AJP - GI AJP: Renal Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Gastrointest Liver Physiol 290: G1298-G1306, 2006. First published January 19, 2006; doi:10.1152/ajpgi.00530.2005
0193-1857/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/6/G1298    most recent
00530.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tietz, A. B.
Right arrow Articles by Schäfer, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tietz, A. B.
Right arrow Articles by Schäfer, C.

INFLAMMATION/IMMUNITY/MEDIATORS

Gene deletion of MK2 inhibits TNF-{alpha} and IL-6 and protects against cerulein-induced pancreatitis

Anne Barbara Tietz,1,* Antje Malo,1,* Joachim Diebold,2 Alexey Kotlyarov,3 Andreas Herbst,1 Frank T. Kolligs,1 Barbara Brandt-Nedelev,4 Walter Halangk,4 Matthias Gaestel,3 Burkhard Göke,1 and Claus Schäfer1

1Departments of Internal Medicine II, Klinikum Grosshadern and 2Pathology, Ludwig Maximilians University, Munich; and 3Department of Biochemistry, Hannover Medical School, Hannover; and 4Department of Surgery, Division of Experimental Surgery, Otto-von-Guericke-University, Magdeburg, Germany

Submitted 15 November 2005 ; accepted in final form 17 January 2006


   ABSTRACT
TOP
 ABSTRACT
MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Inflammatory effects contribute to the pathogenesis of pancreatitis. Clearly, proinflammatory cytokines like TNF-{alpha} and IL-6 are involved in this process and the associated systemic complications. The MAPKAPK-2 (MK2) signaling pathway is involved in cytokine gene expression. Therefore, we hypothesized that blockade of this pathway inhibits the expression of proinflammatory cytokines and thereby protects against pancreatitis. To investigate this, we used an in vivo mouse model with a homozygous deletion of the MK2 gene. Pancreatitis was induced by injection of cerulein. The severity was determined by measuring serum lipase, pancreatic trypsin activation, pancreatic edema, and morphological changes by quantitative scoring of histological sections. Systemic inflammation was evaluated by measuring myeloperoxidase activity in lung tissue. Serum levels of TNF-{alpha} and IL-6 were measured using an ELISA, and mRNA levels were identified using RT-PCR and subsequent quantitative PCR analysis. Pancreatitis in animals with deletion of the MK2 gene is less severe and accompanied with reduced serum levels of TNF-{alpha} and IL-6. Pancreatic mRNA levels revealed a fourfold reduction of IL-6 mRNA expression in MK2 –/– mice. Effects were associated with suppression of pancreatic trypsin activity and reduced acinar cell injury. In summary, these data show that gene deletion of MK2 ameliorates cerulein-induced pancreatitis. TNF-{alpha} and IL-6 signaling is mediated by the MK2 pathway and therefore crucial for the regulatory inflammatory processes. TNF-{alpha} expression is supposably regulated by a posttranscriptional mechanism, whereas IL-6 expression is most likely regulated by transcriptional effects.

cytokines; MAPKAP kinase; actin cytoskeleton; inflammation

ACUTE PANCREATITIS HAS BEEN the subject of investigations for many years. In addition to the hypotheses of premature trypsinogen activation, changes in the cytoskeleton, the colocalization hypothesis, and the disruption of exocrine protein transport, cytokines have become a new focus in the investigation of the pathophysiology of pancreatitis. Although the exact underlying mechanisms have only begun to emerge, cytokines play a crucial role in the process of pancreatitis with the systemic complications like lung injury and multiple organ dysfunction syndrome (MODS). Since MODS is the primary cause of morbidity and mortality in acute pancreatitis (3), there is a great need to understand the pathophysiological processes leading to this fatal complication. Here, TNF-{alpha} and IL-6 as proinflammatory cytokines play a predominant role (2). It is not clear by which pathway cytokines trigger the cascade of inflammation. However, MK2 is an essential element involved in regulation of cytokine gene expression, for example, TNF-{alpha} in spleen cells and macrophages (18).

MK2 is a member of the MAP kinase-activated protein kinases and was first purified by Stokoe et al. (31). The specific activator of MK2 is the stress-activated protein kinase p38, which phosphorylates and activates MK2. Furthermore, it has been shown that MK2 is activated by heat-shock and TNF-{alpha} and is identified as the kinase responsible for the phosphorylation of the small heat-shock protein 27 (Hsp27) (8, 31). IL-6 synthesis in response to stimulation with TNF-{alpha} is reported to be regulated by the p38 MAP kinase pathway as well (1).

Although TNF-{alpha} had been known to be an important effector in the MAP kinase pathway, its specific function and regulation in the pancreas is poorly understood. One study showed that pancreatic acini produce, secrete, and respond to TNF-{alpha} (12). Another study investigated the effects of TNF-{alpha} antibodies in a pancreatitis model induced with retrograde bile infusion in rats (11). However, no investigations have been followed in mice so far, and, most important, very little is known about the detailed intracellular mechanisms and pathways by which TNF-{alpha} evokes the deleterious effects. The aim of this study was to determine whether gene deletion of MK2 results in reduced TNF-{alpha} and IL-6 expression and thereby protects in a cerulein-induced model of pancreatitis. With our mouse model we provide a new approach in elucidating a MAP kinase-dependent pathway involving cytokines leading to pancreatic injury and the affiliated systemic complications.


   MATERIAL AND METHODS
TOP
 ABSTRACT
 MATERIAL AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animals. C57BL (wild-type) mice and MK2 –/– mice weighing 25–30 g were used in this study. MK2 –/– animals were generated on a C57BL/6J genetic background as described previously (18). During the experiments the animals were housed and maintained under controlled environmental conditions. All animal studies were in accordance with the national and international guidelines as outlined in the Guide for the Care and Use of Laboratory Animals and performed according to protocols approved by the institutional clinical care and the local veterinarian office.

Induction of acute pancreatitis. Wild-type mice and MK2 –/– mice received hourly intraperitoneal injections containing a supramaximal dose (50 µg/kg) of cerulein. The control groups (C57BL and MK2 –/– mice) received comparable injections of 0.9% saline at hourly intervals. One hour after the final cerulein injection, animals were killed by decapitation under isoflurane anesthesia, and blood was collected. Acini were isolated by collagenase digestion as described in detail previously (12).

Quantification of cerulein-induced injuries. Blood and pancreatic tissue were processed as described previously (20). Serum lipase activity was measured using a colorimetric assay according to the manufacturer's instructions (Roche Diagnostics, Indianapolis, IN). Results are expressed in units per liter. Pancreatic edema was measured as described earlier by Tashiro et al. (33).

Quantitation of pancreatic trypsin activity. Trypsin activity was measured as described previously (20). In brief, pancreas samples were homogenized in ice-cold 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (pH 6.0; 250 mM sucrose, 5 mM MOPS, 1 mM magnesium sulfate) using a Teflon glass homogenizer. The resulting homogenate was centrifuged, and the supernatant was used for the assay. Trypsin activity was measured fluorometrically using Boc-Glu-Ala-Arg-AMC-HCl (Bachem, Heidelberg, Germany) as substrate, and the activity was calculated from the slope using a standard curve generated with purified trypsin. Protein content was measured with the Bio-Rad protein assay with trypsin activation expressed as femtomoles per milligram protein.

Histological studies and evaluation of pancreatic morphology. One portion of the pancreas was processed for hematoxylin-eosin staining by standard procedures for histological studies (20). Multiple randomly chosen microscopic fields from at least four mice from each treatment group were examined and semiquantitated based on necrosis, vacuolization, presence of inflammatory cells, and edema by a pathologist who was blinded to the treatment, as described previously (20). In short, sections were examined for each sample and scored on a scale of 0–3 (0 being normal and 3 being severe) based on the number of acinar cell necrosis and the presence of vacuolization, interstitial edema, and interstitial inflammation, and to what extent these characteristics affected the organ.

Quantification of myeloperoxidase activity. Myeloperoxidase (MPO) activity in the lung tissue was measured as described previously (14). Tissue samples were homogenized using a Elmer Potter homogenizer at 2,400 rpm. An aliquot of this homogenate was taken for protein determination; the rest was centrifuged at 10,000 g and 4°C for 10 min. Pellet was resuspended in extraction buffer and snap-frozen and thawed four times. Samples were subsequently sonicated twice for 10 s and centrifuged for 5 min at 10,000 g and 4°C. The supernatant was used for MPO measurement. The reaction mixture consisted of 1 ml KH2PO4 buffer (pH 6.0), 10 µl o-dianisidine, 10 µl H2O2, and 50–200 µl of the supernatant. The supernatant was added to the mixture after 1 min of monitoring the absorbance at 460 nm, and absorbance was monitored for an additional 4 min. Activity was calculated from the slope and expressed as milliunits per milligram protein.

Determination of TNF-{alpha} and IL-6 serum levels. TNF-{alpha} and IL-6 levels were measured using a commercially available ELISA kit for mouse TNF-{alpha} and IL-6 (Quantikine; R&D Systems, Minneapolis, MN) according to the manufacturer's protocol. Each sample was measured in duplicate with a microplate reader and expressed as means ± SE.

RNA isolation and RT-PCR analysis. Total cellular RNA was extracted from pancreatic sections. Approximately 50 mg pancreatic tissue was homogenized 1 ml TRIzol (Invitrogen, Carlsbad, CA) with a Polytron homogenizer. After centrifugation, phase separation was achieved with chloroform. The aqueous phase was transferred to a new microcentrifuge tube. RNA was precipitated by adding 0.5 ml isopropylalcohol per 1 ml TRIzol and a 10-min centrifugation period at 4°C and 12,000 g. The pellet was washed with ethanol. RNA was further purified utilizing the RNAeasy kit (Qiagen, Basel, Switzerland) following the manufacturer's instructions. Total RNA, 4 µg, was subjected to first-strand cDNA synthesis in a 20-µl reaction mixture containing SuperScript first-strand reverse transcriptase (Invitrogen). One microliter of the resulting cDNA was used for each polymerase reaction (PCR), which contained HotStarTaq polymerase (Qiagen), buffer, and magnesium chloride as supplied with the enzyme and dNTPs from Peqlab (Helsingborg, Sweden). Primers were received from MWG Biotech (Martinsried, Germany). Primer sequences were designed as following (5' to 3') TNF-{alpha}, CTATGGCCCAGACCCTCACACTC/GCTGGCACCACTAGTTGGTTGTCTT; IL-6, CGTGGAAATGAGAAAAGAGTTGTG/CCAGTTTGGTAGCATCCATCATTTCT; GAPDH, ACCACAGTCCATGCCATCAC/TCCACCACC; and murine actin, CATTGCTGACAGGATGCAGAA/GCTGATCCACATCTGCTGGAA.

Real-time quantitative PCR. All assays were performed with the Corbett research rotor-gene RG-3000 machine using SYBR green detection. For the preparation of the master mix the Platinum Taq reagent kit (Invitrogen, Karlsruhe, Germany) and SYBR green detection method (Molecular Probes, Leiden, Netherlands), with a total reaction volume of 20 µl containing 8 µl of a 1:5 diluted DNA, were used. Primers were the ones described above. Identity of PCR products was confirmed by melting-point analysis and agarose gel electrophoresis.

Western blotting. In brief, Western blotting and isoelectric focusing experiments as well as the initial preparation of lysates were performed as described previously (20). Primary antibodies used in this study included Hsp27 (Stressgen, Victoria, Canada), STAT 1 (Transduction Labs, Heidelberg, Germany), phospho STAT 1 (Upstate, Hamburg, Germany), STAT 3 (Transduction Labs), phospho STAT 3 (Santa Cruz Biotechnology, Heidelberg, Germany), ATF-2 and phospho ATF-2 (Santa Cruz Biotechnology), and p38 and phospho p38 (Cell Signaling, Heidelberg, Germany) in a 1:1,000 dilution. After washing of the membranes, the appropriate secondary antibody conjugated to horseradish peroxidase (Amersham Pharmacia Biotech, Freiburg, Germany) was applied in a 1:10,000 dilution and incubated for 1 h at room temperature. Finally, antibody binding was detected by enhanced chemiluminescent detection system (ECL, Amersham Pharmacia Biotech) and recorded on film.

Statistical analysis. Results are means ± SE. Values were obtained from multiple determinations in six or more separate experiments. In every experiment there were at least 3–4 animals in each treatment group. Statistical analysis for serum lipase, pancreatic water content, pancreatic trypsin activity, cytokine protein levels, and mRNA expression, as well as MPO activity, was carried out by the Mann-Whitney U-test. Severity scoring for edema, inflammation, vacuolization, and necrosis was analyzed using the Kruskal-Wallis one-way analysis of variance on the Ranks Dunn’s method. All statistical computations were performed using SigmaStat 3.0 statistical software (SYSTAT Software, Chicago, IL).


   RESULTS
TOP
 ABSTRACT
 MATERIAL AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
MK2 –/– mice lack the ability to phosphorylate Hsp27. Previously, we have shown that Hsp27 is one of the major downstream targets of the p38 signaling pathway and that MK2 is the kinase to phosphorylate Hsp27 (27). Therefore, we investigated the level of Hsp27 phosphorylation to further confirm that this pathway is disrupted in MK2 –/– mice. Phosphorylation of Hsp27 correlates with an acidic shift on the isoelectric focusing gel. Immunoblotting of pancreatic lysates from uninjected mice showed only the unphosphorylated form of Hsp27, whereas in control mice after saline injections, two specific bands appeared representing the unphosphorylated and monophosphorylated form of Hsp27 (Fig. 1). The phosphorylation is most likely in response to the stress of six intraperitoneal saline injections. Treatment with cerulein led to an acidic shift and appearance of a third band, representing the unphosphorylated, monophosphorylated, and diphosphorylated forms, respectively (Fig. 1). Immunoblotting of control pancreatic lysates from MK2 –/– animals (treatment with saline) showed only the unphosphorylated form of Hsp27 at the basic end of the gel, and treatment of the MK2 –/– animals with cerulein did not change this pattern, indicating that Hsp27 is not phosphorylatable in MK2 –/– animals. These data confirm that the MK2 signaling pathway is disrupted in these mice. To further avoid effects of infiltrating inflammatory cells on the phosphorylation of Hsp27, in vitro studies on isolated acini from MK2-deficient mice were performed. Similar to the in vivo results, no Hsp27 phosphorylation was observed after stimulation with other secretagogues like JMV 180, carbachol, and bombesin or after induction of osmotic stress by sorbitol (results not shown).


Figure 1
View larger version (33K):
[in this window]
[in a new window]
  		Fig. 1. Phosphorylation analysis of Hsp27 by isoelectric focusing and Western blotting. P, pancreas removed quickly without treatment of the animals; Cont., lysates from animals that received six hourly intraperitoneal injections of saline; Cer, six hourly intraperitoneal injections of 50 µg/kg cerulein. 0 P, unphosphorylated; 1 P, monophosphorylated; 2 P, diphosphorylated form of Hsp27. C57BL mice show a lack of phosphorylation without any pharmaceutical treatment (P, wild type), minor phosphorylation after saline injections (Cont., wild type), and increased phosphorylation after the injection of cerulein (Cer, wild type). MK2 –/– mice show a lack of phosphorylation after treatment with saline (Cont., MK-2–/–, two different animals) and cerulein (Cer, MK-2–/–, two different animals). Representative immunoblots of at least three independent experiments are shown.

 
Effects of MK2 gene deletion on lipase activity, edema, and trypsin activation. To examine the effects of gene deletion of MK2 on the severity of acute pancreatitis, mice were treated with supramaximal concentrations of cerulein, and several parameters of pancreatitis were measured and compared with those obtained from wild-type mice. Treatment of control mice with six hourly injections of 50 µg/kg cerulein led to enhanced serum lipase, pancreatic water content, and pancreatic trypsin activity (Fig. 2, A–C). In contrast, gene deletion of MK2 showed significantly reduced levels of serum lipase, edema, and suppression of pancreatic trypsin activity (Fig. 2, A–C).


Figure 2
View larger version (16K):
[in this window]
[in a new window]
  		Fig. 2. Effects of gene deletion of MK2 on cerulein-induced pancreatitis. Serum lipase levels (A), pancreatic water content (B), and trypsin activity (C) were measured as described in MATERIALS AND METHODS after six hourly injections of 50 µg/kg cerulein (black bars). Control animals received saline (gray bars). Results are means ± SE. In each experimental group at least 5 animals are included. *P < 0.05 and **P < 0.01 were considered significant.

 
Morphological evaluations in MK2 –/– mice compared with wild-type animals. Saline-injected control mice showed no evidence of pancreatic edema or other characteristics of acute pancreatitis (Fig. 3, A and C). Cerulein treatment of control mice resulted in acute pancreatitis characterized by increased edema, inflammation, vacuolization, and necrosis (3B). In contrast, treatment of MK2 –/– with cerulein led to markedly attenuated inflammatory changes that would normally be associated with acute pancreatitis including vacuolization, necrosis, and inflammation (Fig. 3D). To assess these changes in a semiquantitative manner, histological slides of the pancreas were scored blinded as described in MATERIALS AND METHODS. Treatment of nontransgenic mice with cerulein resulted in a significant increase in edema, inflammation, vacuolization, and necrosis, whereas in saline-injected mice, none or only a few of these parameters were detectable (Fig. 3, bottom). In MK2 –/– mice, edema was reduced compared with the control animals after cerulein treatment. Moreover, these pancreata showed no necrosis and only modest inflammation and vacuolization (Fig. 3). These results show that MK2 deficiency protects against the morphological deleterious effects of acute pancreatitis.


Figure 3
View larger version (75K):
[in this window]
[in a new window]
  		Fig. 3. Top: morphological changes in cerulein-induced pancreatitis. Representative hemotoxylin-eosin-stained sections of pancreas were examined by light microscopy in normal control wild-type animals (A), an MK2 –/– control animal (C), a wild-type animal administered six hourly injections of 50 µg/kg cerulein (B), and an MK2 –/– animal administered 6 intraperitoneal cerulein injections (D). Bottom: effects of gene deletion of MK2 on pancreatic inflammatory changes after induction of pancreatitis. Histological sections of pancreata harvested 1 h after six hourly injections of saline (open bars) or cerulein from wild-type (hatched bars) or MK2 –/– mice (filled bars) were scored by an independent pathologist from 0 (normal) to 3 (severe) for edema, inflammation, vacuolization, and necrosis as described in MATERIALS AND METHODS. Results are means ± SE; *P < 0.05; **P < 0.01.

 
TNF-{alpha} and IL-6 levels are attenuated in MK2 –/– mice compared with control animals. To assess the protein levels of TNF-{alpha} and IL-6 in the serum, we performed an ELISA assay from both MK2 –/– and control mice. Cerulein treatment in wild-type control animals revealed a pronounced increase of serum IL-6 levels, whereas this induction was almost completely blocked in MK2-deficient mice. Injection of sodium chloride did not affect the basal IL-6 levels. (Fig. 4A). Similar results were observed for TNF-{alpha} serum levels. MK2 –/– mice express more than a 50% reduction in TNF-{alpha} protein compared with wild-type mice after the induction of pancreatitis with cerulein. In addition to these results, experiments were performed with pancreas homogenates to assess the levels of cytokine in pancreatic tissue after induction of pancreatitis. These data revealed almost similar results (Fig. 5), whereas for TNF-{alpha} levels in pancreatic homogenates, only a trend, but not a statistically significant reduction was observed. Measuring TNF-{alpha} in homogenates from pancreatitis tissue seems to be very difficult. One of the reasons is that TNF-{alpha} is highly sensitive to degradation in inflamed tissue. In addition, although we used a homogenization buffer with protease inhibitors, the pancreas consists of such large amounts of these proteases that probably not all can be inhibited and therefore acts on the degradation of TNF-{alpha}. Nevertheless, in summary, gene deletion of MK2 leads to significantly lower serum protein levels of TNF-{alpha} and IL-6, whereas in pancreatic homogenates, only reduced levels of IL-6 were detectable in the model of cerulein-induced pancreatitis compared with wild-type mice.


Figure 4
View larger version (13K):
[in this window]
[in a new window]
  		Fig. 4. Effects of gene deletion of MK2 on IL-6 and TNF-{alpha} serum protein levels. IL-6 (A) and TNF-{alpha} (B) were measured with ELISA technique following the manufacturer's protocol after six hourly injections of either saline (gray bars) or cerulein (black bars). Results are means ± SE with at least 5 animals in each saline group and 10 animals in the cerulein group; *P < 0.05; **P < 0.01.

 

Figure 5
View larger version (11K):
[in this window]
[in a new window]
  		Fig. 5. Effects of gene deletion of MK2 on IL-6 and TNF-{alpha} pancreatic homogenate protein levels. IL-6 (A) and TNF-{alpha} (B) were measured with ELISA technique following the manufacturer's protocol after six hourly injections of either saline (gray bars) or cerulein (black bars). Results are means ± SE with at least 5 animals in each saline group and 10 animals in the cerulein group; **P < 0.01; n.s., not significant.

 
Kinetics of TNF-{alpha} and IL-6 protein expression in serum. To evaluate the most significant time points of TNF-{alpha} and IL-6 protein level expression in the model of cerulein-induced pancreatitis, we performed time-course experiments for the two cytokines using an ELISA. We determined the TNF-{alpha} and IL-6 serum levels after hourly injections over 1, 4, 6, 7, 12, and 24 h (only 12 hourly injections). For both cytokines, the main protein level peak occurred between 6 and 7 h. IL-6 levels became as high as 317.42 ng/ml, and TNF-{alpha} levels rose up to 2.48 pg/ml at this time point. TNF-{alpha} continued to peak at 12 h with 2.69 pg/ml and then rapidly degraded after 24 h to only 0.03 pg/ml. IL-6 levels already start decreasing after 7 h to protein levels of 33.12 pg/ml at 12 h (results not shown) and show a further drastic reduction at 24 h with only 3.79 pg/ml. MK2 –/– mice showed almost no increase in IL-6 serum levels after induction of pancreatitis over a period of 7 h. Even at the maximum IL-6 level in wild-type mice after 7 h, the MK2 –/– mice were near basal levels (58 pg/ml compared with 39 pg/ml for the sodium chloride-treated MK2 –/– control mice). For TNF-{alpha} serum levels in MK2 –/– mice, only data for 1, 3, and 7 h after induction of pancreatitis exists. Here we observed a significant reduction of the TNF-{alpha} serum levels. MK2 deletion did not alter the time to reach serum peak levels of TNF-{alpha}

MPO activity in lung tissue. To further evaluate the systemic complications of acute pancreatitis, we assessed MPO activity, a marker for neutrophil sequestration, in lung tissue of control and MK2 –/– mice after treatment with cerulein. In control mice, administration of cerulein induced a significant increase in MPO activity (Fig. 6), whereas in MK2 –/– mice, MPO activity was significantly reduced by more than 50%. Taken together, these results indicate that MK2-deficient animals are not only protected from pancreatic injury and elevation of serum lipase levels, pancreatic trypsin activity, and pancreatic edema, but also from the subsequent complications accompanied by sequestration of neutrophils in the pulmonary microcirculation.


Figure 6
View larger version (9K):
[in this window]
[in a new window]
  		Fig. 6. Myeloperoxidase (MPO) activity was measured in the lung after six hourly cerulein injections in wild-type (hatched bar) and MK2 –/– (lined bar) animals. Open bar shows the C57BL mice after administration of saline, whereas the results from MK2 –/– control animals are presented by the solid bar. Data are expressed as MPO activity (mU/mg tissue weight). Results are means ± SE; *P < 0.05. Data are from four independent experiments with 6–8 mice per group.

 
Effects of cerulein-induced pancreatitis on IL-6 and TNF-{alpha} mRNA levels. Since TNF-{alpha} and IL-6 protein levels in MK2 –/– mice are significantly lower compared with wild-type animals in acute pancreatitis, we aimed to quantify pancreatic mRNA expression of these cytokines. After the induction of pancreatitis with cerulein, RNA was isolated from pancreatic tissue. RT-PCR was performed for subsequent quantitative PCR experiments. Wild-type mice show a 3.79-fold IL-6 mRNA upregulation compared with sodium chloride-treated control animals (Fig. 7A). In MK2 –/– mice the IL-6 mRNA levels remain nearly unchanged, even a little lower than the control animals. TNF-{alpha} mRNA levels do not differ after the induction of pancreatitis in wild-type and MK2 –/– mice (Fig. 7B). Wild-type mice show an elevation that amounts to 862.1% (compared to sodium chloride-treated animals), whereas MK2 –/– mice show a comparable activation of 745.5%.


Figure 7
View larger version (17K):
[in this window]
[in a new window]
  		Fig. 7. Effects of gene deletion of MK2 on IL-6 (A) and TNF-{alpha} (B) mRNA levels. Quantitative PCR was carried out as described in MATERIAL AND METHODS to determine pancreatic mRNA levels of these cytokines after six hourly injections of saline (gray bars) or cerulein (black bars) in either wild-type or MK2 –/– animals. Data are expressed as percent of control (saline treated animals). Results are means ± SE; *P < 0.15.

 
TNF-{alpha} and IL-6 protein expression in isolated acini after stimulation with supramaximal concentrations of CCK. Further investigations in isolated pancreatic acini revealed that MK2 –/– acini produce and secrete significantly less TNF-{alpha} and IL-6 compared with wild-type mice after stimulation with supramaximal concentrations of CCK (Fig. 8). Isolated acini from MK2 –/– and C57BL mice were left untreated or stimulated with 1 and 100 nM CCK for 1 h. In MK2 –/– acini, there was only slight detection of IL-6 and TNF-{alpha} in the supernatant and the sonicated acini pellets after high-dose CCK stimulation. In contrast, in C57BL acini, a strong increase of IL-6 and TNF-{alpha} was measurable after CCK stimulation (Fig. 8, A–C). Time-course experiments with CCK stimulation up to 3 h revealed similar results. In addition, RNA was isolated from isolated pancreatic acini, and RT-PCR was performed for subsequent quantitative PCR experiments. Similar to the in vivo data, acini from wild-type mice show an IL-6 mRNA upregulation compared with unstimulated acini, whereas in MK2 –/– acini, the IL-6 mRNA levels remain unchanged (results not shown).


Figure 8
View larger version (7K):
[in this window]
[in a new window]
  		Fig. 8. Effects of gene deletion of MK2 on IL-6 and TNF-{alpha} secretion in isolated acini. Acini were isolated as previously described (12) and stimulated as indicated for 1 h. IL-6 and TNF-{alpha} were measured with ELISA technique following the manufacturer's protocol. Secretion of IL-6 (A) and TNF-{alpha} (C) after stimulation with CCK in isolated acini. Acinar IL-6 content after stimulation with CCK in isolated acini (B). Results are means ± SE from five independent experiments. *P < 0.05 and **P < 0.01.

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
It has been well accepted that the development of acute pancreatitis is a multi-step process. Whereas the onset is triggered by early acinar events, the severity and systemic inflammation is determined by consecutive extra-acinar events (30). The activation of trypsinogen to trypsin plays a key role in this process, leading to cell injury in experimental models of acute pancreatitis and in isolated acinar cells (24, 25, 26). The subsequent extra-acinar events consist mainly of a distinct immune response, in which proinflammatory cytokines play a major role (3, 5, 7, 10, 21, 29). Several studies have shown that pancreatic acinar cells express chemokines and cytokines including IL-6 and TNF-{alpha} (28; for review see Refs. 4, 5, 13, 15).

In this study we aimed to investigate the specific role of TNF-{alpha} and IL-6 in promoting acute pancreatitis and to further shed light into the signaling pathways involved in the regulation of these cytokines. The MAP kinase signaling pathways are ubiquitous cascades that regulate cellular growth, differentiation, and response to environmental stress. A recent study focused on the role of JNK in the pathophysiology of acute pancreatitis and showed that using a JNK and p38 inhibitor, the severity of cerulein-induced pancreatitis in rats is reduced (35). However, one of the major difficulties in all previous studies investigating the MAP kinase pathways in acute pancreatitis has been the lack of selectivity of all pharmacological antagonists applied. Using mice where the gene of MK2 is deleted, we present a model that is selective and highly specific.

We have previously shown that p38/MK2 phosphorylates Hsp27 in isolated pancreatic acini and plays a role in regulating the CCK-induced changes in the actin cytoskeleton in acini (27). According to this study where incubation of isolated rat acini with SB203580, a specific p38 inhibitor, had no effect on CCK-induced amylase secretion, isolated acini from MK2 –/– animals showed no difference in the amylase release after CCK stimulation (results not shown). In addition, we measured TNF-{alpha} and IL-6 cytokine levels and performed quantitative PCR analysis from these cytokines from isolated acini after stimulation with supramaximal CCK doses (see Fig. 8). This demonstrates that the cytokines are produced and secreted by acinar cells and is in concordance with data published by Gukovskaya et al. (12). Most recently, we demonstrated that phosphorylation of Hsp27 and its overexpression protects against cerulein-induced pancreatitis and that MK2 is the major kinase to phosphorylate Hsp27 (20). Therefore, one would expect that gene deletion of MK2 would worsen the pancreatitis. Clearly, the protective effects of Hsp27 are not total. There are still signs of pancreatitis, indicating that there are multiple mechanisms involved in the pathogenesis of acute pancreatitis. There is good evidence that Hsp27 acts as an actin-binding protein and protects by inhibiting actin depolymerization. In exocrine acini, this results in a preserved actin cytoskeleton with exocytosis of the zymogen granules at the apical pole (20). In the past years, several distinct functions of MK2, in addition to the phosphorylation of Hsp27 have been reported. This includes activation of transcription factors like CHOP, Elk1, and genes involved in the production for cytokines after MK2 gets phosphorylated and translocated in the nucleus. Because the MK2 –/– mice have normal levels of Hsp27, the protective effects of MK2 –/– gene deletion are a result of the reduced levels of anti-inflammatory cytokines, e.g., IL-6 and TNF-{alpha}. We propose a pathway as shown in Fig. 9.


Figure 9
View larger version (25K):
[in this window]
[in a new window]
  		Fig. 9. Proposed signaling pathway of MK2-mediated IL-6 and TNF-{alpha} cytokine regulation in pancreatic acinar cells.

 
TNF-{alpha} and IL-6 have been identified to maintain inflammation in multiple organs. These cytokines are upregulated, for example, in rheumatoid arthritis and in inflammatory bowel diseases. In addition, Hommes et al. (16) have shown that the inhibition of p38 MAP kinase results in a clinical improvement of patients with Crohn disease (CED). Inhibition of p38 was followed by a reduced TNF-{alpha} production of the inflamed mucosa in CED patients (16, 34). On the other hand, another study showed that inhibition of p38 led to an accumulation of TNF-{alpha} and exacerbates the mucosal inflammation in a colitis model, whereas the deficiency of JNK revealed attenuation in the inflammatory process (17).

For IL-6, its role as a proinflammatory cytokine in acute pancreatitis so far is unclear; Suzuki et al. (32) reported that overexpressing human IL-6 in transgenic mice increased the severity of pancreatitis, suggesting it is proinflammatory. Another study suggested that IL-6 is in fact an anti-inflammatory cytokine (6). TNF-{alpha} is a pleiotropic cytokine with effects on cell growth, gene expression, and cell death, and pancreatic acini have been shown to activate, release, and respond to TNF-{alpha} by apoptosis (12).

To investigate the effects of MK2 on cytokine expression in vivo, an LPS stimulation model was established (18, 19, 22, 23, 36). In this model, MK2-deficient spleen cells or macrophages are stimulated by LPS to assess TNF-{alpha} and IL-6 expression. The TNF-{alpha}-induced MK2 activation is also reported to regulate IL-6 synthesis (1). Concerning the regulation of TNF-{alpha} and IL-6 regulation, there is evidence in in vivo studies of spleen cells and macrophages that LPS-induced TNF-{alpha} biosynthesis becomes independent of MK2 when the AU-rich element (ARE) of the TNF-{alpha} gene is deleted. Whereas TNF-{alpha} production is blocked as a result of the TNF-{alpha} gene deletion, IL-6 production is still dependent on MK2. In this study of MK2-deficient macrophages, the half-life of IL-6 mRNA is reported to be shortened more than 10-fold. On the other hand, the half-life of TNF-{alpha} mRNA is only insignificantly reduced (22). This study provides evidence that the AU-rich 3'-untranslated regions of these two cytokines are located downstream to MK2 in the signaling cascade. In addition to this study, there is further evidence that MK2 regulates biosynthesis of IL-6 at the level of mRNA stability and of TNF-{alpha}, mainly through an ARE-dependent posttranscriptional mechanism. One of the proteins binding to the ARE of the TNF-{alpha} mRNA is hnRNP A0. This macrophage protein is an important substrate for MK2. MK2 phosphorylates this protein, and this in turn leads to the posttranscriptional regulation of TNF-{alpha} mRNA and to the stabilization of IL-6 mRNA (23). To investigate mechanisms by which gene deletion of MK2 is protective in acute pancreatitis, we investigated cytokine protein expression of the proinflammatory cytokines IL-6 and TNF-{alpha}. Here we demonstrate that serum levels and pancreatic tissue levels of IL-6 were lower in MK2 –/– mice after the induction of pancreatitis compared with wild-type mice, whereas significantly reduced TNF-{alpha} levels were detectable only in the serum of MK2 –/– mice. These results were even more prominent for IL-6 than for TNF-{alpha}. Our findings concerning TNF-{alpha} are consistent with previous data where MK2 –/– mice display a reduction of TNF-{alpha} levels of up to 90% (18). According to this study, this resistance to LPS-induced stress is not due to a change in signaling from the TNF receptor. Also, TNF-{alpha} secretion is not affected, and mRNA stability is not reduced. Therefore, a posttranscriptional mechanism for TNF-{alpha} regulation is likely.

To further investigate the mechanisms for the regulation of TNF-{alpha} and IL-6 protein expression, we determined the mRNA levels of these two cytokines after the induction of pancreatitis using quantitative PCR. We hereby present a novel approach since mRNA levels for these cytokines in mouse pancreatic tissue have only been evaluated by Northern blot or semiquantitative PCR techniques using an internal standard. Because of the possibility that activation or inhibition of signaling mechanisms other than the pancreatic acinar cells contribute to the reduced IL-6 and TNF-{alpha} levels, we investigated the secretion of these cytokines in isolated acini from knockout or wild-type mice. Similar to the in vivo data, isolated acini from MK2 –/– mice showed reduced levels of IL-6 and TNF-{alpha} after stimulation with supramaximal concentrations of CCK. These data emphasize that the pancreatic acinar cells are the major source of the serum cytokine levels and maintain the inflammatory process during the acute pancreatitis.

We provide evidence that TNF-{alpha} protein levels are regulated at the posttranscriptional level, because TNF-{alpha} mRNA levels do not differ in MK2 –/– mice compared with C57BL mice, whereas the protein levels are much lower in MK2 mice. In contrast, IL-6 is most likely regulated by mRNA stabilization through MK2. We show that IL-6 mRNA levels of MK2 –/– mice are more than fourfold lower than in control mice, resulting from the lack of IL-6 mRNA stabilization downstream of MK2. This can be assumed to be the mechanism for significantly lower protein levels in MK2 –/– mice and lower levels of IL-6 mRNA. We hereby present new evidence for the regulation of those cytokines in an in vivo model of acute pancreatitis.

Different processes regulate cytokine expression. Two major mechanisms are distinguished: transcriptional and posttranscriptional regulation of cytokine expression. To further investigate the regulation of cytokine expression by activation of transcription factors, we investigated the phosphorylation of ATF-2, STAT 1, and STAT 3 by Western blotting. Our data show no significant difference in the activation of these transcription factors in MK2 –/– mice compared with wild-type mice after the induction of pancreatitis (results not shown). The results on the STAT signaling are consistent with our previous results (9). We also investigated whether MK2 is involved in the regulation of apoptosis. Therefore, we determined activation of caspases 3 and 8, as well as NF-{kappa}B activation, in MK2 –/– and C57BL mice. Western blotting revealed no activation of the caspase 3 and 8 pathways and no differences in the amount of I{kappa}B protein expression and its degradation after induction of pancreatitis (data not shown).

These results elucidate the crucial role of MK2 in the pathogenesis of acute pancreatitis. Its deficiency is protective for histological and biochemical parameters in acute pancreatitis. This study provides further evidence that TNF-{alpha} and IL-6 signaling are important for mediating inflammatory processes in acute pancreatitis and the subsequent lung injury. Thereby, TNF-{alpha} is hypothesized to be regulated by a posttranscriptional stabilization, whereas IL-6 is most likely regulated by mRNA stabilization. Although we have investigated a number of different intracellular signaling pathways that might explain the protective effects of MK2 gene deletion on pancreatitis, all of them showed no differences. Nevertheless, we cannot exclude that mechanisms other than regulation of IL-6 and TNF-{alpha} are involved.

In summary, we have shown that gene deletion of MK2 protects against cerulein-induced pancreatitis, most likely by inhibiting the production and secretion of IL-6 and TNF-{alpha} in acinar cells. This protection is part of a reduced inflammatory injury caused by the cytokines TNF-{alpha} and IL-6 and is mediated through the p38/MK2 pathway.


   GRANTS
TOP
 ABSTRACT
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by Deutsche Forschungsgemeinschaft Grant SCHA 766/3–4 (to C. Schäfer) and Friedrich-Baur-Stiftung Grant 065/04 (to C. Schäfer).


   ACKNOWLEDGMENTS
 
We thank Claudia Jäger for assistance with establishing the quantitative PCR technique.

Parts of these data were presented at the Digestive Disease Week meeting 2004 in New Orleans.


   FOOTNOTES
 

Address for reprint requests and other correspondence: Claus Schäfer, Dept. of Internal Medicine II, Klinikum Grosshadern Ludwig-Maximilians-Univ.-Munich, Marchioninistr 15, 81377 Munich, Germany (e-mail: claus.schaefer{at}med.uni-muenchen.de)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* A. B. Tietz and A. Malo contributed equally to this work. Back


   REFERENCES
TOP
 ABSTRACT
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Beyaert R, Cuenda A, Vanden Berghe W, Plaisance S, Lee JC, Haegeman G, Cohen P, and Fiers W. The p38/RK mitogen-activated protein kinase pathway regulates interleukin-6 synthesis response to tumor necrosis factor. EMBO J 15: 1914–1923, 1996.[Web of Science][Medline]
  2. Bhatia M and Moochhala S. Role of inflammatory mediators in the pathophysiology of acute respiratory distress syndrome. J Pathol 202: 145–156, 2004.[CrossRef][Web of Science][Medline]
  3. Bhatia M, Neoptolemos JP, and Slavin J. Inflammatory mediators as therapeutic targets in acute pancreatitis. Curr Opin Investig Drugs 2: 496–501, 2001.[Medline]
  4. Blinman TA, Gukovsky I, Mouria M, Zaninovic V, Livingston E, Pandol SJ, and Gukovskaya AS. Activation of pancreatic acinar cells on isolation from tissue: cytokine upregulation via p38 MAP kinase. Am J Physiol Cell Physiol 279: C1993–C2003, 2000.[Abstract/Free Full Text]
  5. Brady M, Christmas S, Sutton R, Neoptolemos J, and Slavin J. Cytokines and acute pancreatitis. Baillieres Best Pract Res Clin Gastroenterol 13: 265–289, 1999.[CrossRef][Medline]
  6. Cuzzocrea S, Mazzon E, Dugo L, Centorrino T, Ciccolo A, McDonald MC, de Sarro A, Caputi AP, and Thiemermann C. Absence of endogenous interleukin-6 enhances the inflammatory response during acute pancreatitis induced by cerulein in mice. Cytokine 18: 274–285, 2002.[CrossRef][Web of Science][Medline]
  7. Denham W, Yang J, Fink G, Denham D, Carter G, Bowers V, and Norman J. TNF but not IL-1 decreases pancreatic acinar cell survival without affecting exocrine function: a study in the perfused human pancreas. J Surg Res 74: 3–7, 1998.[CrossRef][Web of Science][Medline]
  8. Engel K, Ahlers A, Brach MA, Herrmann F, and Gaestel M. MAPKAP kinase 2 is activated by heat shock and TNF-alpha: in vivo phosphorylation of small heat shock protein results from stimulation of the MAP kinase cascade. J Cell Biochem 57: 321–330, 1995.[CrossRef][Web of Science][Medline]
  9. Gallmeier E, Schafer C, Moubarak P, Tietz A, Plossl I, Huss R, Goke B, and Wagner AC. JAK and STAT proteins are expressed and activated by IFN-gamma in rat pancreatic acinar cells. J Cell Physiol 203: 209–216, 2005.[CrossRef][Web of Science][Medline]
  10. Gomez-Cambronero LG, Sabater L, Pereda J, Cassinello N, Camps B, Vina J, and Sastre J. Role of cytokines and oxidative stress in the pathophysiology of acute pancreatitis: therapeutical implications. Curr Drug Targets Inflamm Allergy 1: 393–403, 2002.[CrossRef][Medline]
  11. Grewal HP, Kotb M, el Din AM, Ohman M, Salem A, Gaber L, and Gaber AO. Induction of tumor necrosis factor in severe acute pancreatitis and its subsequent reduction after hepatic passage. Surgery 115: 213–221, 1994.[Web of Science][Medline]
  12. Gukovskaya AS, Gukovsky I, Zaninovic V, Song M, Sandoval D, Gukovsky S, and Pandol SJ. Pancreatic acinar cells produce, release, and respond to tumor necrosis factor-alpha. Role in regulating cell death and pancreatitis. J Clin Invest 100: 1853–1862, 1997.[Web of Science][Medline]
  13. Gukovsky I, Gukovskaya AS, Blinman TA, Zaninovic V, and Pandol SJ. Early NF-{kappa}B activation is associated with hormone-induced pancreatitis. Am J Physiol Gastrointest Liver Physiol 275: G1402–G1414, 1998.[Abstract/Free Full Text]
  14. Halangk W, Lerch MM, Brandt-Nedelev B, Roth W, Ruthenbuerger M, Reinheckel T, Domschke W, Lippert H, Peters C, and Deussing J. Role of cathepsin B in intracellular trypsinogen activation and the onset of acute pancreatitis. J Clin Invest 106: 773–781, 2000.[Web of Science][Medline]
  15. Han B and Logsdon CD. Cholecystokinin induction of mob-1 chemokine expression in pancreatic acinar cells requires NF-{kappa}B activation. Am J Physiol Cell Physiol 277: C74–C82, 1999.[Abstract/Free Full Text]
  16. Hommes D, van den Blink B, Plasse T, Bartelsman J, Xu C, Macpherson B, Tytgat G, Peppelenbosch M, and Van Deventer S. Inhibition of stress-activated MAP kinases induces clinical improvement in moderate to severe Crohn's disease. Gastroenterology 122: 7–14, 2002.[CrossRef][Web of Science][Medline]
  17. Kontoyiannis D, Boulougouris G, Manoloukos M, Armaka M, Apostolaki M, Pizarro T, Kotlyarov A, Forster I, Flavell R, Gaestel M, Tsichlis P, Cominelli F, and Kollias G. Genetic dissection of the cellular pathways and signaling mechanisms in modeled tumor necrosis factor-induced Crohn's-like inflammatory bowel disease. J Exp Med 196: 1563–1574, 2002.[Abstract/Free Full Text]
  18. Kotlyarov A, Neininger A, Schubert C, Eckert R, Birchmeier C, Volk HD, and Gaestel M. MAPKAP kinase 2 is essential for LPS-induced TNF-{alpha} biosynthesis. Nat Cell Biol 1: 94–97, 1999.[CrossRef][Web of Science][Medline]
  19. Kotlyarov A, Yannoni Y, Fritz S, Laass K, Telliez JB, Pitman D, Lin LL, and Gaestel M. Distinct cellular functions of MK2. Mol Cell Biol 22: 4827–4835, 2002.[Abstract/Free Full Text]
  20. Kubisch C, Dimagno MJ, Tietz AB, Welsh MJ, Ernst SA, Brandt-Nedelev B, Diebold J, Wagner AC, Goke B, Williams JA, and Schafer C. Overexpression of heat shock protein Hsp27 protects against cerulein-induced pancreatitis. Gastroenterology 127: 275–286, 2004.[CrossRef][Web of Science]
  21. Mayer J, Rau B, Gansauge F, and Beger HG. Inflammatory mediators in human acute pancreatitis: clinical and pathophysiological implications. Gut 47: 546–552, 2000.[Abstract/Free Full Text]
  22. Neininger A, Kontoyiannis D, Kotlyarov A, Winzen R, Eckert R, Volk HD, Holtmann H, Kollias G, and Gaestel M. MK2 targets AU-rich elements and regulates biosynthesis of tumor necrosis factor and interleukin-6 independently at different post-transcriptional levels. J Biol Chem 277: 3065–3068, 2002.[Abstract/Free Full Text]
  23. Rousseau S, Morrice N, Peggie M, Campbell DG, Gaestel M, and Cohen P. Inhibition of SAPK2a/p38 prevents hnRNP A0 phosphorylation by MAPKAP-K2 and its interaction with cytokine mRNAs. EMBO J 21: 6505–6514, 2002.[CrossRef][Web of Science][Medline]
  24. Saluja AK, Bhagat L, Lee HS, Bhatia M, Frossard JL, and Steer ML. Secretagogue-induced digestive enzyme activation and cell injury in rat pancreatic acini. Am J Physiol Gastrointest Liver Physiol 276: G835–G842, 1999.[Abstract/Free Full Text]
  25. Saluja AK, Donovan EA, Yamanaka K, Yamaguchi Y, Hofbauer B, and Steer ML. Cerulein-induced in vitro activation of trypsinogen in rat pancreatic acini is mediated by cathepsin B. Gastroenterology 113: 304–310, 1997.[CrossRef][Web of Science][Medline]
  26. Saluja AK and Steer MLP. Pathophysiology of pancreatitis. Role of cytokines and other mediators of inflammation. Digestion 60, Suppl 1: 27–33, 1999.[Medline]
  27. Schafer C, Ross SE, Bragado MJ, Groblewski GE, Ernst SA, and Williams JA. A role for the p38 mitogen-activated protein kinase/Hsp 27 pathway in cholecystokinin-induced changes in the actin cytoskeleton in rat pancreatic acini. J Biol Chem 273: 24173–24180, 1998.[Abstract/Free Full Text]
  28. Schafer C, Tietz AB, and Goke B. Pathophysiology of acute experimental pancreatitis: lessons from genetically engineered animal models and new molecular approaches. Digestion 71: 162–172, 2005.[CrossRef][Web of Science][Medline]
  29. Schmid RM and Adler G. Cytokines in acute pancreatitis: new pathophysiological concepts evolve. Eur J Gastroenterol Hepatol 11: 125–127, 1999.[Web of Science][Medline]
  30. Steer ML. Early events in acute pancreatitis. Baillieres Best Pract Res Clin Gastroenterol 13: 213–225, 1999.[CrossRef][Medline]
  31. Stokoe D, Campbell DG, Nakielny S, Hidaka H, Leevers SJ, Marshall C, and Cohen P. MAPKAP kinase-2: a novel protein kinase activated by mitogen-activated protein kinase. EMBO J 11: 3985–3994, 1992.[Web of Science][Medline]
  32. Suzuki S, Miyasaka K, Jimi A, and Funakoshi A. Induction of acute pancreatitis by cerulein in human IL-6 gene transgenic mice. Pancreas 21: 86–92, 2000.[CrossRef][Web of Science][Medline]
  33. Tashiro M, Ernst SA, Edwards J, and Williams JA. Hyperthermia induces multiple pancreatic heat shock proteins and protects against subsequent arginine-induced acute pancreatitis in rats. Digestion 65: 118–126, 2002.[CrossRef][Web of Science][Medline]
  34. Waetzig GH, Seegert D, Rosenstiel P, Nikolaus S, and Schreiber S. p38 mitogen-activated protein kinase is activated and linked to TNF-{alpha} signaling in inflammatory bowel disease. J Immunol 168: 5342–5351, 2002.[Abstract/Free Full Text]
  35. Wagner AC, Mazzucchelli L, Miller M, Camoratto AM, and Goke B. CEP-1347 inhibits caerulein-induced rat pancreatic JNK activation and ameliorates caerulein pancreatitis. Am J Physiol Gastrointest Liver Physiol 278: G165–G172, 2000.[Abstract/Free Full Text]
  36. Winzen R, Kracht M, Ritter B, Wilhelm A, Chen CY, Shyu AB, Muller M, Gaestel M, Resch K, and Holtmann H. The p38 MAP kinase pathway signals for cytokine-induced mRNA stabilization via MAP kinase-activated protein kinase 2 and an AU-rich region-targeted mechanism. EMBO J 18: 4969–4980, 1999.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
Y.-Y. Li, S. Ochs, Z.-R. Gao, A. Malo, C.-J. Chen, S. Lv, E. Gallmeier, B. Goke, and C. Schafer
Regulation of HSP60 and the role of MK2 in a new model of severe experimental pancreatitis
Am J Physiol Gastrointest Liver Physiol, November 1, 2009; 297(5): G981 - G989.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/6/G1298    most recent
00530.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (11)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tietz, A. B.
Right arrow Articles by Schäfer, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tietz, A. B.
Right arrow Articles by Schäfer, C.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.