AJP - GI Journal of Neurophysiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 290: G1307-G1317, 2006. First published January 26, 2006; doi:10.1152/ajpgi.00576.2005
0193-1857/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/6/G1307    most recent
00576.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheng, L.
Right arrow Articles by Harnett, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, L.
Right arrow Articles by Harnett, K. M.

NEUROREGULATION AND MOTILITY

HCl-induced inflammatory mediators in cat esophageal mucosa and inflammatory mediators in esophageal circular muscle in an in vitro model of esophagitis

Ling Cheng,1 Weibiao Cao,1 Claudio Fiocchi,2,3 Jose Behar,1 Piero Biancani,1 and Karen M. Harnett1

1Department of Medicine, Rhode Island Hospital and Brown University, Providence, Rhode Island; and 2Department of Pathobiology, Lerner Research Institute and 3Department of Gastroenterology and Hepatology, Cleveland Clinic Foundation University, Cleveland, Ohio

Submitted 20 December 2005 ; accepted in final form 19 January 2006


    ABSTRACT
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Platelet-activating factor (PAF) and interleukin-6 (IL-6) are produced in the esophagus in response to HCl and affect ACh release, causing changes in esophageal motor function similar to esophagitis (Cheng L, Cao W, Fiocchi C, Behar J, Biancani P, and Harnett KM. Am J Physiol Gastrointest Liver Physiol 289: G418–G428, 2005). We therefore examined HCl-activated mechanisms for production of PAF and IL-6 in cat esophageal mucosa and circular muscle. A segment of normal mucosa was tied at both ends, forming a mucosal sac (Cheng L, Cao W, Fiocchi C, Behar J, Biancani P, and Harnett KM. Am J Physiol Gastrointest Liver Physiol 289: G860–G869, 2005) that was filled with acidic Krebs buffer (pH 5.8) or normal Krebs buffer (pH 7.0) as control and kept in oxygenated Krebs buffer for 3 h. The supernatant of the acidic sac (MS-HCl) abolished contraction of normal muscle strips in response to electric field stimulation. The inhibition was reversed by the PAF antagonist CV3988 and by IL-6 antibodies. PAF and IL-6 levels in MS-HCl and mucosa were significantly elevated over control. IL-6 levels in mucosa and supernatant were reduced by CV3988, suggesting that formation of IL-6 depends on PAF. PAF-receptor mRNA levels were not detected by RT-PCR in normal mucosa, but were significantly elevated after exposure to HCl, indicating that HCl causes production of PAF and expression of PAF receptors in esophageal mucosa and that PAF causes production of IL-6. PAF and IL-6, produced in the mucosa, are released to affect the circular muscle layer. In the circular muscle, PAF causes production of additional IL-6 that activates NADPH oxidase to induce production of H2O2. H2O2 causes formation of IL-1beta that may induce production of PAF in the muscle, possibly closing a self-sustaining cycle of production of inflammatory mediators.

inflammation; smooth muscle contraction; reactive oxygen species; cytokines


WE HAVE REPORTED (11) that experimental esophagitis reduces contraction in response to electric field stimulation (EFS), but not ACh-induced contraction, in cat esophageal circular smooth muscle strips and that several inflammatory mediators, such as IL-1beta, IL-6, H2O2, platelet-activating factor (PAF), and PGE2, are present in the muscle (11, 16). When applied to normal esophageal circular muscle, these mediators reproduce esophagitis-induced changes in contraction, i.e., they inhibited contraction in response to neural stimulation by inhibiting release of ACh but did not inhibit contraction in response to direct myogenic stimulation by direct application of ACh.

When applied to the circular muscle, some of these inflammatory mediators induce formation of other mediators. For instance, IL-1beta and IL-6 induce production of H2O2 in normal circular muscle (16). In turn, H2O2 induces production of PAF and PGE2 (16), and PAF may induce production of more H2O2. For this reason, examining tissues with established inflammation may provide relatively few clues about the sequence of events leading to its establishment. On the other hand, studying separately the events occurring initially in the mucosa and in the muscle layer may permit an estimation of the individual contributions of each of these two components and, possibly, allow the reconstruction of the sequence of events responsible for onset and development of inflammation in both the mucosa and the muscle. Our previously described in vitro mucosal tube (or sac) preparation (15) was designed to distinguish the inflammatory mediators released in the mucosal layer, from both neural and immune cells, from those produced in the circular muscle in response to the mediators released by the mucosal layer. Because the mucosal tube is created by removing the muscle layer at the level of the submucosa, it is reasonable to assume that anything that is produced by the mucosal sac and is collected in the surrounding supernatant would come in contact with the circular muscle in the intact esophagus.

Therefore, we examined the sequence of events occurring in this in vitro model of acute esophagitis that begins with the instillation of HCl inside the mucosal sac. We identified the inflammatory mediators released by the mucosa that affect the circular muscle and examined the functional response of the circular muscle layer to these mucosa-derived mediators.


    METHODS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Tissue preparation. Experimental procedures were approved by the Animal Welfare Committee of Rhode Island Hospital. Adult male cats weighing between 3.5 and 5.5 kg were used in this study. After an overnight fast, animals were initially anesthetized with ketamine (Aveco, Fort Dodge, IA), then euthanized with an overdose of phenobarbital (Schering, Kenilworth, NJ). The chest and abdomen were opened with a midline incision exposing the esophagus and stomach. The esophagus and stomach were removed together and separated immediately above the lower esophageal sphincter (LES). The esophagus was pinned on a wax block, and the smooth muscle layer was opened along the long axis and removed by sharp dissection at the level of the submucosa, leaving the mucosa intact as a tube. The smooth muscle layer, beginning at 1 cm proximal to the LES, was cut into 2-mm circular muscle strips that were mounted in separate 1-ml muscle chambers and used for EFS, as previously described in detail (4, 12). The esophageal epithelial tube consisted of epithelial cells, lamina propria, and muscularis mucosa and submucosa with the epithelial layer on the inside. The separation between mucosal sac and circular muscle strips was as close to the inner layer of the circular muscle as could be surgically achieved under dissecting microscope; thus it seems reasonable to assume that whatever came out of the sac into the supernatant would directly affect the muscle layer. The esophageal mucosa tube was divided in two parts, and each part was tied at both ends. One was filled with Krebs buffer (0.5 ml/cm of tube) and used as a control; the other one was filled with the same volume of Krebs buffer equilibrated with HCl to pH 5.8. We have shown (15) that in the mucosa, tissue content of IL-1beta and IL-6 was highest when the sac was filled with medium at a pH between 5.8 and 4.8 and declined when the pH was lowered to 4, likely reflecting tissue damage.

Both tubes were kept in Krebs buffer with 95% O2 and 5% CO2, at 36°C for 3 h, using 1 ml of Krebs buffer per 100 mg of mucosa. After 3 h, the supernatant surrounding the tubes was collected and analyzed or used to examine its effect on muscle contraction. The pH of the supernatant was 7.4 and needed no adjustment. The mucosa tubes were then opened, the luminal content was discarded, and the tissue was used to measure cytokine content or fixed with 10% formalin for histological examination. This experimental preparation has been described in detail (15).

To compare this in vitro model of inflammation to in vivo-induced acute esophagitis, some animals had their esophagus perfused with 0.1 N HCl on three successive days, and were tested on the fourth day. This procedure has been described in detail elsewhere (11).

A mucosal sac from these in vivo esophagitis animals was prepared and filled with physiological salt solution (PSS) and maintained in Krebs buffer with 95% O2 and 5% CO2, at 36°C for 3 h, using 1 ml of Krebs buffer per 100 mg of mucosa. Inflammatory mediators present in the mucosa or released in the supernatant were measured.

Measurements of contraction. Circular muscle strips devoid of mucosa (2-mm wide) were mounted in separate 1-ml muscle chambers as described in detail (12). They were initially stretched to 2.5 g to bring them near conditions of optimum force development and equilibrated for 2 h while perfused continuously with oxygenated PSS at 37°C. The PSS contained the following (in mmol/l): 116.6 NaCl, 21.9 NaHCO3, 1.2 KH2PO4, 3.4 KCl, 2.5 CaCl2, 5.4 glucose, and 1.2 MgCl2. The solution was equilibrated with a gas mixture containing 95% O2 and 5% CO2 at 37°C, pH 7.4. After equilibration, esophageal strips were stimulated with EFS consisting of 10-s trains of square-wave pulses of supramaximal voltage (0.2-ms duration at 0.5–5 Hz). The stimuli were delivered by a stimulator (Grass Instruments, model S48) through platinum wire electrodes placed longitudinally on either side of the strip.

To study the effect of supernatant from HCl-treated mucosa or of selected cytokines on EFS-induced contraction, 0.1–0.15 ml supernatant was added to the 1-ml bath (pH 7.4) and maintained for 2 h, or appropriate concentrations of the cytokines were added for 2 h, before measuring contraction in response to EFS.

Measurement of IL-6. Esophageal tissue (100 mg of mucosa or muscle) was homogenized in 2 ml phosphate-buffered saline (PBS; Sigma, St. Louis, MO) (pH 7.4) containing 0.01 M phosphate buffer, 0.0027 M KCl, and 0.137 M NaCl. Homogenization was achieved with three, 10- to 20-s bursts with a Tissue-Tearor (BioSpec, Racine, WI). The homogenate was centrifuged at 2,000 g, 4°C, for 20 min. An aliquot of homogenate was taken for protein determination. The homogenate supernatant or the mucosal sac supernatant was frozen in liquid nitrogen for later use. The concentrations of IL-6 were measured using enzyme immunoassay kits from Cayman Chemical (Ann Arbor, MI).

Measurement of PAF. PAF was extracted from tissues by a modification of the method of Bligh and Dyer (5). Esophageal tissue (100 mg of mucosa or muscle) was homogenized in 2 ml of methanol. One milliliter of homogenate was transferred to a tube containing 0.5 ml of chloroform, 1 ml methanol, and 0.4 ml H2O for a final ratio of 1:2:0.8, chloroform:methanol:H2O (vol/vol/vol). The mixture was vortexed, left at room temperature for 1 h, then centrifuged (5,000 g, 5 min). The supernatant was transferred to another glass tube, and the pellet was reextracted with 3.8 ml of the chloroform:methanol:H2O solution. The mixture was centrifuged again, and the two supernatants were combined. Chloroform (2 ml) and 1 M NaCl (2 ml) were added, and the phases were separated by centrifugation (5,000 g, 5 min). The upper phase was aspirated and discarded, and the lower phase was washed once with 4 ml of 1 M NaCl:methanol (9:1 vol/vol). Samples of this washed chloroform phase were dried under nitrogen and stored at –20°C. Measurement of PAF was performed within 72 h of extraction.

Measurement of tissue levels of PAF or of PAF in the mucosal sac supernatant were made using the PAF 3H scintillation proximity assay system (TRK 990; Amersham International, Buckinghamshire, UK). Scintillation proximity assay is a sensitive assay system that uses microscopic beads containing scintillant that emit light when radiolabeled molecules of interest bind to the surface of the bead.

Measurement of PGE2. Esophageal mucosa (100 mg) was homogenized with 10- to 20-s bursts with a Tissue-Tearor (Biospec) followed by 40–60 strokes with a Dounce tissue grinder (Wheaton, Melville, NJ). The homogenate was centrifuged at 15,000 rpm at 4°C for 15 min, and 100 µl of each sample supernatant was used for protein measurement to normalize PGE2 values in mucosa supernatant.

Mucosa supernatant (2 ml) was used to measure release of PGE2 by the HCl-filled mucosal sac. PGE2 in the supernatant was purified with a PGE2 affinity column (Cayman Chemical). The resulting extracts were kept at –70°C. The PGE2 concentration was quantified by using a PGE2 competitive enzyme immunoassay kit (Cayman Chemical).

PAF receptor immunohistochemistry. Tissue sections from paraffin blocks were sequentially immersed three times in xylene, twice in 100% alcohol, once in 95% alcohol, then in running water, to remove paraffin. Each immersion was for 5 min. The slides were then maintained in PBS, then incubated with a 10% solution of blocking serum for 30 min. After removal from the blocking serum, the sections were incubated with the PAF antibody (1:200) for 60 min, then washed three times for 5 min in buffer and incubated with a fluorochrome-conjugated antibody for 45 min in a dark chamber. The sections were washed three times for 5 min in buffer in a dark chamber, then placed in 90% glycerol in PBS, and a cover slip was mounted. The slides were examined using a fluorescence microscope with appropriate filters, then stored in a dark location at 4°C.

RT-PCR. Total RNA was purified by TRIzol reagent (Invitrogen) from mucosa and esophageal circular muscle. Total RNA (2 µg) was reversely transcribed and then subjected to PCR by using a kit SuperScript first-strand synthesis system for RT-PCR (Invitrogen).

Primers for PAF-receptor mRNA were sense, TTCAATGAGATAAAGATCTTCA; and antisense, GAGCAAGGTACGGATGATGACC. A search of the Blast database indicated that these primers are specific for PAF-receptor mRNA of human, chimpanzee, rhesus macaque monkey, dog, rat, mouse, zebrafish, guinea pig, goat, and cow. Reactions were carried out in a PTC-100 programmable thermal controller (MJ Research, Waltham, MA) for 1 cycle at 94°C for 5 min, followed by 40 cycles at 94°C for 1 min, 62°C for 1 min, and 72°C for 1 min.

Primers for IL-6-receptor mRNA were sense, GAAGCAGCAGGCAATGTTACC; and antisense, CTCACAGATGGCGTTGACAAGG. A search of the Blast database indicated that these primers are specific for IL-6-receptor mRNA of human and mouse. Reactions were carried out in a PTC-100 programmable thermal controller (MJ Research) for 1 cycle at 94°C for 5 min, followed by 35 cycles at 94°C for 30 s, 55°C for 1 min, and 72°C for 1 min.

Protein determination. The homogenates of esophageal tissues were solubilized by addition of 6 ml of 0.1 N NaOH and heating the sample at 80°C for 30 min. The amount of protein present was determined by colorimetric analysis (Bio-Rad, Melville, NY) according to the method of Bradford (8).

Materials and reagents. Human interleukins IL-6 and IL-1beta were purchased from Pierce Endogen (Rockford, IL). Antibodies of IL-6 and IL-1beta were purchased from R&D Systems (Minneapolis, MN). Apocynin was purchased from Calbiochem (San Diego, CA). All other reagents were purchased from Sigma-Aldrich.

Statistical analysis. Data are means ± SE. Statistical differences between means were determined by Student's t-test. Differences between multiple groups were tested using analysis of the variance (ANOVA) for repeated measures and checked for significance using the Scheffé F-test.


    RESULTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Mucosal sac supernatant and circular muscle contraction. Figure 1 shows that direct application of HCl (3 h, pH 5.8) to circular muscle strips did not change EFS-induced contraction, compared with untreated muscle. In contrast, the supernatant of HCl-filled mucosa almost abolished the contraction. This supernatant-induced inhibition was reversed when the competitive PAF-receptor antagonist CV-3988 or IL-6 antibodies were added to the supernatant of the HCl-filled mucosal sac.


Figure 1
View larger version (17K):
[in this window]
[in a new window]
 
Fig. 1. Direct application of HCl (pH 5.8, 3 h) to circular muscle strips (Muscle + HCl) did not change electric field stimulation (EFS)-induced contraction, compared with untreated muscle (Muscle alone). Supernatant of HCl-filled mucosa (MS-HCl, pH 5.8, 3 h), however, almost abolished the contraction. The supernatant-induced inhibition was reversed when the competitive platelet-activating factor (PAF) antagonist CV-3988 (10–6 M) or IL-6 antibodies (1:200 dilution) were added to the supernatant of the HCl-filled mucosal sac (P < 0.01, ANOVA). Some of the data shown have been previously published (15) and are shown here to clearly demonstrate the effect of the PAF-receptor antagonist CV-3988 on EFS-induced contraction. Values are means ± SE for 3–6 experiments.

 
Inflammatory mediators in esophageal mucosa and mucosal sac supernatant. Figure 2 shows that PAF and IL-6 levels were elevated in the supernatant of normal mucosa exposed to HCl and comparable to the levels of both mediators present in supernatants of mucosa from animals with in vivo-induced esophagitis. These findings are consistent with the results illustrated in Fig. 1 and support the conclusion that the presence of HCl in the lumen of the esophageal mucosal sac induces production of PAF and IL-6 in the mucosa, which are subsequently released into the surrounding supernatant.


Figure 2
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 2. PAF levels in mucosa supernatant are shown at left; IL-6 levels are shown at right. When a sac of normal mucosa was filled with HCl (MS-HCl) at pH 5.8 for 3 h, both PAF and IL-6 levels increased significantly (*P < 0.05, ANOVA) in the supernatant. The increased levels were comparable to those present in supernatant of mucosa from animals with in vivo-induced esophagitis (MS esophagitis) after 3-h incubation in normal Krebs buffer. Values are means ± SE for 3 experiments.

 
To determine whether IL-6 may induce production of PAF or, conversely, whether PAF may induce production of IL-6, we examined the release of PAF into the supernatant of an HCl-filled mucosal sac in the presence of an IL-6 antibody, both inside and outside the sac, and the release of IL-6 in the presence of the PAF-receptor antagonist CV3988. Figure 3 shows that neutralization of IL-6 did not significantly affect production of PAF in the mucosal tissue or PAF release into the supernatant. In contrast, as shown in Fig. 4, neutralizing PAF with the PAF-receptor antagonist CV3988 significantly inhibited production of IL-6 in the mucosa and release of IL-6 into the supernatant. This suggests that production of PAF induces production and release of IL-6 by the mucosa.


Figure 3
View larger version (9K):
[in this window]
[in a new window]
 
Fig. 3. PAF levels in mucosa and mucosa supernatant shown at left and right, respectively. When a sac of normal mucosa was filled with HCl at pH 5.8 for 3 h, PAF levels increased significantly in mucosa and in the supernatant (*P < 0.05, ANOVA). Adding IL-6 antibodies (1:200) to HCl inside the sac and to the sac supernatant did not affect PAF levels in the mucosa or in the supernatant, indicating that formation and release of PAF does not depend on the presence of IL-6. Values are means ± SE for 3 experiments.

 

Figure 4
View larger version (10K):
[in this window]
[in a new window]
 
Fig. 4. IL-6 levels in mucosa and mucosa supernatant shown at left and right, respectively. When a sac of normal mucosa was filled with HCl at pH 5.8 for 3 h, IL-6 levels increased significantly in mucosa and in the supernatant when compared with control (*P < 0.05, ANOVA). Adding the PAF-receptor antagonist CV3988 (10–6 M) to HCl inside the sac and to the sac supernatant significantly reduced IL-6 levels in the mucosa and in the supernatant compared with HCl-treated mucosa without the antagonist (#P < 0.05, ANOVA), indicating that formation and release of IL-6 depends on binding of PAF to its receptors. Values are means ± SE for 3 experiments.

 
We have previously shown (16) that PGE2 and PAF are elevated in circular muscle layer of animals with in vivo-induced esophagitis and that both mediators contributed to inhibition of ACh release from enteric neurons. We therefore examined release of PGE2 into the supernatant of HCl-filled mucosal sac. Unlike PAF, PGE2 increased by a small amount (20%, Table 1). This increase was not significant compared with control (i.e., mucosal sac filled with Krebs buffer) and was negligible compared with the levels present in supernatant of mucosal sac from esophagitis animals (Fig. 5).


View this table:
[in this window]
[in a new window]
 
Table 1. HCl-induced increase in levels of inflammatory mediators in mucosa supernatant as percent of control

 

Figure 5
View larger version (10K):
[in this window]
[in a new window]
 
Fig. 5. When a sac of normal mucosa was filled with HCl (HCl) at pH 5.8 for 3 h, the levels of PGE2 released in the supernatant did not change. In contrast, mucosal sacs from esophagitis animals released significantly higher levels of PGE2 after the same length of incubation in normal Krebs buffer (*P < 0.05, ANOVA). Values are means ± SE for 3 experiments.

 
Table 1 summarizes the inflammatory mediators present in the supernatant surrounding the HCl-filled mucosal sac preparation, after its filling with HCl (pH 5.8, 3 h). The levels of IL-6 and PAF in the supernatants were significantly elevated compared with Krebs solution-filled mucosal sac (control). By comparison, supernatant levels of H2O2, IL-1beta, or PGE2 were similar to those present in the supernatant of Krebs-filled mucosa.

Inflammatory mediators in esophageal circular smooth muscle. We next examined the effects of PAF and IL-6 released by the mucosa in response to HCl on esophageal circular muscle. PAF caused production of H2O2 by esophageal circular smooth muscle (Fig. 6). This H2O2 production in response to PAF was significantly reduced by incubation with the NADPH oxidase inhibitor apocynin, indicating PAF-induced activation of NADPH oxidase in the muscle. In addition, PAF-induced production of H2O2 was also reduced by incubation of the muscle with IL-6 antibodies, indicating that IL-6, presumably produced in response to PAF, mediates PAF-induced production of H2O2.


Figure 6
View larger version (13K):
[in this window]
[in a new window]
 
Fig. 6. When esophageal circular muscle was exposed to PAF (10–5 M), H2O2 levels in the muscle increased significantly (*P < 0.05, ANOVA) compared with control. The increase was significantly reduced by the NADPH oxidase inhibitor apocynin (10–5 M) (#P < 0.05, ANOVA) and by a selective IL-6 antibody (1:200) compared with PAF-treated mucosa. The reduction induced by apocynin was the same as the reduction induced by the IL-6 antibody. The data indicate that PAF-induced production of H2O2 depends on activation of NADPH oxidase and formation of IL-6. Values are means ± SE for 3 experiments. The cartoon on the top right side represents a possible pathway consistent with these results. The pathway will be modified in subsequent figures so as to remain consistent with this and the following figures.

 
That IL-6 production is induced by PAF was confirmed in the results shown in Fig. 7. IL-6 production is not affected by apocynin or by IL-1beta antibodies, but it is completely abolished by the addition of CV3988. These data suggest that, similarly to the mucosa, PAF directly causes production of IL-6 in the muscle, and IL-6 then activates NADPH oxidase, causing production of H2O2.


Figure 7
View larger version (13K):
[in this window]
[in a new window]
 
Fig. 7. When esophageal circular muscle was exposed to PAF (10–5 M), IL-6 levels in the muscle increased significantly (*P < 0.05, ANOVA) compared with control. The increase was not affected by the NADPH oxidase inhibitor apocynin (10–5 M) or by a selective IL-1beta antibody (1:200), compared with PAF. The PAF-induced increase was abolished, as expected, by the PAF-receptor antagonist CV3988 (10–6 M). These data indicate that PAF-induced production of IL-6 is direct and not mediated by activation of NADPH oxidase or formation of IL-1beta. Values are means ± SE for 3 experiments.

 
IL-6-induced production of H2O2 was confirmed in the results shown in Fig. 8. The IL-6-induced increase in H2O2 was reduced by apocynin, confirming activation of NADPH oxidase, but was not affected by the PAF-receptor antagonist CV3988. These data suggest that IL-6-dependent production of H2O2 does not involve PAF, whereas PAF-induced production of H2O2 is mediated by IL-6. In this respect, production of IL-6 and PAF by the muscle is similar to that of the mucosa, where PAF induces production of IL-6, whereas IL-6 plays no role in inducing production of PAF.


Figure 8
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 8. When esophageal circular muscle was exposed to IL-6 (2 U/ml), H2O2 levels in the muscle increased significantly (*P < 0.05, ANOVA compared to control). The increase was abolished by the NADPH oxidase inhibitor apocynin (10–5 M) (#P < 0.05, ANOVA compared to IL-6-treated muscle), indicating IL-6-induced activation of NADPH oxidase. The IL-6-induced increase in H2O2 was not affected by the PAF-receptor antagonist CV3988 (10–6 M). These data indicate that IL-6-dependent production of H2O2 does not involve PAF. Values are means ± SE for 3 experiments.

 
We have shown, in this in vitro model of HCl-induced inflammation, that IL-1beta is produced in the mucosa but not released in the supernatant (15). IL-1beta, however, is present in the circular muscle layer after induction of in vivo esophagitis (11). We therefore investigated whether IL-1beta may be produced in the circular muscle in response to PAF, IL-6, or H2O2. Figure 9 shows that in the circular muscle H2O2, PAF, and IL-6 induce production of IL-1beta. PAF-induced production of IL-1beta is reduced by IL-6 neutralization, indicating that production of IL-1beta is mediated by IL-6. IL-6-mediated production of IL-1beta appears to depend on activation of NADPH oxidase, as it is reduced by the NADPH oxidase blocker apocynin. Thus PAF causes production of IL-6, and IL-6 activates NADPH oxidase to produce H2O2 which, in turn, induces production of IL-1beta.


Figure 9
View larger version (14K):
[in this window]
[in a new window]
 
Fig. 9. When esophageal circular muscle was exposed to H2O2, IL-1beta in the muscle increased significantly (*P < 0.05, ANOVA vs. control). PAF and IL-6 also increased IL-1beta. The increase induced by PAF was abolished by immunoneutralization of IL-6 (#P < 0.05, ANOVA, compared with PAF alone). The increase induced by IL-6 was abolished by the NADPH oxidase inhibitor apocynin (10–5 M) (#P < 0.05, ANOVA, compared with IL-6 alone). These data indicate PAF may induce production of IL-1beta by sequential formation of IL-6, causing production of H2O2 that, finally, induces production of IL-1beta. Values are means ± SE for 3 experiments.

 
We have shown, in an in vivo experimental esophagitis preparation (16), that production of PAF may be reduced by the H2O2 scavenger catalase, suggesting H2O2-mediated production of PAF. We therefore examined the possible role of H2O2 in production of PAF in this in vitro model of esophageal inflammation. Figure 10 indicates that exposure to H2O2 induces production of PAF by the muscle and that production of PAF depends on formation of IL-1beta as PAF levels are abolished by incubation with IL-1beta antibodies.


Figure 10
View larger version (15K):
[in this window]
[in a new window]
 
Fig. 10. When esophageal circular muscle was exposed to H2O2 (70 µM), PAF levels in the muscle increased significantly (*P < 0.05, ANOVA), and the increase was almost abolished by incubation with IL-1beta antibodies (1:200) (#P < 0.05, ANOVA compared with H2O2-treated muscle), indicating that production of IL-1beta is required for H2O2-induced production of PAF. Values are means ± SE for 3 experiments.

 
Finally, to confirm the validity of the proposed model of interaction among inflammatory mediators, we examined production of IL-6 in response to H2O2 or IL-1beta. Figure 11 indicates that IL-6 may be produced in response to either H2O2 or IL-1beta. IL-6 production in response to H2O2 was abolished by IL-1beta antibodies and by the PAF antagonist CV3988. IL-6 production in response to IL-1beta was abolished by the PAF antagonist CV3988, but not by apocynin, confirming the proposed sequence of events.


Figure 11
View larger version (14K):
[in this window]
[in a new window]
 
Fig. 11. When esophageal circular muscle was exposed to H2O2 (70 µM) or to IL-1beta (200 U/ml), IL-6 levels in the muscle increased significantly (*P < 0.05, ANOVA compared to control). The IL-6 production in response to H2O2 was abolished by IL-1beta antibodies (1:200) and by the PAF antagonist CV3988 (10–6 M) (#P < 0.05, ANOVA, compared with H2O2-treated muscle). IL-6 production in response to IL-1beta was abolished by the PAF antagonist CV3988 (#P < 0.05, ANOVA, compared with IL-1beta-treated muscle). Values are means ± SE for 3 experiments.

 
PAF and IL-6 receptor mRNA. Because esophageal mucosa produces and releases IL-6 in response to PAF, we examined mucosa and circular muscle tissues for the presence of PAF-receptor mRNA and IL-6-receptor mRNA.

Figure 12 indicates that normal mucosa does not contain PAF-receptor or IL-6-receptor mRNA. HCl treatment increased PAF-receptor but not IL-6-receptor mRNA in mucosa. After esophagitis, induced in vivo by repeated HCl esophageal perfusion over 3 days, both receptors were expressed in the mucosa. In contrast, PAF-receptor and IL-6-receptor mRNA are present in normal circular muscle. PAF-receptor and IL-6-receptor mRNA are not affected by direct exposure of muscle to HCl but are upregulated after in vivo esophagitis. These findings are confirmed in Fig. 13, \. showing immunohistochemistry for PAF receptors in normal and HCl-treated mucosa (3 h). The data suggest that, when PAF receptors are present, PAF causes biosynthesis of cytokines such as IL-6 (and perhaps others) in mucosa. IL-6 receptors, however, are not present after incubation in HCl. If IL-6 is directly responsible for activation of NADPH oxidase, then the absence of IL-6 receptors in the mucosa may explain why H2O2 is not produced in the mucosa (15) after 3-h incubation in HCl. Both PAF and IL-6 receptors are present in muscle, where they cause production of H2O2, which diffuses across cell membranes and may induce production of additional inflammatory mediators.


Figure 12
View larger version (59K):
[in this window]
[in a new window]
 
Fig. 12. PAF-receptor (PAF-R) and IL-6-receptor (IL-6-R) mRNA in esophageal mucosa and circular muscle layers was examined by RT-PCR. Normal mucosa did not have PAF-receptor and IL-6-receptor mRNA. HCl treatment increased PAF-receptor but not IL-6-receptor mRNA in mucosa. After esophagitis, induced in vivo by repeated HCl esophageal perfusion over 3 days, both receptors were expressed in the mucosa. In contrast, PAF-receptor and IL-6-receptor mRNA was present in normal circular muscle. PAF-receptor and IL-6-receptor mRNA was not affected by direct exposure of muscle to HCl but was upregulated after in vivo esophagitis.

 

Figure 13
View larger version (39K):
[in this window]
[in a new window]
 
Fig. 13. Immunohistochemistry for PAF receptors in normal and HCl-treated mucosa (3 h). HCl treatment caused a visible increase in PAF receptor-associated immunofluorescence.

 
Based on all the above results, we propose the series of events illustrated in Fig. 14: exposure of mucosa to HCl causes formation of PAF, upregulation of PAF-receptor mRNA, and expression of PAF receptors in the mucosa, where PAF may activate its receptors to induce formation of IL-6 and IL-1beta. PAF and IL-6 are released and affect the circular muscle layer, whereas IL-1beta produced by the mucosa remains confined to the mucosa.


Figure 14
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 14. Left: in mucosa, HCl causes formation of IL-1beta, PAF, and IL-6. IL-6 is produced in response to PAF, presumably after PAF receptors are expressed in response to HCl. PAF and IL-6 are then released to affect the circular muscle. IL-1beta remains in the mucosa. Right: in circular muscle, PAF, released by the mucosa, causes the sequential production of IL-6, H2O2, and IL-1beta, which in turn induces production of PAF by the circular muscle. We have previously shown that IL-1beta-induced production of PAF is partially reduced by the H2O2 scavenger catalase (16), implying that IL-1beta-induced production of PAF may partly depend on formation of H2O2. This possibility is reflected by the dashed arrow on the left side of the flow chart.

 

    DISCUSSION
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We have shown (15) that in vitro exposure of esophageal circular muscle to HCl does not affect the amplitude of EFS-induced contraction. In contrast, incubation in supernatant of mucosa exposed to HCl at the same pH and for the same time almost abolished the circular muscle response to electrical (i.e., neural) stimulation, indicating the presence of inflammatory mediators released by the mucosa in response to acid. We have also shown that one of the released inflammatory mediators is IL-6 (15). In this study, we now show that PAF is also released and, in addition, that PAF mediates production of IL-6 in the mucosa as well as in the circular muscle layer (besides inhibiting release of ACh from intramural neurons, as previously demonstrated; Ref. 16). In the circular muscle, IL-6 causes sequential production of H2O2 and IL-1beta, which in turn, induces production of PAF by the circular muscle itself, completing an inflammatory cycle.

These conclusions are supported by the following findings.

PAF-induced production of IL-6 in mucosa and circular muscle. IL-6 is generated in response to PAF in several experimental preparations, including human uterine cervical (49) and lung fibroblast (43), human endometrial stromal cells (38), lung cells (53), endothelial cells (31) and keratinocytes (41), and rat vascular smooth muscle cells (20). We therefore examined whether PAF may be produced and secreted by mucosa in response to acid, to generate IL-6. We found that PAF and IL-6 are both present in mucosa and supernatant after exposure to HCl. In addition, inhibition of PAF by a PAF-receptor antagonist and immunoneutralization of IL-6 by a selective IL-6 antibody partly restored contraction in response to EFS in esophageal circular muscle exposed to supernatant of HCl-treated mucosa. These findings support the presence of both PAF and IL-6 in the supernatant and their role in decreasing esophageal circular muscle contraction. We measured both PAF and IL-6 and found that both were present in mucosa supernatant, at levels comparable with those found in supernatant of mucosa from animals with in vivo-induced esophagitis (by repeated HCl perfusion on three consecutive days).

To show that PAF contributes to production of IL-6, we measured both mediators in mucosa tissue and mucosa supernatant, after 3-h incubation with HCl, in the presence of inhibitors or antibodies. Immunoneutralization of IL-6 with a selective IL-6 antibody had no effect on HCl-induced production and release of PAF, but inhibition of PAF by a PAF-receptor antagonist inhibited HCl-induced formation and release of IL-6, confirming that, in esophageal mucosa exposed to HCl, PAF causes formation of IL-6.

In our model of in vivo-induced esophagitis by repeated esophageal acid perfusion, we have shown that increased levels of PGE2 reduce contraction in response to electrical stimulation (16). We therefore examined whether elevated levels of PGE2 may be released by the mucosa in response to HCl to affect contraction of circular muscle. Mucosa from esophagitis animals released elevated levels of PGE2 compared with control mucosa. In contrast, in normal mucosa, slight or no increase in PGE2 release (Table 1) occurred after 3-h exposure to HCl, indicating that most of PGE2 production is delayed, occurring in mucosa (and, possibly in muscle) during the course of the inflammatory process that produces in vivo esophagitis. PAF and IL-6 are the major inflammatory mediators released by the mucosa, as shown in Table 1, which summarizes results from this and previous studies from our laboratory. As shown elsewhere (13) and reported again in Table 1, after 3-h exposure to HCl, no H2O2 is produced in or released by the mucosa. The identity of the inflammatory mediators released by the mucosa after exposure to HCl is important, because they act on the circular muscle and on circulating leukocytes in the initial phase of the inflammatory process. Because PAF produced in the mucosa leads to formation of IL-6, resulting in release of both PAF and IL-6 into the surrounding supernatant, it appears that PAF is a particularly important inflammatory mediator that initiates the inflammatory cascade and contributes to the transmission of the inflammation from the mucosal layer to circular muscle.

The mechanisms responsible for acid-induced formation of PAF in the mucosa are unknown. Data from this and previous studies from our laboratory (11, 15, 16) suggest that acid-induced inflammation begins with formation of IL-1beta, PAF, and IL-6 in the mucosal layer. IL-1beta does not diffuse out of the mucosa (15), but it may promote the conversion of the biologically inactive lyso-platelet-activating factor (lyso-PAF) to the bioactive platelet-activating factor (PAF) by an acetylation reaction, as reported in cultured human endothelial cells (10). As shown in several cell types (20, 31, 38, 43, 49, 53), PAF induces production of IL-6 in esophageal mucosa, and both diffuse out of the mucosal layer to the circular muscle where PAF will bind to PAF receptors that are always present in the muscle layer. In the circular muscle, PAF induces formation of IL-6 as it does in the mucosa.

PAF-induced formation of IL-6 has been demonstrated in several experimental preparations (20, 31, 38, 43, 49, 53), but the pathway mediating PAF-induced formation of IL-6 is far from clear. PAF is a potent proinflammatory phospholipid with diverse pathological and physiological effects. The PAF receptor couples to pertussis toxin-sensitive and insensitive G proteins (18, 25), with various types of G proteins involved in individual cases (24, 47). PAF-receptor signaling involves the activation of phospholipases A2, C, and D (30, 34, 42), increased inositol 1,4,5-trisphosphate synthesis, and release of arachidonic acid, causing calcium mobilization (25). Recently, PAF-receptor signaling was shown to occur by a mechanism involving phosphorylation of Tyk 2 (Janus activated protein tyrosine kinase family member) independently of G protein participation (36), suggesting an additional mechanism of signal transduction by the PAF receptor (47). Thus activation of the PAF receptor leads to the activation of numerous signaling intermediates, including protein kinase C, phosphatidylinositol 3-kinase, protein tyrosine kinases, phospholipases, and MAP kinases (27). In human lung fibroblasts, Roth et al. (43) demonstrated that PAF-induced transcription of IL-6 genes requires activation of pertussis toxin-sensitive G proteins, tyrosine kinases, and protein kinase C, but the precise pathway leading from PAF to formation of IL-6 is unknown.

IL-6-induced production of H2O2 in circular muscle. In the circular muscle, PAF induces formation of IL-6 as it does in the mucosa. Production of IL-6 is then followed by IL-6-induced production of H2O2. The pathway for IL-6-induced production of H2O2 has not been clearly elucidated. The reverse pathway, responsible for H2O2-induced production of IL-6, has been investigated in a variety of experimental preparations, and two distinct pathways have been demonstrated. A more common pathway occurs by activation of NF{kappa}B and induction of cytokine gene expression (21, 29, 40, 46, 55). The other pathway is mediated through reactive oxygen species (ROS)-induced activation of MAPKs, which culminates in IL-6 gene expression through a CRE-dependent, but not NF{kappa}B-dependent, pathway (45). In contrast, the finding of IL-6-induced production of H2O2 is novel and has been recently demonstrated in our laboratory in cat esophageal circular muscle (16) and by others in vascular smooth muscle (54). In vascular smooth muscle, however, production of H2O2 is critically dependent on activation of angiotensin receptors, as IL-6 alone does not cause a significant increase in H2O2, and IL-6-induced potentiation of H2O2 does not occur in angiotensin II type 1 receptor knockout animals. In contrast, in esophageal circular muscle, IL-6-induced production of H2O2 may be direct and does not require activation of angiotensin receptors and is independent of PAF. Figure 8 clearly shows statistically significant production of H2O2 in response to IL-6 that is not affected by the PAF-receptor antagonist CV3988.

In the circular muscle, IL-6 induces formation of H2O2 by activating a phagocytic-like NADPH oxidase. NADPH oxidase has been well-characterized in phagocytes (32). The NADPH oxidase of phagocytes is a multisubunit enzyme complex that produces the superoxide anion OFormula(39). OFormula in aqueous solution is short-lived and rapidly reduced to the more stable molecule H2O2. Phagocytic NADPH oxidase may be rapidly activated and produce large amounts of ROS (32).

Low levels of ROS, seen in non-phagocytic cells, were thought to be byproducts of aerobic metabolism, as part of the mitochondrial respiratory process. Recently, however, superoxide-generating homologues of the phagocytic NADPH oxidase catalytic unit (gp91phox, also known as NOX2) have been discovered: NOX1, NOX3, NOX4, NOX5, DUOX1, and DUOX2. These and homologues of other NADPH oxidase subunits (2, 32, 50) have been found in several cell types. The presence of these homologues in non-phagocytic cells suggests that ROS generated in these cells may have a nonmitochondrial origin and have distinctive cellular functions related to immunity, signal transduction, and modification of the extracellular matrix (32).

The role of these NADPH oxidases in the development of esophageal inflammation has not been explored. Data from our laboratory indicate that human esophageal smooth muscle cells contain NOX1 through NOX5 and that NOX5 cDNA, obtained by real-time PCR, is significantly upregulated by induction of esophagitis (17). NOX5 is significantly upregulated by exposure to PAF (L. Cheng, unpublished observations), and H2O2 content of esophageal and LES circular muscle is significantly increased in esophagitis and in normal muscle exposed to IL-6 or IL-1beta (1417).

In the present study, we show that IL-6 increases H2O2 levels in cat esophageal circular muscle by activating NADPH oxidase, as shown in Fig. 8. This conclusion is based on inhibition of H2O2 production by the ortho-methoxy-substituted catechol apocynin, a potent and selective inhibitor of NADPH oxidase (22). Apocynin inhibits the assembly of NADPH oxidase by preventing translocation of its components p47phox and p67phox (48) to the membrane to associate with Rac-GTP and cytochrome b558 to form the active enzyme (32). Apocynin is extensively used to identify production of H2O2 by NADPH oxidase, as opposed to other possible sources of ROS, in cells and in experimental models of inflammation (3). The finding of apocynin-induced inhibition of H2O2 production in response to IL-6 strongly supports the likelihood of IL-6-induced formation of H2O2 by NADPH oxidase.

Signal-transducing IL-6 receptors may activate a JAK-STAT pathway or activate the MAP kinase cascade (6, 23). The MAP kinase pathway may in turn activate cPLA2, producing arachidonic acid. In monocytes, activation of NADPH oxidase depends on cytosolic phospholipase A2-generated arachidonic acid (1). Arachidonic acid may promote activation of NADPH oxidase by binding to the myeloid-related proteins S100A8/A9, which then interact with the p47-p67 NADPH components (7, 28), promoting interactions between the different oxidase subunits and enabling full oxidase activation or directly affecting the function of flavocytochrome b (19).

H2O2-induced production of IL-1beta in circular muscle. IL-1beta is an additional proinflammatory cytokine present in esophageal circular muscle of animals with in vivo-induced esophagitis and is in part responsible for reduced contraction in response to neural stimulation (11, 16). In esophageal mucosa, however, IL-1beta is produced in response to HCl (3 h) but not released to affect the circular muscle layer (15).

To investigate how IL-1beta may be produced in circular muscle during the inflammatory process, we examined whether PAF or PAF/IL-6/H2O2 may cause production of IL-1beta in circular muscle.

As shown in Fig. 9, PAF mediates production of IL-1beta through formation of IL-6 and IL-6-induced production of H2O2. The data suggest that diffusion of PAF from the mucosa to the circular muscle causes production of IL-6 in the muscle, which in turn contributes to production of H2O2, and H2O2 causes production of IL-1beta by the circular muscle. A review of the literature indicates that IL-1beta-induced formation of H2O2 has been reported in several experimental preparations (9, 26, 35, 37, 44, 51), including cat esophageal and LES circular muscle (14, 16). Conversely, it has been shown that H2O2 may induce the release of IL-1beta by activating NF{kappa}B (21, 33), perhaps through tyrosine phosphorylation of I{kappa}B{alpha} and serine phosphorylation of p65 (52), possibly inducing production of cytokines, with preference for IL-1beta (21). In any case, H2O2-induced formation of IL-1beta is clearly demonstrated in Fig. 9.

Examining production of PAF indicates that H2O2 mediates production of PAF through formation of IL-1beta, as H2O2-induced production of PAF is abolished by immunoneutralization of IL-1beta (Fig. 10). These results are consistent with H2O2-induced production of IL-1beta. The finding that IL-1beta antibodies abolish H2O2-induced production of PAF suggests that formation of IL-1beta is an obligatory step in formation of PAF in response to H2O2.

These data are consistent with the cartoon illustrated in Fig. 14. To test the validity of the model illustrated, we examined production of IL-6 in response to H2O2, IL-1beta, and PAF. Figure 11 confirms the sequential production of inflammatory mediators, from H2O2-induced production of IL-1beta to IL-1beta-induced production of PAF and PAF-induced production of IL-6. Taken together, the data suggest that PAF, released by the mucosa, induces sequential production of IL-6, H2O2, IL-1beta, and PAF in the circular muscle.

A qualitative understanding of development of inflammation in response to HCl may be illustrated by examining RT-PCR data for IL-6 and PAF receptors. The normal mucosa has no receptor mRNA for either PAF or IL-6. Upon exposure to HCl the mucosa releases both PAF and IL-6 to affect the muscle layer, which has receptor mRNA for both mediators and thus may initiate an immune response, resulting in production of more IL-6, H2O2, IL-1beta, and PAF. In the mucosa, 3-h exposure to HCl induces upregulation of PAF-receptor mRNA and expression of PAF receptors (Fig. 12 and 13). Mucosa IL-6-receptor mRNA may be upregulated later in the inflammatory process, appearing after induction of in vivo esophagitis by repeated perfusion of the esophageal lumen over the course of 3 days.

We conclude that PAF, released by the mucosa, diffuses to the circular muscle where it induces formation of IL-6, which in turn activates NADPH oxidase, causing sequential production of H2O2, IL-1beta, and PAF by the muscle. We have shown that IL-1beta-induced production of PAF was partially reduced by the H2O2 scavenger catalase (16), implying that IL-1beta-induced production of PAF may partly depend on formation of H2O2. This possibility is reflected by the dashed arrow on the left side of the flow chart in Fig. 14.

These inflammatory mediators inhibit neurally mediated contraction of circular muscle by inhibiting ACh release from intramural neurons as previously demonstrated (16). Once these inflammatory mediators are present, any one of them may contribute to sequential formation of the others, possibly initiating a self-sustaining cycle.


    GRANTS
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grant RO1-DK-57030.


    FOOTNOTES
 

Address for reprint requests and other correspondence: K. M. Harnett, RI Hospital, Gastrointestinal Motor Function Research Laboratory, 55 Claverick St., Rm. 333, Providence, RI 02903 (e-mail: karen_harnett{at}brown.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Bae YS, Kim Y, Kim JH, Lee TG, Suh PG, and Ryu SH. Independent functioning of cytosolic phospholipase A2 and phospholipase D1 in Trp-Lys-Tyr-Met-Val-D-Met-induced superoxide generation in human monocytes. J Immunol 164: 4089–4096, 2000.[Abstract/Free Full Text]
  2. Banfi B, Maturana A, Jaconi S, Arnaudeau S, Laforge T, Sinha B, Ligeti E, Demaurex N, and Krause KH. A mammalian H+ channel generated through alternative splicing of the NADPH oxidase homolog NOH-1. Science 287: 138–142, 2000.[Abstract/Free Full Text]
  3. Barbieri SS, Cavalca V, Eligini S, Brambilla M, Caiani A, Tremoli E, and Colli S. Apocynin prevents cyclooxygenase 2 expression in human monocytes through NADPH oxidase and glutathione redox-dependent mechanisms. Free Radic Biol Med 37: 156–165, 2004.[Web of Science][Medline]
  4. Biancani P, Billett G, Hillemeier C, Nissenshon M, Rhim BY, Sweczack S, and Behar J. Acute experimental esophagitis impairs signal transduction in cat LES circular muscle. Gastroenterology 103: 1199–1206, 1992.[Web of Science][Medline]
  5. Bligh EG and Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol 37: 911–917, 1959.[Medline]
  6. Boulanger MJ, Chow DC, Brevnova EE, and Garcia KC. Hexameric structure and assembly of the interleukin-6/IL-6 alpha-receptor/gp130 complex. Science 300: 2101–2104, 2003.[Abstract/Free Full Text]
  7. Bouzidi F and Doussiere J. Binding of arachidonic acid to myeloid-related proteins (S100A8/A9) enhances phagocytic NADPH oxidase activation. Biochem Biophys Res Commun 325: 1060–1065, 2004.[CrossRef][Web of Science][Medline]
  8. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Annal Biochem 72: 248–254, 1976.[CrossRef][Web of Science][Medline]
  9. Brigelius-Flohe R, Banning A, Kny M, and Bol GF. Redox events in interleukin-1 signaling. Arch Biochem Biophys 423: 66–73, 2004.[CrossRef][Web of Science][Medline]
  10. Bussolino F, Breviario F, Aglietta M, Sanavio F, Bosia A, and Dejana E. Studies on the mechanism of interleukin 1 stimulation of platelet activating factor synthesis in human endothelial cells in culture. Biochim Biophys Acta 927: 43–54, 1987.[Medline]
  11. Cao W, Cheng L, Behar J, Fiocchi C, Biancani P, and Harnett KM. Proinflammatory cytokines alter/reduce esophageal circular muscle contraction in experimental cat esophagitis. Am J Physiol Gastrointest Liver Physiol 287: G1131–G1139, 2004.[Abstract/Free Full Text]
  12. Cao WB, Harnett KM, Chen Q, Jain MK, Behar J, and Biancani P. Group I secreted PLA2 (sPLA2) and arachidonic acid metabolites in the maintenance of cat LES tone. Am J Physiol Gastrointest Liver Physiol 277: G585–G598, 1999.[Abstract/Free Full Text]
  13. Chen WP, Chen A, and Lin CY. In vitro effects of interleukins on human mesangial cells: implications for glomerulonephritis. J Pathol 175: 327–337, 1995.[CrossRef][Web of Science][Medline]
  14. Cheng L, Cao W, Behar J, Biancani P, and Harnett KM. Inflammation induced changes in arachidonic acid metabolism in cat LES circular muscle. Am J Physiol Gastrointest Liver Physiol 288: G787–G797, 2005.[Abstract/Free Full Text]
  15. Cheng L, Cao W, Fiocchi C, Behar J, Biancani P, and Harnett KM. In vitro model of acute esophagitis in the cat. Am J Physiol Gastrointest Liver Physiol 289: G860–G869, 2005.[Abstract/Free Full Text]
  16. Cheng L, Cao W, Fiocchi C, Behar J, Biancani P, and Harnett KM. Platelet-activating factor and prostaglandin E2 impair esophageal ACh release in experimental esophagitis. Am J Physiol Gastrointest Liver Physiol 289: G418–G428, 2005.[Abstract/Free Full Text]
  17. Cheng L, Harnett KM, Cao W, Liu F, Behar J, Fiocchi C, and Biancani P. Hydrogen peroxide reduces lower esophageal sphincter tone in human esophagitis. Gastroenterology 129: 1675–1685, 2005.[CrossRef][Web of Science][Medline]
  18. Dupre DJ, Le Gouill C, Rola-Pleszczynski M, and Stankova J. Inverse agonist activity of selected ligands of platelet-activating factor receptor. J Pharmacol Exp Ther 299: 358–365, 2001.[Abstract/Free Full Text]
  19. Foubert TR, Burritt JB, Taylor RM, and Jesaitis AJ. Structural changes are induced in human neutrophil cytochrome b by NADPH oxidase activators, LDS, SDS, and arachidonate: intermolecular resonance energy transfer between trisulfopyrenyl-wheat germ agglutinin and cytochrome b(558). Biochim Biophys Acta 1567: 221–231, 2002.[Medline]
  20. Gaumond F, Fortin D, Stankova J, and Rola-Pleszczynski M. Differential signaling pathways in platelet-activating factor-induced proliferation and interleukin-6 production by rat vascular smooth muscle cells. J Cardiovasc Pharmacol 30: 169–175, 1997.[CrossRef][Web of Science][Medline]
  21. Haddad JJ. Redox regulation of pro-inflammatory cytokines and I{kappa}B-{alpha}/NF{kappa}B nuclear translocation and activation. Biochem Biophys Res Commun 296: 847–856, 2002.[CrossRef][Web of Science][Medline]
  22. Hart BA and Simons JM. Metabolic activation of phenols by stimulated neutrophils: a concept for a selective type of anti-inflammatory drug. Biotechnol Ther 3: 119–135, 1992.[Medline]
  23. Heinrich PC, Behrmann I, Haan S, Hermanns HM, Muller-Newen G, and Schaper F. Principles of interleukin (IL)-6-type cytokine signalling and its regulation. Biochem J 374: 1–20, 2003.[CrossRef][Web of Science][Medline]
  24. Honda Z, Ishii S, and Shimizu T. Platelet-activating factor receptor. J Biochem (Tokyo) 131: 773–779, 2002.[Abstract/Free Full Text]
  25. Honda Z, Takano T, Gotoh Y, Nishida E, Ito K, and Shimizu T. Transfected platelet-activating factor receptor activates mitogen-activated protein (MAP) kinase and MAP kinase kinase in Chinese hamster ovary cells. J Biol Chem 269: 2307–2315, 1994.[Abstract/Free Full Text]
  26. Hwang YS, Jeong M, Park JS, Kim MH, Lee DB, Shin BA, Mukaida N, Ellis LM, Kim HR, Ahn BW, and Jung YD. Interleukin-1beta stimulates IL-8 expression through MAP kinase and ROS signaling in human gastric carcinoma cells. Oncogene 23: 6603–6611, 2004.[CrossRef][Web of Science][Medline]
  27. Ishii S and Shimizu T. Platelet-activating factor (PAF) receptor and genetically engineered PAF receptor mutant mice. Prog Lipid Res 39: 41–82, 2000.[CrossRef][Web of Science][Medline]
  28. Kerkhoff C, Nacken W, Benedyk M, Dagher MC, Sopalla C, and Doussiere J. The arachidonic acid-binding protein S100A8/A9 promotes NADPH oxidase activation by interaction with p67phox and Rac-2. Faseb J, 2005.
  29. Kosmidou I, Vassilakopoulos T, Xagorari A, Zakynthinos S, Papapetropoulos A, and Roussos C. Production of interleukin-6 by skeletal myotubes: role of reactive oxygen species. Am J Respir Cell Mol Biol 26: 587–593, 2002.[Abstract/Free Full Text]
  30. Kuruvilla A, Putcha G, Poulos E, and Shearer WT. Tyrosine phosphorylation of phospholipase C concomitant with its activation by platelet-activating factor in a human B cell line. J Immunol 151: 637–648, 1993.[Abstract]
  31. Lacasse C, Turcotte S, Gingras D, Stankova J, and Rola-Pleszczynski M. Platelet-activating factor stimulates interleukin-6 production by human endothelial cells and synergizes with tumor necrosis factor for enhanced production of granulocyte-macrophage colony stimulating factor. Inflammation 21: 145–158, 1997.[CrossRef][Web of Science][Medline]
  32. Lambeth JD. NOX enzymes and the biology of reactive oxygen. Nat Rev Immunol 4: 181–189, 2004.[CrossRef][Web of Science][Medline]
  33. Lindstrom TM and Bennett PR. 15-Deoxy-{Delta}12,14-prostaglandin j2 inhibits interleukin-1beta-induced nuclear factor-{kappa}b in human amnion and myometrial cells: mechanisms and implications. J Clin Endocrinol Metab 90: 3534–3543, 2005.[Abstract/Free Full Text]
  34. Liu B, Nakashima S, Kanoh H, Takano T, Shimizu T, and Nozawa Y. Activation of phospholipase D in Chinese hamster ovary cells expressing platelet-activating factor receptor. J Biochem (Tokyo) 116: 882–891, 1994.[Abstract/Free Full Text]
  35. Lo YY, Conquer JA, Grinstein S, and Cruz TF. Interleukin-1beta induction of c-fos and collagenase expression in articular chondrocytes: involvement of reactive oxygen species. J Cell Biochem 69: 19–29, 1998.[CrossRef][Web of Science][Medline]
  36. Lukashova V, Asselin C, Krolewski JJ, Rola-Pleszczynski M, and Stankova J. G-protein-independent activation of Tyk2 by the platelet-activating factor receptor. J Biol Chem 276: 24113–24121, 2001.[Abstract/Free Full Text]
  37. Mendes AF, Caramona MM, Carvalho AP, and Lopes MC. Hydrogen peroxide mediates interleukin-1beta-induced AP-1 activation in articular chondrocytes: implications for the regulation of iNOS expression. Cell Biol Toxicol 19: 203–214, 2003.[CrossRef][Web of Science][Medline]
  38. Nasu K, Narahara H, Matsui N, Kawano Y, Tanaka Y, and Miyakawa I. Platelet-activating factor stimulates cytokine production by human endometrial stromal cells. Mol Hum Reprod 5: 548–553, 1999.[Abstract/Free Full Text]
  39. Nauseef WM. The NADPH-dependent oxidase of phagocytes. Proc Assoc Am Physicians 111: 373–382, 1999.[Web of Science][Medline]
  40. Ndengele MM, Muscoli C, Wang ZQ, Doyle TM, Matuschak GM, and Salvemini D. Superoxide potentiates NF{kappa}B activation and modulates endotoxin-induced cytokine production in alveolar macrophages. Shock 23: 186–193, 2005.[CrossRef][Web of Science][Medline]
  41. Pei Y, Barber LA, Murphy RC, Johnson CA, Kelley SW, Dy LC, Fertel RH, Nguyen TM, Williams DA, and Travers JB. Activation of the epidermal platelet-activating factor receptor results in cytokine and cyclooxygenase-2 biosynthesis. J Immunol 161: 1954–1961, 1998.[Abstract/Free Full Text]
  42. Prescott SM, Zimmerman GA, and McIntyre TM. Platelet-activating factor. J Biol Chem 265: 17381–17384, 1990.[Free Full Text]
  43. Roth M, Nauck M, Yousefi S, Tamm M, Blaser K, Perruchoud AP, and Simon HU. Platelet-activating factor exerts mitogenic activity and stimulates expression of interleukin 6 and interleukin 8 in human lung fibroblasts via binding to its functional receptor. J Exp Med 184: 191–201, 1996.[Abstract/Free Full Text]
  44. Roy D, Sarkar S, and Felty Q. Levels of IL-1beta control stimulatory/inhibitory growth of cancer cells. Front Biosci 11: 889–898, 2006.[Web of Science][Medline]
  45. Sano M, Fukuda K, Sato T, Kawaguchi H, Suematsu M, Matsuda S, Koyasu S, Matsui H, Yamauchi-Takihara K, Harada M, Saito Y, and Ogawa S. ERK and p38 MAPK, but not NF{kappa}B, are critically involved in reactive oxygen species-mediated induction of IL-6 by angiotensin II in cardiac fibroblasts. Circ Res 89: 661–669, 2001.[Abstract/Free Full Text]
  46. Shi C, Zhao X, Wang X, and Andersson R. Role of nuclear factor-{kappa}B, reactive oxygen species and cellular signaling in the early phase of acute pancreatitis. Scand J Gastroenterol 40: 103–108, 2005.[CrossRef][Web of Science][Medline]
  47. Stafforini DM, McIntyre TM, Zimmerman GA, and Prescott SM. Platelet-activating factor, a pleiotrophic mediator of physiological and pathological processes. Crit Rev Clin Lab Sci 40: 643–672, 2003.[Web of Science][Medline]
  48. Stolk J, Hiltermann TJ, Dijkman JH, and Verhoeven AJ. Characteristics of the inhibition of NADPH oxidase activation in neutrophils by apocynin, a methoxy-substituted catechol. Am J Respir Cell Mol Biol 11: 95–102, 1994.[Abstract]
  49. Sugano T, Narahara H, Nasu K, Arima K, Fujisawa K, and Miyakawa I. Effects of platelet-activating factor on cytokine production by human uterine cervical fibroblasts. Mol Hum Reprod 7: 475–481, 2001.[Abstract/Free Full Text]
  50. Suh YA, Arnold RS, Lassegue B, Shi J, Xu X, Sorescu D, Chung AB, Griendling KK, and Lambeth JD. Cell transformation by the superoxide-generating oxidase Mox1. Nature 401: 79–82, 1999.[CrossRef][Medline]
  51. Sung JY, Hong JH, Kang HS, Choi I, Lim SD, Lee JK, Seok JH, Lee JH, and Hur GM. Methotrexate suppresses the interleukin-6 induced generation of reactive oxygen species in the synoviocytes of rheumatoid arthritis. Immunopharmacology 47: 35–44, 2000.[CrossRef][Web of Science][Medline]
  52. Takada Y, Mukhopadhyay A, Kundu GC, Mahabeleshwar GH, Singh S, and Aggarwal BB. Hydrogen peroxide activates NF{kappa}B through tyrosine phosphorylation of I{kappa}B{alpha} and serine phosphorylation of p65: evidence for the involvement of I{kappa}B{alpha} kinase and Syk protein-tyrosine kinase. J Biol Chem 278: 24233–24241, 2003.[Abstract/Free Full Text]
  53. Tamm M, Bihl M, Eickelberg O, Stulz P, Perruchoud AP, and Roth M. Hypoxia-induced interleukin-6 and interleukin-8 production is mediated by platelet-activating factor and platelet-derived growth factor in primary human lung cells. Am J Respir Cell Mol Biol 19: 653–661, 1998.[Abstract/Free Full Text]
  54. Wassmann S, Stumpf M, Strehlow K, Schmid A, Schieffer B, Bohm M, and Nickenig G. Interleukin-6 induces oxidative stress and endothelial dysfunction by overexpression of the angiotensin II type 1 receptor. Circ Res 94: 534–541, 2004.[Abstract/Free Full Text]
  55. Yu JH, Lim JW, Kim H, and Kim KH. NADPH oxidase mediates interleukin-6 expression in cerulein-stimulated pancreatic acinar cells. Int J Biochem Cell Biol 37: 1458–1469, 2005.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
L. Cheng, S. de la Monte, J. Ma, J. Hong, M. Tong, W. Cao, J. Behar, P. Biancani, and K. M. Harnett
HCl-activated neural and epithelial vanilloid receptors (TRPV1) in cat esophageal mucosa
Am J Physiol Gastrointest Liver Physiol, July 1, 2009; 297(1): G135 - G143.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
W. Cao, L. Cheng, J. Behar, P. Biancani, and K. M. Harnett
IL-1beta signaling in cat lower esophageal sphincter circular muscle
Am J Physiol Gastrointest Liver Physiol, October 1, 2006; 291(4): G672 - G680.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
290/6/G1307    most recent
00576.2005v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cheng, L.
Right arrow Articles by Harnett, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cheng, L.
Right arrow Articles by Harnett, K. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.