|
|
||||||||
NEUROREGULATION AND MOTILITY
1Department of Medicine, Rhode Island Hospital and Brown University, Providence, Rhode Island; and 2Department of Pathobiology, Lerner Research Institute and 3Department of Gastroenterology and Hepatology, Cleveland Clinic Foundation University, Cleveland, Ohio
Submitted 20 December 2005 ; accepted in final form 19 January 2006
| ABSTRACT |
|---|
|
|
|---|
that may induce production of PAF in the muscle, possibly closing a self-sustaining cycle of production of inflammatory mediators.
inflammation; smooth muscle contraction; reactive oxygen species; cytokines
, IL-6, H2O2, platelet-activating factor (PAF), and PGE2, are present in the muscle (11, 16). When applied to normal esophageal circular muscle, these mediators reproduce esophagitis-induced changes in contraction, i.e., they inhibited contraction in response to neural stimulation by inhibiting release of ACh but did not inhibit contraction in response to direct myogenic stimulation by direct application of ACh.
When applied to the circular muscle, some of these inflammatory mediators induce formation of other mediators. For instance, IL-1
and IL-6 induce production of H2O2 in normal circular muscle (16). In turn, H2O2 induces production of PAF and PGE2 (16), and PAF may induce production of more H2O2. For this reason, examining tissues with established inflammation may provide relatively few clues about the sequence of events leading to its establishment. On the other hand, studying separately the events occurring initially in the mucosa and in the muscle layer may permit an estimation of the individual contributions of each of these two components and, possibly, allow the reconstruction of the sequence of events responsible for onset and development of inflammation in both the mucosa and the muscle. Our previously described in vitro mucosal tube (or sac) preparation (15) was designed to distinguish the inflammatory mediators released in the mucosal layer, from both neural and immune cells, from those produced in the circular muscle in response to the mediators released by the mucosal layer. Because the mucosal tube is created by removing the muscle layer at the level of the submucosa, it is reasonable to assume that anything that is produced by the mucosal sac and is collected in the surrounding supernatant would come in contact with the circular muscle in the intact esophagus.
Therefore, we examined the sequence of events occurring in this in vitro model of acute esophagitis that begins with the instillation of HCl inside the mucosal sac. We identified the inflammatory mediators released by the mucosa that affect the circular muscle and examined the functional response of the circular muscle layer to these mucosa-derived mediators.
| METHODS |
|---|
|
|
|---|
and IL-6 was highest when the sac was filled with medium at a pH between 5.8 and 4.8 and declined when the pH was lowered to 4, likely reflecting tissue damage. Both tubes were kept in Krebs buffer with 95% O2 and 5% CO2, at 36°C for 3 h, using 1 ml of Krebs buffer per 100 mg of mucosa. After 3 h, the supernatant surrounding the tubes was collected and analyzed or used to examine its effect on muscle contraction. The pH of the supernatant was 7.4 and needed no adjustment. The mucosa tubes were then opened, the luminal content was discarded, and the tissue was used to measure cytokine content or fixed with 10% formalin for histological examination. This experimental preparation has been described in detail (15).
To compare this in vitro model of inflammation to in vivo-induced acute esophagitis, some animals had their esophagus perfused with 0.1 N HCl on three successive days, and were tested on the fourth day. This procedure has been described in detail elsewhere (11).
A mucosal sac from these in vivo esophagitis animals was prepared and filled with physiological salt solution (PSS) and maintained in Krebs buffer with 95% O2 and 5% CO2, at 36°C for 3 h, using 1 ml of Krebs buffer per 100 mg of mucosa. Inflammatory mediators present in the mucosa or released in the supernatant were measured.
Measurements of contraction. Circular muscle strips devoid of mucosa (2-mm wide) were mounted in separate 1-ml muscle chambers as described in detail (12). They were initially stretched to 2.5 g to bring them near conditions of optimum force development and equilibrated for 2 h while perfused continuously with oxygenated PSS at 37°C. The PSS contained the following (in mmol/l): 116.6 NaCl, 21.9 NaHCO3, 1.2 KH2PO4, 3.4 KCl, 2.5 CaCl2, 5.4 glucose, and 1.2 MgCl2. The solution was equilibrated with a gas mixture containing 95% O2 and 5% CO2 at 37°C, pH 7.4. After equilibration, esophageal strips were stimulated with EFS consisting of 10-s trains of square-wave pulses of supramaximal voltage (0.2-ms duration at 0.55 Hz). The stimuli were delivered by a stimulator (Grass Instruments, model S48) through platinum wire electrodes placed longitudinally on either side of the strip.
To study the effect of supernatant from HCl-treated mucosa or of selected cytokines on EFS-induced contraction, 0.10.15 ml supernatant was added to the 1-ml bath (pH 7.4) and maintained for 2 h, or appropriate concentrations of the cytokines were added for 2 h, before measuring contraction in response to EFS.
Measurement of IL-6. Esophageal tissue (100 mg of mucosa or muscle) was homogenized in 2 ml phosphate-buffered saline (PBS; Sigma, St. Louis, MO) (pH 7.4) containing 0.01 M phosphate buffer, 0.0027 M KCl, and 0.137 M NaCl. Homogenization was achieved with three, 10- to 20-s bursts with a Tissue-Tearor (BioSpec, Racine, WI). The homogenate was centrifuged at 2,000 g, 4°C, for 20 min. An aliquot of homogenate was taken for protein determination. The homogenate supernatant or the mucosal sac supernatant was frozen in liquid nitrogen for later use. The concentrations of IL-6 were measured using enzyme immunoassay kits from Cayman Chemical (Ann Arbor, MI).
Measurement of PAF. PAF was extracted from tissues by a modification of the method of Bligh and Dyer (5). Esophageal tissue (100 mg of mucosa or muscle) was homogenized in 2 ml of methanol. One milliliter of homogenate was transferred to a tube containing 0.5 ml of chloroform, 1 ml methanol, and 0.4 ml H2O for a final ratio of 1:2:0.8, chloroform:methanol:H2O (vol/vol/vol). The mixture was vortexed, left at room temperature for 1 h, then centrifuged (5,000 g, 5 min). The supernatant was transferred to another glass tube, and the pellet was reextracted with 3.8 ml of the chloroform:methanol:H2O solution. The mixture was centrifuged again, and the two supernatants were combined. Chloroform (2 ml) and 1 M NaCl (2 ml) were added, and the phases were separated by centrifugation (5,000 g, 5 min). The upper phase was aspirated and discarded, and the lower phase was washed once with 4 ml of 1 M NaCl:methanol (9:1 vol/vol). Samples of this washed chloroform phase were dried under nitrogen and stored at 20°C. Measurement of PAF was performed within 72 h of extraction.
Measurement of tissue levels of PAF or of PAF in the mucosal sac supernatant were made using the PAF 3H scintillation proximity assay system (TRK 990; Amersham International, Buckinghamshire, UK). Scintillation proximity assay is a sensitive assay system that uses microscopic beads containing scintillant that emit light when radiolabeled molecules of interest bind to the surface of the bead.
Measurement of PGE2. Esophageal mucosa (100 mg) was homogenized with 10- to 20-s bursts with a Tissue-Tearor (Biospec) followed by 4060 strokes with a Dounce tissue grinder (Wheaton, Melville, NJ). The homogenate was centrifuged at 15,000 rpm at 4°C for 15 min, and 100 µl of each sample supernatant was used for protein measurement to normalize PGE2 values in mucosa supernatant.
Mucosa supernatant (2 ml) was used to measure release of PGE2 by the HCl-filled mucosal sac. PGE2 in the supernatant was purified with a PGE2 affinity column (Cayman Chemical). The resulting extracts were kept at 70°C. The PGE2 concentration was quantified by using a PGE2 competitive enzyme immunoassay kit (Cayman Chemical).
PAF receptor immunohistochemistry. Tissue sections from paraffin blocks were sequentially immersed three times in xylene, twice in 100% alcohol, once in 95% alcohol, then in running water, to remove paraffin. Each immersion was for 5 min. The slides were then maintained in PBS, then incubated with a 10% solution of blocking serum for 30 min. After removal from the blocking serum, the sections were incubated with the PAF antibody (1:200) for 60 min, then washed three times for 5 min in buffer and incubated with a fluorochrome-conjugated antibody for 45 min in a dark chamber. The sections were washed three times for 5 min in buffer in a dark chamber, then placed in 90% glycerol in PBS, and a cover slip was mounted. The slides were examined using a fluorescence microscope with appropriate filters, then stored in a dark location at 4°C.
RT-PCR. Total RNA was purified by TRIzol reagent (Invitrogen) from mucosa and esophageal circular muscle. Total RNA (2 µg) was reversely transcribed and then subjected to PCR by using a kit SuperScript first-strand synthesis system for RT-PCR (Invitrogen).
Primers for PAF-receptor mRNA were sense, TTCAATGAGATAAAGATCTTCA; and antisense, GAGCAAGGTACGGATGATGACC. A search of the Blast database indicated that these primers are specific for PAF-receptor mRNA of human, chimpanzee, rhesus macaque monkey, dog, rat, mouse, zebrafish, guinea pig, goat, and cow. Reactions were carried out in a PTC-100 programmable thermal controller (MJ Research, Waltham, MA) for 1 cycle at 94°C for 5 min, followed by 40 cycles at 94°C for 1 min, 62°C for 1 min, and 72°C for 1 min.
Primers for IL-6-receptor mRNA were sense, GAAGCAGCAGGCAATGTTACC; and antisense, CTCACAGATGGCGTTGACAAGG. A search of the Blast database indicated that these primers are specific for IL-6-receptor mRNA of human and mouse. Reactions were carried out in a PTC-100 programmable thermal controller (MJ Research) for 1 cycle at 94°C for 5 min, followed by 35 cycles at 94°C for 30 s, 55°C for 1 min, and 72°C for 1 min.
Protein determination. The homogenates of esophageal tissues were solubilized by addition of 6 ml of 0.1 N NaOH and heating the sample at 80°C for 30 min. The amount of protein present was determined by colorimetric analysis (Bio-Rad, Melville, NY) according to the method of Bradford (8).
Materials and reagents.
Human interleukins IL-6 and IL-1
were purchased from Pierce Endogen (Rockford, IL). Antibodies of IL-6 and IL-1
were purchased from R&D Systems (Minneapolis, MN). Apocynin was purchased from Calbiochem (San Diego, CA). All other reagents were purchased from Sigma-Aldrich.
Statistical analysis. Data are means ± SE. Statistical differences between means were determined by Student's t-test. Differences between multiple groups were tested using analysis of the variance (ANOVA) for repeated measures and checked for significance using the Scheffé F-test.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
|
|
, or PGE2 were similar to those present in the supernatant of Krebs-filled mucosa. Inflammatory mediators in esophageal circular smooth muscle. We next examined the effects of PAF and IL-6 released by the mucosa in response to HCl on esophageal circular muscle. PAF caused production of H2O2 by esophageal circular smooth muscle (Fig. 6). This H2O2 production in response to PAF was significantly reduced by incubation with the NADPH oxidase inhibitor apocynin, indicating PAF-induced activation of NADPH oxidase in the muscle. In addition, PAF-induced production of H2O2 was also reduced by incubation of the muscle with IL-6 antibodies, indicating that IL-6, presumably produced in response to PAF, mediates PAF-induced production of H2O2.
|
antibodies, but it is completely abolished by the addition of CV3988. These data suggest that, similarly to the mucosa, PAF directly causes production of IL-6 in the muscle, and IL-6 then activates NADPH oxidase, causing production of H2O2.
|
|
is produced in the mucosa but not released in the supernatant (15). IL-1
, however, is present in the circular muscle layer after induction of in vivo esophagitis (11). We therefore investigated whether IL-1
may be produced in the circular muscle in response to PAF, IL-6, or H2O2. Figure 9 shows that in the circular muscle H2O2, PAF, and IL-6 induce production of IL-1
. PAF-induced production of IL-1
is reduced by IL-6 neutralization, indicating that production of IL-1
is mediated by IL-6. IL-6-mediated production of IL-1
appears to depend on activation of NADPH oxidase, as it is reduced by the NADPH oxidase blocker apocynin. Thus PAF causes production of IL-6, and IL-6 activates NADPH oxidase to produce H2O2 which, in turn, induces production of IL-1
.
|
as PAF levels are abolished by incubation with IL-1
antibodies.
|
. Figure 11 indicates that IL-6 may be produced in response to either H2O2 or IL-1
. IL-6 production in response to H2O2 was abolished by IL-1
antibodies and by the PAF antagonist CV3988. IL-6 production in response to IL-1
was abolished by the PAF antagonist CV3988, but not by apocynin, confirming the proposed sequence of events.
|
Figure 12 indicates that normal mucosa does not contain PAF-receptor or IL-6-receptor mRNA. HCl treatment increased PAF-receptor but not IL-6-receptor mRNA in mucosa. After esophagitis, induced in vivo by repeated HCl esophageal perfusion over 3 days, both receptors were expressed in the mucosa. In contrast, PAF-receptor and IL-6-receptor mRNA are present in normal circular muscle. PAF-receptor and IL-6-receptor mRNA are not affected by direct exposure of muscle to HCl but are upregulated after in vivo esophagitis. These findings are confirmed in Fig. 13, \. showing immunohistochemistry for PAF receptors in normal and HCl-treated mucosa (3 h). The data suggest that, when PAF receptors are present, PAF causes biosynthesis of cytokines such as IL-6 (and perhaps others) in mucosa. IL-6 receptors, however, are not present after incubation in HCl. If IL-6 is directly responsible for activation of NADPH oxidase, then the absence of IL-6 receptors in the mucosa may explain why H2O2 is not produced in the mucosa (15) after 3-h incubation in HCl. Both PAF and IL-6 receptors are present in muscle, where they cause production of H2O2, which diffuses across cell membranes and may induce production of additional inflammatory mediators.
|
|
. PAF and IL-6 are released and affect the circular muscle layer, whereas IL-1
produced by the mucosa remains confined to the mucosa.
|
| DISCUSSION |
|---|
|
|
|---|
, which in turn, induces production of PAF by the circular muscle itself, completing an inflammatory cycle. These conclusions are supported by the following findings.
PAF-induced production of IL-6 in mucosa and circular muscle. IL-6 is generated in response to PAF in several experimental preparations, including human uterine cervical (49) and lung fibroblast (43), human endometrial stromal cells (38), lung cells (53), endothelial cells (31) and keratinocytes (41), and rat vascular smooth muscle cells (20). We therefore examined whether PAF may be produced and secreted by mucosa in response to acid, to generate IL-6. We found that PAF and IL-6 are both present in mucosa and supernatant after exposure to HCl. In addition, inhibition of PAF by a PAF-receptor antagonist and immunoneutralization of IL-6 by a selective IL-6 antibody partly restored contraction in response to EFS in esophageal circular muscle exposed to supernatant of HCl-treated mucosa. These findings support the presence of both PAF and IL-6 in the supernatant and their role in decreasing esophageal circular muscle contraction. We measured both PAF and IL-6 and found that both were present in mucosa supernatant, at levels comparable with those found in supernatant of mucosa from animals with in vivo-induced esophagitis (by repeated HCl perfusion on three consecutive days).
To show that PAF contributes to production of IL-6, we measured both mediators in mucosa tissue and mucosa supernatant, after 3-h incubation with HCl, in the presence of inhibitors or antibodies. Immunoneutralization of IL-6 with a selective IL-6 antibody had no effect on HCl-induced production and release of PAF, but inhibition of PAF by a PAF-receptor antagonist inhibited HCl-induced formation and release of IL-6, confirming that, in esophageal mucosa exposed to HCl, PAF causes formation of IL-6.
In our model of in vivo-induced esophagitis by repeated esophageal acid perfusion, we have shown that increased levels of PGE2 reduce contraction in response to electrical stimulation (16). We therefore examined whether elevated levels of PGE2 may be released by the mucosa in response to HCl to affect contraction of circular muscle. Mucosa from esophagitis animals released elevated levels of PGE2 compared with control mucosa. In contrast, in normal mucosa, slight or no increase in PGE2 release (Table 1) occurred after 3-h exposure to HCl, indicating that most of PGE2 production is delayed, occurring in mucosa (and, possibly in muscle) during the course of the inflammatory process that produces in vivo esophagitis. PAF and IL-6 are the major inflammatory mediators released by the mucosa, as shown in Table 1, which summarizes results from this and previous studies from our laboratory. As shown elsewhere (13) and reported again in Table 1, after 3-h exposure to HCl, no H2O2 is produced in or released by the mucosa. The identity of the inflammatory mediators released by the mucosa after exposure to HCl is important, because they act on the circular muscle and on circulating leukocytes in the initial phase of the inflammatory process. Because PAF produced in the mucosa leads to formation of IL-6, resulting in release of both PAF and IL-6 into the surrounding supernatant, it appears that PAF is a particularly important inflammatory mediator that initiates the inflammatory cascade and contributes to the transmission of the inflammation from the mucosal layer to circular muscle.
The mechanisms responsible for acid-induced formation of PAF in the mucosa are unknown. Data from this and previous studies from our laboratory (11, 15, 16) suggest that acid-induced inflammation begins with formation of IL-1
, PAF, and IL-6 in the mucosal layer. IL-1
does not diffuse out of the mucosa (15), but it may promote the conversion of the biologically inactive lyso-platelet-activating factor (lyso-PAF) to the bioactive platelet-activating factor (PAF) by an acetylation reaction, as reported in cultured human endothelial cells (10). As shown in several cell types (20, 31, 38, 43, 49, 53), PAF induces production of IL-6 in esophageal mucosa, and both diffuse out of the mucosal layer to the circular muscle where PAF will bind to PAF receptors that are always present in the muscle layer. In the circular muscle, PAF induces formation of IL-6 as it does in the mucosa.
PAF-induced formation of IL-6 has been demonstrated in several experimental preparations (20, 31, 38, 43, 49, 53), but the pathway mediating PAF-induced formation of IL-6 is far from clear. PAF is a potent proinflammatory phospholipid with diverse pathological and physiological effects. The PAF receptor couples to pertussis toxin-sensitive and insensitive G proteins (18, 25), with various types of G proteins involved in individual cases (24, 47). PAF-receptor signaling involves the activation of phospholipases A2, C, and D (30, 34, 42), increased inositol 1,4,5-trisphosphate synthesis, and release of arachidonic acid, causing calcium mobilization (25). Recently, PAF-receptor signaling was shown to occur by a mechanism involving phosphorylation of Tyk 2 (Janus activated protein tyrosine kinase family member) independently of G protein participation (36), suggesting an additional mechanism of signal transduction by the PAF receptor (47). Thus activation of the PAF receptor leads to the activation of numerous signaling intermediates, including protein kinase C, phosphatidylinositol 3-kinase, protein tyrosine kinases, phospholipases, and MAP kinases (27). In human lung fibroblasts, Roth et al. (43) demonstrated that PAF-induced transcription of IL-6 genes requires activation of pertussis toxin-sensitive G proteins, tyrosine kinases, and protein kinase C, but the precise pathway leading from PAF to formation of IL-6 is unknown.
IL-6-induced production of H2O2 in circular muscle.
In the circular muscle, PAF induces formation of IL-6 as it does in the mucosa. Production of IL-6 is then followed by IL-6-induced production of H2O2. The pathway for IL-6-induced production of H2O2 has not been clearly elucidated. The reverse pathway, responsible for H2O2-induced production of IL-6, has been investigated in a variety of experimental preparations, and two distinct pathways have been demonstrated. A more common pathway occurs by activation of NF
B and induction of cytokine gene expression (21, 29, 40, 46, 55). The other pathway is mediated through reactive oxygen species (ROS)-induced activation of MAPKs, which culminates in IL-6 gene expression through a CRE-dependent, but not NF
B-dependent, pathway (45). In contrast, the finding of IL-6-induced production of H2O2 is novel and has been recently demonstrated in our laboratory in cat esophageal circular muscle (16) and by others in vascular smooth muscle (54). In vascular smooth muscle, however, production of H2O2 is critically dependent on activation of angiotensin receptors, as IL-6 alone does not cause a significant increase in H2O2, and IL-6-induced potentiation of H2O2 does not occur in angiotensin II type 1 receptor knockout animals. In contrast, in esophageal circular muscle, IL-6-induced production of H2O2 may be direct and does not require activation of angiotensin receptors and is independent of PAF. Figure 8 clearly shows statistically significant production of H2O2 in response to IL-6 that is not affected by the PAF-receptor antagonist CV3988.
In the circular muscle, IL-6 induces formation of H2O2 by activating a phagocytic-like NADPH oxidase. NADPH oxidase has been well-characterized in phagocytes (32). The NADPH oxidase of phagocytes is a multisubunit enzyme complex that produces the superoxide anion O
(39). O
in aqueous solution is short-lived and rapidly reduced to the more stable molecule H2O2. Phagocytic NADPH oxidase may be rapidly activated and produce large amounts of ROS (32).
Low levels of ROS, seen in non-phagocytic cells, were thought to be byproducts of aerobic metabolism, as part of the mitochondrial respiratory process. Recently, however, superoxide-generating homologues of the phagocytic NADPH oxidase catalytic unit (gp91phox, also known as NOX2) have been discovered: NOX1, NOX3, NOX4, NOX5, DUOX1, and DUOX2. These and homologues of other NADPH oxidase subunits (2, 32, 50) have been found in several cell types. The presence of these homologues in non-phagocytic cells suggests that ROS generated in these cells may have a nonmitochondrial origin and have distinctive cellular functions related to immunity, signal transduction, and modification of the extracellular matrix (32).
The role of these NADPH oxidases in the development of esophageal inflammation has not been explored. Data from our laboratory indicate that human esophageal smooth muscle cells contain NOX1 through NOX5 and that NOX5 cDNA, obtained by real-time PCR, is significantly upregulated by induction of esophagitis (17). NOX5 is significantly upregulated by exposure to PAF (L. Cheng, unpublished observations), and H2O2 content of esophageal and LES circular muscle is significantly increased in esophagitis and in normal muscle exposed to IL-6 or IL-1
(1417).
In the present study, we show that IL-6 increases H2O2 levels in cat esophageal circular muscle by activating NADPH oxidase, as shown in Fig. 8. This conclusion is based on inhibition of H2O2 production by the ortho-methoxy-substituted catechol apocynin, a potent and selective inhibitor of NADPH oxidase (22). Apocynin inhibits the assembly of NADPH oxidase by preventing translocation of its components p47phox and p67phox (48) to the membrane to associate with Rac-GTP and cytochrome b558 to form the active enzyme (32). Apocynin is extensively used to identify production of H2O2 by NADPH oxidase, as opposed to other possible sources of ROS, in cells and in experimental models of inflammation (3). The finding of apocynin-induced inhibition of H2O2 production in response to IL-6 strongly supports the likelihood of IL-6-induced formation of H2O2 by NADPH oxidase.
Signal-transducing IL-6 receptors may activate a JAK-STAT pathway or activate the MAP kinase cascade (6, 23). The MAP kinase pathway may in turn activate cPLA2, producing arachidonic acid. In monocytes, activation of NADPH oxidase depends on cytosolic phospholipase A2-generated arachidonic acid (1). Arachidonic acid may promote activation of NADPH oxidase by binding to the myeloid-related proteins S100A8/A9, which then interact with the p47-p67 NADPH components (7, 28), promoting interactions between the different oxidase subunits and enabling full oxidase activation or directly affecting the function of flavocytochrome b (19).
H2O2-induced production of IL-1
in circular muscle.
IL-1
is an additional proinflammatory cytokine present in esophageal circular muscle of animals with in vivo-induced esophagitis and is in part responsible for reduced contraction in response to neural stimulation (11, 16). In esophageal mucosa, however, IL-1
is produced in response to HCl (3 h) but not released to affect the circular muscle layer (15).
To investigate how IL-1
may be produced in circular muscle during the inflammatory process, we examined whether PAF or PAF/IL-6/H2O2 may cause production of IL-1
in circular muscle.
As shown in Fig. 9, PAF mediates production of IL-1
through formation of IL-6 and IL-6-induced production of H2O2. The data suggest that diffusion of PAF from the mucosa to the circular muscle causes production of IL-6 in the muscle, which in turn contributes to production of H2O2, and H2O2 causes production of IL-1
by the circular muscle. A review of the literature indicates that IL-1
-induced formation of H2O2 has been reported in several experimental preparations (9, 26, 35, 37, 44, 51), including cat esophageal and LES circular muscle (14, 16). Conversely, it has been shown that H2O2 may induce the release of IL-1
by activating NF
B (21, 33), perhaps through tyrosine phosphorylation of I
B
and serine phosphorylation of p65 (52), possibly inducing production of cytokines, with preference for IL-1
(21). In any case, H2O2-induced formation of IL-1
is clearly demonstrated in Fig. 9.
Examining production of PAF indicates that H2O2 mediates production of PAF through formation of IL-1
, as H2O2-induced production of PAF is abolished by immunoneutralization of IL-1
(Fig. 10). These results are consistent with H2O2-induced production of IL-1
. The finding that IL-1
antibodies abolish H2O2-induced production of PAF suggests that formation of IL-1
is an obligatory step in formation of PAF in response to H2O2.
These data are consistent with the cartoon illustrated in Fig. 14. To test the validity of the model illustrated, we examined production of IL-6 in response to H2O2, IL-1
, and PAF. Figure 11 confirms the sequential production of inflammatory mediators, from H2O2-induced production of IL-1
to IL-1
-induced production of PAF and PAF-induced production of IL-6. Taken together, the data suggest that PAF, released by the mucosa, induces sequential production of IL-6, H2O2, IL-1
, and PAF in the circular muscle.
A qualitative understanding of development of inflammation in response to HCl may be illustrated by examining RT-PCR data for IL-6 and PAF receptors. The normal mucosa has no receptor mRNA for either PAF or IL-6. Upon exposure to HCl the mucosa releases both PAF and IL-6 to affect the muscle layer, which has receptor mRNA for both mediators and thus may initiate an immune response, resulting in production of more IL-6, H2O2, IL-1
, and PAF. In the mucosa, 3-h exposure to HCl induces upregulation of PAF-receptor mRNA and expression of PAF receptors (Fig. 12 and 13). Mucosa IL-6-receptor mRNA may be upregulated later in the inflammatory process, appearing after induction of in vivo esophagitis by repeated perfusion of the esophageal lumen over the course of 3 days.
We conclude that PAF, released by the mucosa, diffuses to the circular muscle where it induces formation of IL-6, which in turn activates NADPH oxidase, causing sequential production of H2O2, IL-1
, and PAF by the muscle. We have shown that IL-1
-induced production of PAF was partially reduced by the H2O2 scavenger catalase (16), implying that IL-1
-induced production of PAF may partly depend on formation of H2O2. This possibility is reflected by the dashed arrow on the left side of the flow chart in Fig. 14.
These inflammatory mediators inhibit neurally mediated contraction of circular muscle by inhibiting ACh release from intramural neurons as previously demonstrated (16). Once these inflammatory mediators are present, any one of them may contribute to sequential formation of the others, possibly initiating a self-sustaining cycle.
| GRANTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
| REFERENCES |
|---|
|
|
|---|
B-
/NF
B nuclear translocation and activation. Biochem Biophys Res Commun 296: 847856, 2002.[CrossRef][Web of Science][Medline]
stimulates IL-8 expression through MAP kinase and ROS signaling in human gastric carcinoma cells. Oncogene 23: 66036611, 2004.[CrossRef][Web of Science][Medline]
12,14-prostaglandin j2 inhibits interleukin-1
-induced nuclear factor-
b in human amnion and myometrial cells: mechanisms and implications. J Clin Endocrinol Metab 90: 35343543, 2005.
induction of c-fos and collagenase expression in articular chondrocytes: involvement of reactive oxygen species. J Cell Biochem 69: 1929, 1998.[CrossRef][Web of Science][Medline]
-induced AP-1 activation in articular chondrocytes: implications for the regulation of iNOS expression. Cell Biol Toxicol 19: 203214, 2003.[CrossRef][Web of Science][Medline]
B activation and modulates endotoxin-induced cytokine production in alveolar macrophages. Shock 23: 186193, 2005.[CrossRef][Web of Science][Medline]
control stimulatory/inhibitory growth of cancer cells. Front Biosci 11: 889898, 2006.[Web of Science][Medline]
B, are critically involved in reactive oxygen species-mediated induction of IL-6 by angiotensin II in cardiac fibroblasts. Circ Res 89: 661669, 2001.
B, reactive oxygen species and cellular signaling in the early phase of acute pancreatitis. Scand J Gastroenterol 40: 103108, 2005.[CrossRef][Web of Science][Medline]
B through tyrosine phosphorylation of I
B
and serine phosphorylation of p65: evidence for the involvement of I
B
kinase and Syk protein-tyrosine kinase. J Biol Chem 278: 2423324241, 2003.This article has been cited by other articles:
![]() |
L. Cheng, S. de la Monte, J. Ma, J. Hong, M. Tong, W. Cao, J. Behar, P. Biancani, and K. M. Harnett HCl-activated neural and epithelial vanilloid receptors (TRPV1) in cat esophageal mucosa Am J Physiol Gastrointest Liver Physiol, July 1, 2009; 297(1): G135 - G143. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Cao, L. Cheng, J. Behar, P. Biancani, and K. M. Harnett IL-1beta signaling in cat lower esophageal sphincter circular muscle Am J Physiol Gastrointest Liver Physiol, October 1, 2006; 291(4): G672 - G680. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |