TCA. After incubation on ice for 2 h, the TCA mixtures were centrifuged at 14,000 rpm (30,000 g) for 45 min, and the pellets were washed in cold acetone for 15 min and centrifuged at 13,000 rpm for 30 min at 4°C in a microcentrifuge. The acetone was decanted, and pellets were dried at room temperature. The pellets were resuspended in SDS-PAGE loading buffer and separated by 12% SDS-PAGE. One microliter of 1.5 M Tris (pH 8.8) was added to resuspended pellets to counteract any change in pH by TCA. Bacterial genomic DNA was used at a concentration of 25 µg/ml. For the DNase treatment studies, SNs were incubated with DNase I (25 U/ml) at 37°C for 4 h. DNase I alone was used as control.

Detection of IL-8. HT-29 cells were grown in 24-well plates or on 12-mm-diameter collagen-coated Transwells (Corning, Corning, NY). Although IL-8 is secreted basolaterally, no differences in trends of IL-8 production were seen between Transwells and 24-well plates. Monolayers were infected with various inocula of EPEC as indicated in the text. After 1 h, medium was added to a final volume of 1 ml for 24-well plates; for Transwells, 250 and 500 µl medium were added to the apical and basal well, respectively. IL-8 was determined using a Quantikine IL-8 immunoassay kit (R&D Systems, Minneapolis, MN) from samples taken at 6 h postinfection. Recombinant human TNF-{alpha} and IL-1beta used for IL-8 stimulation were from Promega (Madison, WI) and Sigma-Aldrich (St. Louis, MO), respectively.

SDS-PAGE and Western blotting. Proteins from SNs were separated by 12% SDS-PAGE, transferred to a 0.2-µm-pore-size nitrocellulose membrane using a Trans-Blot Cell apparatus (Bio-Rad, Hercules, CA), and analyzed by immunoblotting (47). Flagellin monoclonal antibody (15D8; BioVeris, Gaithersberg, MD) was used for Western blotting and was visualized by ECL (Amersham, Piscataway, NJ).

Statistical analysis. Data were analyzed using Student's t-test for independent samples. Differences were considered significant if P was ≤ 0.05.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
IL-8 response is greater to EPEC sterile SN than to bacteria. The role of effector molecules secreted through the TTSS in EPEC-induced inflammation has not been rigorously examined. EPEC infection clearly elicits a net proinflammatory response in in vitro and in vivo models (41, 42, 44). To dissect the effects of EPEC on the inflammatory response by intestinal epithelial cells, we compared the level of IL-8 production after infection with EPEC organisms or exposure to sterile SN. HT-29 cells were infected with EPEC grown in DMEM or filter-sterilized DMEM SNs. Surprisingly, sterile EPEC SN elicited a significantly higher IL-8 response than infection with whole bacteria (Fig. 1A). Consistent with previous reports, these data support the presence of a secreted or released proinflammatory component(s) in EPEC SN (57). Although flagellin expression is high in LB-grown bacteria (Fig. 1C), EPEC does not express significant levels of other virulence genes under these conditions (15). Growth in DMEM, thought to mimic conditions of in vivo infection, increases expression of virulence genes but suppresses flagellin expression. Even with diminished flagellin levels (Fig. 1C), EPEC grown in DMEM also elicited a significant IL-8 response in HT-29 cells as shown in Fig. 1A. In addition, IL-8 production in response to EPEC SN was specific to the pathogenic organism, since sterile SN from commensal bacteria (HS4) SN did not evoke this response (Fig. 1B). Similar data were obtained when host cells were challenged with live organisms from WT EPEC and HS4 strains (data not shown).


Figure 1
View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. Supernatants (SNs) of enteropathogenic Escherichia coli (EPEC) induce more interleukin (IL)-8 than bacteria. A: HT-29 cells were infected with wild-type (WT) EPEC (E2348/69) or treated with filter-sterilized WT SN (500 µl). Cells treated with DMEM alone were included as control. The medium was collected at 6 h for measurement of IL-8 secreted by host cells. IL-8 response to bacteria was modest, whereas that elicited by SN was significantly higher (*P < 0.01, n = 3 experiments, done in duplicate). B: HT-29 cells were treated with DMEM or filter-sterilized SN of WT EPEC and commensal bacteria (HS4) grown in DMEM. The medium was collected at 6 h for measurement of IL-8 secreted by host cells. IL-8 response to EPEC SN was significantly greater than that elicited by SN from commensal bacteria (HS4; *P < 0.01, n = 3, done in duplicate). C: TCA precipitated SNs from Luria-Bertani (LB)- or DMEM-grown WT, AGT01 (fliC::Cm), and AGT02 (fliC complemented) were separated by SDS-PAGE and immunoblotted against flagellin. Flagellin expression, evident in SN of WT and complemented strains, was higher after growth in LB compared with DMEM. AGT01 is deficient in flagellin expression under both conditions.

 
Flagellin is not the only proinflammatory component in EPEC SN. To directly determine the contribution of flagellin to the IL-8 response to SN from DMEM-grown EPEC, HT-29 cells were challenged with sterile SNs from WT EPEC, AGT01 (fliC::Cm), and AGT02 (fliC::Cm complemented). Western blot analysis of flagellin in SNs from WT (E2348/69), AGT01, and AGT02 showed that flagellin was present only in WT and the complemented strains (Fig. 2A). Figure 2A also shows that SN from both WT EPEC and the AGT01 strain elicited a significant IL-8 response in HT-29 cells. In fact, the SN from AGT01 induced greater IL-8 production than WT SN. As expected, SN from flagellin-expressing AGT02 caused a greater increase in IL-8 than AGT01, confirming previously reported work by Zhou et al. (57) that flagellin contributes to the EPEC-mediated IL-8 response in intestinal epithelial cells. In addition to testing the effects of SNs, E2348/69 (WT) and AGT01 organisms were also examined for their ability to induce an IL-8 response. Infection with AGT01 elicited less IL-8 than WT EPEC but retained proinflammatory activity, as evidenced by comparison with uninfected controls. Complementation of fliC (AGT02) restored the response to WT levels (Fig. 2B). Western blot analysis of flagellin from pellets of WT, AGT01, and AGT02 showed that flagellin was present, as expected, only in WT and the complemented strains (Fig. 2B). To confirm the involvement of a nonflagellin proinflammatory component in the SN, Hep 2 cells, which are deficient in flagellin receptor TLR5 expression and therefore unable to respond to flagellin (9), were treated with SNs from WT, AGT01, and AGT02. As can be seen in Fig. 2C, all three strains elicited a similar IL-8 response, indicating that a nonflagellin, proinflammatory component is present in the SN. These data strongly suggest that EPEC expresses proinflammatory factors that signal in a TLR5-independent manner.


Figure 2
View larger version (26K):
[in this window]
[in a new window]
 
Fig. 2. Flagellin mutant induces IL-8 production. A: HT-29 cells were treated with SN (500 µl) from WT (E2348/69), AGT01, or AGT02 for 6 h. The fliC mutant (AGT01) SN induced significantly greater IL-8 production than control. IL-8 production induced by AGT02 (fliC complemented) was not significantly higher than AGT01 (*P < 0.01, n = 3, done in duplicate). Western blot analysis (inset) revealed that AGT01 SN is deficient for flagellin expression, whereas WT and AGT0 SN contained this protein. B: HT-29 cells were infected with WT, AGT01, or AGT02 bacteria for 6 h, and IL-8 released in the medium was assessed. AGT01 induced less IL-8 than WT or AGT02 (fliC complemented; *P < 0.01, n = 3 or more, done in duplicate). Western blot of pellets from DMEM-grown bacteria shows that AGT01 is deficient for flagellin expression, whereas WT and AGT02 expressed the protein. C: Hep 2 cells, which are deficient in TLR5 expression, were treated with WT, AGT01, or AGT02 SNs for 6 h. Strains with (WT, AGT02) and without (AGT01) flagellin elicited comparable IL-8 responses, which were significantly higher than control untreated cells. D: HT-29 cells were treated with SN from GH333 ({Delta}fliC, complete deletion of fliC) or GH335 ({Delta}fliC/pfliC) for 6 h. GH333 ({Delta}fliC) SN induced a 1.6-fold increase in IL-8 response compared with DMEM-treated control. GH335 ({Delta}fliC/pfliC) SN-stimulated IL-8 production was two times that of DMEM-treated control (*P < 0.01, n = 3).

 
AGT01 was constructed by inserting a chloramphenicol cassette in the middle of the fliC gene (15), leaving open the possibility that flagellin fragments of ~260 amino acids from the NH2-terminus of the protein were produced. Although this strain was used previously by others (57) and lack of flagellin expression was confirmed by our work (see Western blots in Fig. 2, A and B), we were concerned that the NH2-terminus fragment, known to interact with TLR5 (11), could contribute to the observed IL-8 response. Therefore a full-deletion {Delta}fliC mutant (GH333) was engineered to confirm the existence of a nonflagellin, proinflammatory EPEC molecule. Interestingly, SN from the complete {Delta}fliC mutant (GH333) and the complemented {Delta}fliC/pfliC (GH335) strain resulted in 1.6- and 2-fold increases in IL-8, respectively, compared with uninfected HT-29 cells (Fig. 2D). These experiments support our previous conclusion that the proinflammatory effect of EPEC on intestinal epithelial cells involves flagellin and nonflagellin molecule(s).

Proinflammatory component of EPEC SN is heat and protease sensitive and >50 kDa. To begin to characterize the nonflagellin proinflammatory molecule(s), sensitivity to heat and protease treatment was determined. Heat treatment of WT SN significantly impaired, but did not completely eliminate, the IL-8 response compared with untreated SNs, indicating that both heat-sensitive and heat-resistant components contribute to this response (Fig. 3A). Proteinase K (150 µg/ml) or trypsin (40 µg/ml) treatment of WT EPEC SN resulted in a significantly reduced IL-8 response than untreated (Fig. 3B), suggesting that the proinflammatory component(s) in EPEC SN is a protein. Unlike flagellin, which is heat resistant but protease sensitive (36, 51), the nonflagellin protein(s) in the SN is sensitive to heat and protease treatment.


Figure 3
View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3. Proinflammatory component of EPEC SNs is heat and protease sensitive and has a molecular mass >50 kDa. A: filter-sterilized WT SN was subjected to heat treatment (HT) by boiling for 15 min. HT SNs (200 µl) were added to HT-29 cells for 6 h. The HT SN elicited significantly less IL-8 than the untreated SNs (*P < 0.01, n = 3 or more, in triplicate). B: filter-sterilized WT SN was treated with proteinase K and trypsin as described in MATERIALS AND METHODS. Enzyme-treated SN (200 µl) was added to HT-29 cells for 6 h. Proteinase and trypsin treatment of SN significantly decreased IL-8 production compared with untreated SN (*P < 0.01, n = 3–6). C: WT SN was fractionated, and fractions <30, >30, <50, and >50 kDa were applied to HT-29 cells. The amount of IL-8 induced by the fractions <50/<30 kDa was significantly less than the unfractionated SN and the >30-kDa fraction (*P < 0.01, n = 3 or more, in duplicate).

 
To characterize the size of the proinflammatory component(s), EPEC SNs were fractionated using molecular mass cut-off filters, and the fractionated SNs were used to treat HT-29 cells. The proinflammatory activity of the SN was found to primarily reside in the >50-kDa fraction (Fig. 3C). However, fractionation does not rule out the possibility of protein oligomers. SN from {Delta}fliC was also fractionated and again the activity localized to the >50 kDa fraction (data not shown), confirming that flagellin is not responsible for the proinflammatory activity measured in this assay.

Bacterial DNA and lipopolysaccharide do not contribute to the IL-8 response. We proceeded to evaluate the contribution of other known proinflammatory factors to EPEC-induced IL-8 production. Although lipopolysaccharide (LPS) is a major proinflammatory component of gram-negative bacteria, differentiated HT-29 cells are unresponsive to LPS (1, 4). The lack of response to LPS was attributed to the decreased expression of its receptor, TLR4, on the surface of IEC lines (1). HT-29 cells used in this study also failed to respond to purified bacterial LPS at concentrations up to 50 µg/ml (Fig. 4A). Bacterial DNA is another well-known proinflammatory molecule that acts through TLR9 (19). To examine the contribution of EPEC DNA to inflammation, DNase I-treated and untreated purified EPEC genomic DNA and SNs from various EPEC strains were used to treat HT-29 cells. DNase I treatment significantly reduced the IL-8 response to purified DNA and minimally to AGT01 (fliC::Cm) SN, but had no effect on SNs from WT or AGT02 (complemented fliC::Cm; Fig. 4B). This study suggests that, although purified EPEC DNA promotes IL-8 production, it is not a significant contributor to the IL-8 responses induced by WT EPEC or AGT01 SNs.


Figure 4
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 4. Bacterial DNA and lipopolysaccharide (LPS) do not contribute to inflammation. A: HT-29 cells were treated with LPS at indicated concentrations. LPS induced significantly less IL-8 compared with the WT (E2348/69) SN (*P < 0.01, n = 3), suggesting that LPS is not the proinflammatory component. B: bacterial DNA or SN from WT, AGT01 (fliC::Cm), and AGT02 (complemented fliC::Cm) were used as such or digested with DNase I before treatment of HT-29 cells. DNase I digestion reduced the IL-8 production in response to pure bacterial DNA, but the effect on WT and AGT01 SNs was minimal (n = 3, in duplicate).

 
TTSS-independent EspC enterotoxin is not proinflammatory. To further characterize the nonflagellin, >50-kDa proinflammatory protein(s), EPEC and AGT SNs were separated by SDS-PAGE and Coomassie stained (Fig. 5A). EPEC has been reported to secrete at least five major proteins in DMEM (24). A prominent band at ~110 kDa, observed in both WT and AGT01 strains, corresponds to the previously identified 110-kDa autotransposed enterotoxin, EspC (34, 49). To determine if EspC contributed to the EPEC inflammatory response, espC was cloned in the commensal strain, HS-4, and verified for expression and secretion of EspC (Fig. 5B). Sterile SN from this strain was tested for IL-8 production and found to be no different compared with commensal or vector alone (Fig. 5B). Thus EspC does not induce IL-8 in HT-29 cells.


Figure 5
View larger version (25K):
[in this window]
[in a new window]
 
Fig. 5. EspC does not induce IL-8 production. A: SN of WT (E2348/69) and AGT01 (fliC::Cm) were TCA precipitated and separated by 12% SDS-PAGE. Coomassie blue staining revealed the presence of a 110-kDa protein in both strains. This protein corresponds to the previously identified enterotoxin EspC. B: HT-29 cells were treated with SN from WT, HS4 (commensal), HS4/espC (pespC transformed into HS4 strain), or HS4/pUC19 (negative control). IL-8 production in response to HS4/espC, vector-transformed control, or the commensal SNs was not significantly different (n = 3, in duplicate). TCA-precipitated SNs from the various strains were separated by SDS-PAGE and stained with Coomassie blue (inset) to verify the expression and secretion of EspC. MWS, molecular mass standards.

 
EPEC bacteria downregulate the IL-8 response. Throughout the course of our studies, it was noted that infection with whole organisms consistently yielded a significantly lower IL-8 response compared with treatment with sterile SNs. This led us to question if EPEC possesses the ability to suppress the host inflammatory response to its own proinflammatory products. To test this possibility, dose-response studies were performed with both EPEC organisms and sterile SNs. Interestingly, there was an inverse relationship between the number of infecting bacteria and IL-8 response, as shown in Fig. 6A, supporting the contention that EPEC downregulates inflammation. On the other hand, IL-8 secretion was directly proportional to the concentration of sterile SN (Fig. 6B). These experiments suggest that, although intestinal epithelial cells mount a proinflammatory response to extracellular components of EPEC, EPEC actually dampens this host response in a TTSS-dependent manner. To investigate this possibility, HT-29 cells were infected with a strain harboring mutations in escN, which encodes the putative ATPase required for type III secretion (21). Infection of cells with {Delta}escN yielded an exaggerated IL-8 response, similar to that evoked by sterile EPEC SN. Complementation of this gene reduced the IL-8 response to levels seen with WT EPEC (Fig. 6C).


Figure 6
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 6. EPEC anti-inflammatory activity is type III secretion system (TTSS) dependent and inversely proportional to multiplicity of infection (MOI). A: infection of cells with increasing amounts of WT EPEC decreased the amount of IL-8 secretion. An MOI of 10, 25, or 50 of WT (E2348/69) bacteria was used to infect HT-29 cells, and IL-was 8 measured at 6 h (*P < 0.01, n = 3, in duplicate). B: SN concentration is proportional to IL-8 response. HT-29 cells were treated with various dilutions of WT SN. IL-8 production was measured (*P < 0.05, n = 3). C: HT-29 cells were infected with WT, {Delta}escN, and complemented {Delta}escN strain ({Delta}escN/pescN). {Delta}escN stimulated a 4-fold greater IL-8 response than WT bacteria. Complementation of {Delta}escN restored the IL-8 response to WT levels (*P < 0.01, n = 3, in duplicate).

 
EspB has anti-inflammatory activity. Because the anti-inflammatory activity of EPEC appeared to be dependent on a functional TTSS, a panel of EPEC strains harboring mutations in genes for specific nonstructural effector molecules was screened for IL-8 responsiveness. Of the four effectors screened ({Delta}espB, {Delta}espF, {Delta}espG, and {Delta}Map), an exaggerated IL-8 response was seen only with {Delta}espB. This finding is consistent with reports that the {Delta}espB mutant caused an increased NF-{kappa}B response compared with WT in both EPEC and Shiga toxin-producing E. coli (17). Complementation of {Delta}espB ({Delta}espB/pespB) restored WT IL-8 activity (Fig. 7B).


Figure 7
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 7. EspB is important for suppression of IL-8 response. A: HT-29 cells were infected with WT (E2348/69), {Delta}espB, {Delta}espF, {Delta}espG, or {Delta}map bacteria. Only {Delta}espB evoked higher IL-8 response than WT (n = 3 or more, in triplicate). B: complementation of {Delta}espB decreased the IL-8 response to WT levels (n = 3 or more, in triplicate).

 
EPEC dampens the IL-8 response to bacterial and host cell inflammatory mediators. The previous experiments strongly suggested that, although EPEC produces extracellular factors that stimulate inflammation, attached bacteria deliver an effector(s) via TTSS in host cells that ramps down this response. We questioned whether this anti-inflammatory activity was specific for bacterial components or might extend to host-derived proinflammatory cytokines. To test this directly, HT-29 cells grown on Transwells (Corning) were infected with EPEC apically and then challenged with either host or bacterial proinflammatory stimuli basally. Challenge with TNF-{alpha} (10 ng/ml), IL-1beta (5 ng/ml), and flagellin from a different organism, EHEC (10.3 µg/ml), alone each induced a potent IL-8 response. Infection with EPEC before challenge with these mediators, however, dramatically reduced the IL-8 response (Fig. 8), demonstrating that EPEC attenuates inflammation in response to a wide range of proinflammatory stimuli, both bacterial and host derived.


Figure 8
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 8. Infection with EPEC suppresses the response to both bacterial and host-derived proinflammatory stimuli. HT-29 cells were apically treated with WT EPEC (E2348/69). At the same time, tumor necrosis factor (TNF)-{alpha} (10 ng/ml), IL-1beta (5 ng/ml), or enterohemorrhagic E. coli (EHEC) flagellin (10.3 µg/ml) was added basally. Basal media was assayed for IL-8 at 6 h. The results show %inhibition by setting uninfected but stimulated cells at 100% (n = 3, in triplicate).

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This paper demonstrates that SNs of DMEM-grown EPEC elicit a proinflammatory response from intestinal epithelial cells. Flagellin and a TTSS-independent >50-kDa protein contribute to this response, whereas LPS, EPEC DNA, and EspC do not play a role in this activity. Intriguingly, EPEC downregulates the proinflammatory response to various stimuli, including its own secreted products, EHEC flagellin, and host-derived cytokines such as TNF-{alpha} and IL-1beta. Active infection is required for the anti-inflammatory response, since WT SNs alone did not dampen IL-8 production. A functional TTSS is required for this anti-inflammatory effect; specifically, the requirement of EspB for this response may reflect its role in pore formation in the host cell membrane or maybe via its role as an intracellular effector (52).

Zhou et al. (57) recently reported that SNs of LB-grown EPEC and {Delta}escN induce IL-8 production in T84 cells and attributed this activity mainly to flagellin. Here we show that IL-8 production is not entirely dependent on flagellin, since {Delta}fliC mutant bacteria and their SNs elicit significant IL-8 production. Contribution of a nonflagellin molecule to EPEC-mediated inflammation was independently confirmed using TLR5 (flagellin receptor)-deficient Hep 2 epithelial cell lines. Treatment of these cells with WT EPEC and fliC::Cm (AGT01) SN stimulated a significant IL-8 response, indicating the presence of a nonflagellin proinflammatory molecule. Although the precise identity of this component is presently unknown, our data rules out LPS, EPEC DNA, and EspC as possible proinflammatory candidates in the EPEC SN.

The more intriguing property of EPEC, however, is its anti-inflammatory activity. We show here that EPEC downregulates the proinflammatory activity not only of its own secreted factors but of EHEC flagellin and host cytokines, including TNF-{alpha} and IL-1beta. Although extracellular components of EPEC elicit an IL-8 response in host cells, an active infection and a functional TTSS are required for EPEC-mediated dampening of this response. This anti-inflammatory property of EPEC is similar to that previously reported for S. typhimurium and Yersinia pseudotuberculosis, which elaborate type III secreted effectors that downregulate the IL-8 response. S. typhimurium AvrA blocks the ubiquitination of inhibitory {kappa}B, thereby preventing activation of the key proinflammatory transcription factor NF-{kappa}B (7). Similarly, the Yersinia spp. effectors YopJ and YopP block the release of TNF-{alpha} by macrophages and IL-8 by epithelial cells, resulting in a significant reduction in inflammation (5, 45, 46). Despite sequence similarity to AvrA, YopJ and YopP mediate their effects by a distinct mechanism involving the inhibition of mitogen-activated protein kinases c-Jun-NH2-terminal kinase, p38, and extracellular signal-regulated kinases 1 and 2 (5, 38, 40). The Yersinia spp. anti-inflammatory effect was also demonstrated in vivo, whereby Y. pseudotuberculosis anti-inflammatory components were effective in dampening colitis in trinitrobenzene sulfonic acid (TNBS)-treated mice (31). In addition to the pathogens Salmonella and Yersinia, a commensal organism, B. thetaiotaomicron was recently shown to attenuate inflammation by enhancing nuclear export of the transcriptionally active RelA subunit of NF-{kappa}B in a PPAR-{gamma} dependent mechanism (23).

Hauf et al. (17) demonstrated that Shiga toxin-producing E. coli actively suppress NF-{kappa}B in an EspB-dependent fashion, thus resulting in reduced expression of inflammatory cytokines (17). Consistent with this report, the type III secretion-deficient {Delta}escN strain was impaired for anti-inflammatory activity. Also, our data show that the EPEC-mediated suppression of inflammation is dependent on EspB, since the IL-8 response was exaggerated when HT-29 cells were infected with {Delta}espB and reduced to WT levels with complementation of espB. In contrast, the loss of other effectors, including EspF, EspG, and Map, had no effect on the anti-inflammatory activity.

In addition to forming pores in the host plasma membrane, EspB is translocated in the cytoplasm (52). Although EspB is essential to EPEC virulence in forming A/E lesions and may interact with {alpha}-catenin (28) and {alpha}1-antitrypsin (26), its cytosolic target molecules for the demonstrated anti-inflammatory effects are not known. Whether the role of EspB in this process is direct or indirect is not understood. Because it is required for pore formation, it is possible that it merely allows the translocation of another effector directly responsible for inhibiting inflammatory pathways. Alternatively, EspB may dampen IL-8 production by interacting with a host protein and interfering with proinflammatory signaling pathways.

In summary, our work demonstrates that EPEC-mediated inflammation is the net effect of two opposing phenomenon. Although secreted or shed extracellular components (flagellin, and >50-kDa protein) of EPEC exert a proinflammatory response, active infection and secretion of effector proteins via TTSS allow the bacteria to attenuate this response. Therefore the effect of EPEC on the host inflammatory response is actually a balance between its extracellular proinflammatory components and intracellular anti-inflammatory effector(s) that are translocated in host cells as a result of active infection. The net (dominant) effect is one of active inflammation defined by neutrophil transmigration and increased intraepithelial lymphocytes and goblet cells, leading to crypt abscess formation, as shown in a mouse model of EPEC infection (44). The ability of EPEC to modulate the inflammatory response by suppressing the degree or severity of changes associated with this reaction, such as loss of tissue integrity, may be essential for the survival of these noninvasive bacteria. With recent studies showing that pathogens such as Y. pseudotuberculosis can reduce the effects of TNBS-induced colitis in mice (31), it is interesting to speculate that attenuated forms of EPEC may have therapeutic benefits for diseases caused by dysregulated inflammatory responses, such as inflammatory bowel disease.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-50694 and DK-58964 to G. Hecht and DK-063030 to V. K. Viswanathan and Merit Review and Research Enhancement Awards from the Department of Veteran Affairs to G. Hecht.


    FOOTNOTES
 

Address for reprint requests and other correspondence: G. Hecht, Dept. of Medicine, Section of Digestive Diseases and Nutrition, Univ. of Illinois, 840 South Wood St., CSB Rm. 738A (MC 716), Chicago, IL 60612 (e-mail: gahecht{at}uic.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* R. Sharma and S. Tesfay contributed equally to this report. Back


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Abreu MT, Vora P, Faure E, Thomas LS, Arnold ET, and Arditi M. Decreased expression of Toll-like receptor-4 and MD-2 correlates with intestinal epithelial cell protection against dysregulated proinflammatory gene expression in response to bacterial lipopolysaccharide. J Immunol 167: 1609–1616, 2001.[Abstract/Free Full Text]
  2. Baldini MM, Kaper JB, Levine MM, Candy DC, and Moon HW. Plasmid-mediated adhesion in enteropathogenic Escherichia coli. J Pediatr Gastroenterol Nutr 2: 534–538, 1983.[Web of Science][Medline]
  3. Bambou JC, Giraud A, Menard S, Begue B, Rakotobe S, Heyman M, Taddei F, Cerf-Bensussan N, and Gaboriau-Routhiau V. In vitro and ex vivo activation of the TLR5 signaling pathway in intestinal epithelial cells by a commensal Escherichia coli strain. J Biol Chem 279: 42984–42992, 2004.[Abstract/Free Full Text]
  4. Bocker U, Yezerskyy O, Feick P, Manigold T, Panja A, Kalina U, Herweck F, Rossol S, and Singer MV. Responsiveness of intestinal epithelial cell lines to lipopolysaccharide is correlated with Toll-like receptor 4 but not Toll-like receptor 2 or CD14 expression. Int J Colorectal Dis 18: 25–32, 2003.[CrossRef][Web of Science][Medline]
  5. Boland A and Cornelis GR. Role of YopP in suppression of tumor necrosis factor alpha release by macrophages during Yersinia infection. Infect Immun 66: 1878–1884, 1998.[Abstract/Free Full Text]
  6. Cario E and Podolsky DK. Differential alteration in intestinal epithelial cell expression of toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease. Infect Immun 68: 7010–7017, 2000.[Abstract/Free Full Text]
  7. Collier-Hyams LS, Zeng H, Sun J, Tomlinson AD, Bao ZQ, Chen H, Madara JL, Orth K, and Neish AS. Cutting edge: Salmonella AvrA effector inhibits the key proinflammatory, anti-apoptotic NF-kappa B pathway. J Immunol 169: 2846–2850, 2002.[Abstract/Free Full Text]
  8. DiMango E, Zar HJ, Bryan R, and Prince A. Diverse Pseudomonas aeruginosa gene products stimulate respiratory epithelial cells to produce interleukin-8. J Clin Invest 96: 2204–2210, 1995.[Web of Science][Medline]
  9. Donnelly MA and Steiner TS. Two nonadjacent regions in enteroaggregative Escherichia coli flagellin are required for activation of toll-like receptor 5. J Biol Chem 277: 40456–40461, 2002.[Abstract/Free Full Text]
  10. Donnenberg MS, Yu J, and Kaper JB. A second chromosomal gene necessary for intimate attachment of enteropathogenic Escherichia coli to epithelial cells. J Bacteriol 175: 4670–4680, 1993.[Abstract/Free Full Text]
  11. Eaves-Pyles TD, Wong HR, Odoms K, and Pyles RB. Salmonella flagellin-dependent proinflammatory responses are localized to the conserved amino and carboxyl regions of the protein. J Immunol 167: 7009–7016, 2001.[Abstract/Free Full Text]
  12. Elliott SJ, Krejany EO, Mellies JL, Robins-Browne RM, Sasakawa C, and Kaper JB. EspG, a novel type III system-secreted protein from enteropathogenic Escherichia coli with similarities to VirA of Shigella flexneri. Infect Immun 69: 4027–4033, 2001.[Abstract/Free Full Text]
  13. Espinosa A and Alfano JR. Disabling surveillance: bacterial type III secretion system effectors that suppress innate immunity. Cell Microbiol 6: 1027–1040, 2004.[CrossRef][Web of Science][Medline]
  14. Gewirtz AT, Navas TA, Lyons S, Godowski PJ, and Madara JL. Cutting edge: bacterial flagellin activates basolaterally expressed TLR5 to induce epithelial proinflammatory gene expression. J Immunol 167: 1882–1885, 2001.[Abstract/Free Full Text]
  15. Giron JA, Torres AG, Freer E, and Kaper JB. The flagella of enteropathogenic Escherichia coli mediate adherence to epithelial cells. Mol Microbiol 44: 361–379, 2002.[CrossRef][Web of Science][Medline]
  16. Goosney DL, Gruenheid S, and Finlay BB. Gut feelings: enteropathogenic E. coli (EPEC) interactions with the host. Annu Rev Cell Dev Biol 16: 173–189, 2000.[CrossRef][Web of Science][Medline]
  17. Hauf N and Chakraborty T. Suppression of NF-kappa B activation and proinflammatory cytokine expression by Shiga toxin-producing Escherichia coli. J Immunol 170: 2074–2082, 2003.[Abstract/Free Full Text]
  18. Hecht G, Hodges K, Gill RK, Kear F, Tyagi S, Malakooti J, Ramaswamy K, and Dudeja PK. Differential regulation of Na+/H+ exchange isoform activities by enteropathogenic E. coli in human intestinal epithelial cells. Am J Physiol Gastrointest Liver Physiol 287: G370–G378, 2004.[Abstract/Free Full Text]
  19. Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, Takeda K, and Akira S. A Toll-like receptor recognizes bacterial DNA. Nature 408: 740–745, 2000.[CrossRef][Medline]
  20. Hueck CJ. Type III protein secretion systems in bacterial pathogens of animals and plants. Microbiol Mol Biol Rev 62: 379–433, 1998.[Abstract/Free Full Text]
  21. Jarvis KG, Giron JA, Jerse AE, McDaniel TK, Donnenberg MS, and Kaper JB. Enteropathogenic Escherichia coli contains a putative type III secretion system necessary for the export of proteins involved in attaching and effacing lesion formation. Proc Natl Acad Sci USA 92: 7996–8000, 1995.[Abstract/Free Full Text]
  22. Jarvis KG and Kaper JB. Secretion of extracellular proteins by enterohemorrhagic Escherichia coli via a putative type III secretion system. Infect Immun 64: 4826–4829, 1996.[Abstract]
  23. Kelly D, Campbell JI, King TP, Grant G, Jansson EA, Coutts AG, Pettersson S, and Conway S. Commensal anaerobic gut bacteria attenuate inflammation by regulating nuclear-cytoplasmic shuttling of PPAR-gamma and RelA. Nat Immun 5: 104–112, 2004.[CrossRef][Web of Science][Medline]
  24. Kenny B and Finlay BB. Protein secretion by enteropathogenic Escherichia coli is essential for transducing signals to epithelial cells. Proc Natl Acad Sci USA 92: 7991–7995, 1995.[Abstract/Free Full Text]
  25. Kenny B and Jepson M. Targeting of an enteropathogenic Escherichia coli (EPEC) effector protein to host mitochondria. Cell Microbiol 2: 579–590, 2000.[CrossRef][Web of Science][Medline]
  26. Knappstein S, Ide T, Schmidt MA, and Heusipp G. Alpha 1-antitrypsin binds to and interferes with functionality of EspB from atypical and typical enteropathogenic Escherichia coli strains. Infect Immun 72: 4344–4350, 2004.[Abstract/Free Full Text]
  27. Knutton S, Baldwin T, Williams PH, and McNeish AS. Actin accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new diagnostic test for enteropathogenic and enterohemorrhagic Escherichia coli. Infect Immun 57: 1290–1298, 1989.[Abstract/Free Full Text]
  28. Kodama T, Akeda Y, Kono G, Takahashi A, Imura K, Iida T, and Honda T. The EspB protein of enterohaemorrhagic Escherichia coli interacts directly with alpha-catenin. Cell Microbiol 4: 213–222, 2002.[CrossRef][Web of Science][Medline]
  29. Levine MM and Edelman R. Enteropathogenic Escherichia coli of classic serotypes associated with infant diarrhea: epidemiology and pathogenesis. Epidemiol Rev 6: 31–51, 1984.[Free Full Text]
  30. Madara JL, Stafford J, Dharmsathaphorn K, and Carlson S. Structural analysis of a human intestinal epithelial cell line. Gastroenterology 92: 1133–1145, 1987.[Web of Science][Medline]
  31. Marceau M, Dubuquoy L, Caucheteux-Rousseaux C, Foligne B, Desreumaux P, and Simonet M. Yersinia pseudotuberculosis anti-inflammatory components reduce trinitrobenzene sulfonic acid-induced colitis in the mouse. Infect Immun 72: 2438–2441, 2004.[Abstract/Free Full Text]
  32. McNamara BP and Donnenberg MS. A novel proline-rich protein, EspF, is secreted from enteropathogenic Escherichia coli via the type III export pathway. FEMS Microbiol Lett 166: 71–78, 1998.[CrossRef][Web of Science][Medline]
  33. McNamara BP, Koutsouris A, O'Connell CB, Nougayrede JP, Donnenberg MS, and Hecht G. Translocated EspF protein from enteropathogenic Escherichia coli disrupts host intestinal barrier function. J Clin Invest 107: 621–629, 2001.[Web of Science][Medline]
  34. Mellies JL, Navarro-Garcia F, Okeke I, Frederickson J, Nataro JP, and Kaper JB. espC pathogenicity island of enteropathogenic Escherichia coli encodes an enterotoxin. Infect Immun 69: 315–324., 2001.[Abstract/Free Full Text]
  35. Merlin C, McAteer S, and Masters M. Tools for characterization of Escherichia coli genes of unknown function. J Bacteriol 184: 4573–4581, 2002.[Abstract/Free Full Text]
  36. Ogushi K, Wada A, Niidome T, Mori N, Oishi K, Nagatake T, Takahashi A, Asakura H, Makino S, Hojo H, Nakahara Y, Ohsaki M, Hatakeyama T, Aoyagi H, Kurazono H, Moss J, and Hirayama T. Salmonella enteritidis FliC (flagella filament protein) induces human beta-defensin-2 mRNA production by Caco-2 cells. J Biol Chem 276: 30521–30526, 2001.[Abstract/Free Full Text]
  37. Orth K, Xu Z, Mudgett MB, Bao ZQ, Palmer LE, Bliska JB, Mangel WF, Staskawicz B, and Dixon JE. Disruption of signaling by Yersinia effector YopJ, a ubiquitin-like protein protease. Science 290: 1594–1597, 2000.[Abstract/Free Full Text]
  38. Palmer LE, Hobbie S, Galan JE, and Bliska JB. YopJ of Yersinia pseudotuberculosis is required for the inhibition of macrophage TNF-alpha production and downregulation of the MAP kinases p38 and JNK. Mol Microbiol 27: 953–965, 1998.[CrossRef][Web of Science][Medline]
  39. Rogers TJ, Paton AW, McColl SR, and Paton JC. Enhanced CXC chemokine responses of human colonic epithelial cells to locus of enterocyte effacement-negative shiga-toxigenic Escherichia coli. Infect Immun 71: 5623–5632, 2003.[Abstract/Free Full Text]
  40. Ruckdeschel K, Machold J, Roggenkamp A, Schubert S, Pierre J, Zumbihl R, Liautard JP, Heesemann J, and Rouot B. Yersinia enterocolitica promotes deactivation of macrophage mitogen-activated protein kinases extracellular signal-regulated kinase-1/2, p38, and c-Jun NH2-terminal kinase. Correlation with its inhibitory effect on tumor necrosis factor-alpha production. J Biol Chem 272: 15920–15927, 1997.[Abstract/Free Full Text]
  41. Savkovic SD, Koutsouris A, and Hecht G. Activation of NF-kappaB in intestinal epithelial cells by enteropathogenic Escherichia coli. Am J Physiol Cell Physiol 273: C1160–C1167, 1997.[Abstract/Free Full Text]
  42. Savkovic SD, Koutsouris A, and Hecht G. Attachment of a noninvasive enteric pathogen, enteropathogenic Escherichia coli, to cultured human intestinal epithelial monolayers induces transmigration of neutrophils. Infect Immun 64: 4480–4487, 1996.[Abstract]
  43. Savkovic SD, Ramaswamy A, Koutsouris A, and Hecht G. EPEC-activated ERK1/2 participate in inflammatory response but not tight junction barrier disruption. Am J Physiol Gastrointest Liver Physiol 281: G890–G898, 2001.[Abstract/Free Full Text]
  44. Savkovic SD, Villanueva J, Turner JR, Matkowskyj KA, and Hecht G. Mouse model of enteropathogenic Escherichia coli infection. Infect Immun 73: 1161–1170, 2005.[Abstract/Free Full Text]
  45. Schesser K, Spiik AK, Dukuzumuremyi JM, Neurath MF, Pettersson S, and Wolf-Watz H. The yopJ locus is required for Yersinia-mediated inhibition of NF-kappaB activation and cytokine expression: YopJ contains a eukaryotic SH2-like domain that is essential for its repressive activity. Mol Microbiol 28: 1067–1079, 1998.[CrossRef][Web of Science][Medline]
  46. Schulte R, Wattiau P, Hartland EL, Robins-Browne RM, and Cornelis GR. Differential secretion of interleukin-8 by human epithelial cell lines upon entry of virulent or nonvirulent Yersinia enterocolitica. Infect Immun 64: 2106–2113, 1996.[Abstract]
  47. Simonovic I, Arpin M, Koutsouris A, Falk-Krzesinski HJ, and Hecht G. Enteropathogenic Escherichia coli activates ezrin, which participates in disruption of tight junction barrier function. Infect Immun 69: 5679–5688, 2001.[Abstract/Free Full Text]
  48. Simonovic I, Rosenberg J, Koutsouris A, and Hecht G. Enteropathogenic Escherichia coli dephosphorylates and dissociates occludin from intestinal epithelial tight junctions. Cell Microbiol 2: 305–315, 2000.[CrossRef][Web of Science][Medline]
  49. Stein M, Kenny B, Stein MA, and Finlay BB. Characterization of EspC, a 110-kilodalton protein secreted by enteropathogenic Escherichia coli which is homologous to members of the immunoglobulin A protease-like family of secreted proteins. J Bacteriol 178: 6546–6554, 1996.[Abstract/Free Full Text]
  50. Steiner TS, Nataro JP, Poteet-Smith CE, Smith JA, and Guerrant RL. Enteroaggregative Escherichia coli expresses a novel flagellin that causes IL-8 release from intestinal epithelial cells. J Clin Invest 105: 1769–1777, 2000.[Web of Science][Medline]
  51. Tallant T, Deb A, Kar N, Lupica J, de Veer MJ, and DiDonato JA. Flagellin acting via TLR5 is the major activator of key signaling pathways leading to NF-kappa B and proinflammatory gene program activation in intestinal epithelial cells (Abstract). BMC Microbiol 4: 33, 2004.[CrossRef][Medline]
  52. Taylor KA, O'Connell CB, Luther PW, and Donnenberg MS. The EspB protein of enteropathogenic Escherichia coli is targeted to the cytoplasm of infected HeLa cells. Infect Immun 66: 5501–5507, 1998.[Abstract/Free Full Text]
  53. Tomson FL, Viswanathan VK, Kanack KJ, Kanteti RP, Straub KV, Menet M, Kaper JB, and Hecht G. Enteropathogenic Escherichia coli EspG disrupts microtubules and in conjunction with Orf3 enhances perturbation of the tight junction barrier. Mol Microbiol 56: 447–464, 2005.[CrossRef][Web of Science][Medline]
  54. Trosky JE, Mukherjee S, Burdette DL, Roberts M, McCarter L, Siegel RM, and Orth K. Inhibition of MAPK signaling pathways by VopA from Vibrio parahaemolyticus. J Biol Chem 279: 51953–51957, 2004.[Abstract/Free Full Text]
  55. Yuhan R, Koutsouris A, Savkovic SD, and Hecht G. Enteropathogenic Escherichia coli-induced myosin light chain phosphorylation alters intestinal epithelial permeability. Gastroenterology 113: 1873–1882, 1997.[CrossRef][Web of Science][Medline]
  56. Zhang J, Xu K, Ambati B, and Yu FS. Toll-like receptor 5-mediated corneal epithelial inflammatory responses to Pseudomonas aeruginosa flagellin. Invest Ophthalmol Vis Sci 44: 4247–4254, 2003.[Abstract/Free Full Text]
  57. Zhou X, Giron JA, Torres AG, Crawford JA, Negrete E, Vogel SN, and Kaper JB. Flagellin of enteropathogenic Escherichia coli stimulates interleukin-8 production in T84 cells. Infect Immun 71: 2120–2129, 2003.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Infect. Immun.Home page
S. C. F. Sampaio, T. A. T. Gomes, C. Pichon, L. du Merle, S. Guadagnini, C. M. Abe, J. L. M. Sampaio, and C. Le Bouguenec
The Flagella of an Atypical Enteropathogenic Escherichia coli Strain Are Required for Efficient Interaction with and Stimulation of Interleukin-8 Production by Enterocytes In Vitro
Infect. Immun., October 1, 2009; 77(10): 4406 - 4413.
[Abstract] [Full Text] [PDF]


Home page
MicrobiologyHome page
R. Nobe, J.-P. Nougayrede, F. Taieb, M. Bardiau, D. Cassart, F. Navarro-Garcia, J. Mainil, T. Hayashi, and E. Oswald
Enterohaemorrhagic Escherichia coli serogroup O111 inhibits NF-{kappa}B-dependent innate responses in a manner independent of a type III secreted OspG orthologue
Microbiology, October 1, 2009; 155(10): 3214 - 3225.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. Bellmeyer, C. Cotton, R. Kanteti, A. Koutsouris, V. K. Viswanathan, and G. Hecht
Enterohemorrhagic Escherichia coli suppresses inflammatory response to cytokines and its own toxin
Am J Physiol Gastrointest Liver Physiol, September 1, 2009; 297(3): G576 - G581.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. A. Khan, S. Bouzari, C. Ma, C. M. Rosenberger, K. S. B. Bergstrom, D. L. Gibson, T. S. Steiner, and B. A. Vallance
Flagellin-Dependent and -Independent Inflammatory Responses following Infection by Enteropathogenic Escherichia coli and Citrobacter rodentium
Infect. Immun., April 1, 2008; 76(4): 1410 - 1422.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
D. V. Zurawski, K. L. Mumy, L. Badea, J. A. Prentice, E. L. Hartland, B. A. McCormick, and A. T. Maurelli
The NleE/OspZ Family of Effector Proteins Is Required for Polymorphonuclear Transepithelial Migration, a Characteristic Shared by Enteropathogenic Escherichia coli and Shigella flexneri Infections
Infect. Immun., January 1, 2008; 76(1): 369 - 379.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. L. Roxas, A. Koutsouris, and V. K. Viswanathan
Enteropathogenic Escherichia coli-Induced Epidermal Growth Factor Receptor Activation Contributes to Physiological Alterations in Intestinal Epithelial Cells
Infect. Immun., May 1, 2007; 75(5): 2316 - 2324.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. N. Luck, L. Badea, V. Bennett-Wood, R. Robins-Browne, and E. L. Hartland
Contribution of FliC to Epithelial Cell Invasion by Enterohemorrhagic Escherichia coli O113:H21
Infect. Immun., December 1, 2006; 74(12): 6999 - 7004.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
J. A. Guttman, F. N. Samji, Y. Li, A. W. Vogl, and B. B. Finlay
Evidence that Tight Junctions Are Disrupted Due to Intimate Bacterial Contact and Not Inflammation during Attaching and Effacing Pathogen Infection In Vivo
Infect. Immun., November 1, 2006; 74(11): 6075 - 6084.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/4/G685    most recent
00404.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sharma, R.
Right arrow Articles by Hecht, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sharma, R.
Right arrow Articles by Hecht, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.