AJP - GI Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 291: G851-G856, 2006. First published June 1, 2006; doi:10.1152/ajpgi.00171.2006
0193-1857/06 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/5/G851    most recent
00171.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shimakura, J.
Right arrow Articles by Inui, K.-i.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shimakura, J.
Right arrow Articles by Inui, K.-i.

HORMONES AND SIGNALING

Induction of intestinal peptide transporter 1 expression during fasting is mediated via peroxisome proliferator-activated receptor {alpha}

Jin Shimakura, Tomohiro Terada, Hirofumi Saito, Toshiya Katsura, and Ken-ichi Inui

Department of Pharmacy, Kyoto University Hospital, Faculty of Medicine, Kyoto University, Kyoto, Japan

Submitted 26 April 2006 ; accepted in final form 19 May 2006


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We previously demonstrated that starvation markedly increased the amount of mRNA and protein levels of the intestinal H+/peptide cotransporter (PEPT1) in rats, leading to altered pharmacokinetics of the PEPT1 substrates. In the present study, the mechanism underlying this augmentation was investigated. We focused on peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}), which plays a pivotal role in the adaptive response to fasting in the liver and other tissues. In 48-h fasted rats, the expression level of PPAR{alpha} mRNA in the small intestine markedly increased, accompanied by the elevation of serum free fatty acids, which are endogenous PPAR{alpha} ligands. Oral administration of the synthetic PPAR{alpha} ligand WY-14643 to fed rats increased the mRNA level of intestinal PEPT1. Furthermore, treatment of the human intestinal model, Caco-2 cells, with WY-14643 resulted in enhanced PEPT1 mRNA expression and uptake activity of glycylsarcosine. In the small intestine of PPAR{alpha}-null mice, augmentation of PEPT1 mRNA during fasting was completely abolished. In the kidney, fasting did not induce PEPT1 expression in either PPAR{alpha}-null or wild-type mice. Together, these results indicate that PPAR{alpha} plays critical roles in fasting-induced intestinal PEPT1 expression. In addition to the well-established roles of PPAR{alpha}, we propose a novel function of PPAR{alpha} in the small intestine, that is, the regulation of nitrogen absorption through PEPT1 during fasting.

Caco-2; SLC15A1; starvation; glycylsarcosine; small intestine


DIETARY PROTEINS ARE DEGRADED into a mixture of free amino acids and small peptides. A large number of studies have provided evidence that the absorption of protein digestion products in the small intestine occurs primarily in the form of small peptides rather than amino acids (22). Thus intestinal peptide transport is of major nutritional significance for the effective absorption of dietary amino nitrogen. Cellular uptake of di- and tripeptides is mediated via H+-coupled peptide cotransporter 1 (PEPT1, SLC15A1), which is primarily expressed in the small intestine and slightly in the kidney (5). Because of its broad substrate specificity, PEPT1 can accept several peptidelike drugs such as oral beta-lactam antibiotics (39) and plays important roles not only as a nutrient transporter but also as a drug transporter. A large number of functional studies using heterologous expression systems have demonstrated the molecular nature of its transport characteristics (6, 15, 20, 24). Furthermore, many studies have also been directed toward the regulation of PEPT1. For example, it has been reported that intestinal PEPT1 is regulated by various factors (1), including dietary conditions (28, 35, 42), hormones [insulin (10), thyroid hormone (2)], epidermal growth factor (27), some pharmacological agents (3, 9), and diurnal rhythm (29).

Among these factors, the dietary regulation of intestinal PEPT1 has been extensively investigated (14, 26, 28, 30, 31, 35, 42). It has been reported that short-term starvation markedly increased the amount of PEPT1 mRNA and protein expression (14, 30, 42) and uptake activity of dipeptides (42). The induction of PEPT1 expression might be an adaptive response against fasting for efficient absorption immediately after food is given again. This fasting-induced expression of PEPT1 altered the pharmacokinetic profiles of some drugs. Fasting increased the transport of the beta-lactam antibiotic cefadroxil in an in situ loop experiment (26) and also increased pharmacokinetic parameters such as maximum plasma concentration and area under the plasma concentration-time curve of the beta-lactam antibiotic ceftibuten in vivo (30).

Although these studies demonstrated the functional aspects of PEPT1 augmentation, the regulatory mechanisms remain to be clarified. In the present study, we assume that some metabolic signals direct this regulation. In the liver, an adaptive response to fasting has been well characterized (43). During fasting, lipolysis of stored triglycerides in adipose tissue is strongly activated, resulting in marked increase in plasma free fatty acid level. The released fatty acids are delivered to the liver, where they undergo beta-oxidation for energy production. The peroxisome proliferator-activated receptors (PPAR{alpha}, -beta/{delta}, and -{gamma}) are a family of nuclear receptors activated by fatty acid ligands (7, 12). PPAR{alpha} acts as a nutritional state sensor and plays a pivotal role in the control of this adaptive response (16, 21) by inducing the transcription of genes such as the peroxisomal and mitochondrial beta-oxidation pathways. Accordingly, PPAR{alpha} is principally expressed in organs with a high capacity for fatty acid oxidation, such as heart, skeletal muscle, liver, and kidney. However, PPAR{alpha} is also expressed in the small intestine (7) and is increased by fasting (8). This raises the possibility that PPAR{alpha} might be responsible for the augmentation of PEPT1 during fasting. In the present study, we have investigated this possibility by examining PPAR{alpha} activation through synthetic ligand and expression profiles of intestinal PEPT1 in fed and fasted PPAR{alpha}-null mice.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials. WY-14643 was purchased from Cayman Chemical (Ann Arbor, MI). Pioglitazone and GW-501516 were purchased from Alexis Biochemicals (Lausen, Switzerland) and Calbiochem (Darmstadt, Germany), respectively. [3H]glycylsarcosine ([3H]Gly-Sar; 18.5 GBq/mmol) was obtained from Moravek Biochemicals (Brea, CA). All other chemicals used were of the highest purity available.

Cell culture, treatment with PPAR ligands, and uptake study. Caco-2 cells were obtained from the American Type Culture Collection (ATCC CRL-1392) and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 1% nonessential amino acids. Caco-2 cells were plated into 24-well plates (day 1) and, 2 or 9 days later, treated with the PPAR ligand WY-14643, pioglitazone, GW-501516, or DMSO (0.1%, as a control) for 24 h. The uptake experiment using [3H]Gly-Sar with Caco-2 cells in a 24-well plate after WY-14643 treatment was performed according to our previous studies (38, 40).

Animal studies. Animal studies were performed in accordance with the Guidelines for Animal Experiments of Kyoto University. All protocols were previously approved by the Animal Research Committee, Graduate School of Medicine, Kyoto University (MedKyo 05189). Male Wistar rats (8 wk old) were obtained from Japan SLC. Male PPAR{alpha}-null mice (B6.129S4-Ppar{alpha}tm1Gonz N12) and wild-type mice (C57BL/6) (8 wk old) were purchased from Taconic (Germantown, NY). The animals were fed a normal chow ad libitum except for the fasting experiments. In all experiments, the animals had free access to water. For determination of the effects of fasting, food was removed from cages 48 h before the animals were killed. For determination of the effect of PPAR{alpha} ligand, fed rats were treated with WY-14643 (50 mg·5 ml–1·kg–1·day–1, suspended in 0.5% methyl cellulose solution) or vehicle (5 ml/kg) by oral gavage for 5 days and killed after an additional 24 h. The small intestine (duodenum and upper part of the jejunum) was removed from the rats or mice under anesthesia. The kidney cortex was also removed from mice. The scraped intestinal mucosa and kidney cortex were rapidly frozen in liquid nitrogen for later preparation of total RNA.

Measurement of level of blood glucose and serum free fatty acids. Blood glucose level was quantified with the FreeStyle blood glucose monitoring system (Nipro, Osaka, Japan). Serum free fatty acid level was quantified with an enzymatic colorimetric assay (free fatty acid, Half-micro test; Roche Diagnostics, Penzberg, Germany).

Real-time PCR. Total RNA was isolated from Caco-2 cells, intestinal mucosa of rats and mice, and mice kidney cortex with the RNeasy Mini Kit (Qiagen, Hilden, Germany). Isolated total RNA (250 or 500 ng) was reverse transcribed, and the reaction mixtures were used for real-time PCR. Real-time PCR was performed with an ABI PRISM 7700 (Applied Biosystems, Foster City, CA) in a total volume of 20 µl containing a 2-µl aliquot of cDNA, 0.5 µM forward and reverse primers, 0.1 µM TaqMan probe, and 10 µl of TaqMan Universal PCR Master Mix (Applied Biosystems) under the following conditions: 50 cycles of 95°C for 15 s and 60°C for 60 s. The forward and reverse primers for mouse PEPT1 were 5'-CGTGCACGTAGCACTGTCCAT-3' (positions 388–408) and 5'-GGCTTGATTCCTCCTGTACCA-3'(positions 433–453), respectively. The forward and reverse primers for rat PEPT1 were 5'-TGCACGTAGCACTGTCCATGA-3' (positions 359–379) and 5'-CAGGGCTTGATTCCTCCTGTAC-3' (positions 425–404), respectively. The sequence of the TaqMan probe was 5'-(6-FAM)TTGGCCTGGCCCTGATAGCCC(TAMRA)-3', corresponding to positions 411–432 for mice, and 5'-(6-FAM)CGGCCTGGCCCTGATAGCCCT(TAMRA)-3', corresponding to positions 381–404 for rats. The primer probe sets used for human PEPT1 (41) and rat Na+-glucose cotransporter 1 (SGLT1) (13) were previously designed. The primer probe sets used for mouse and rat PPAR{alpha}, mouse acyl-CoA oxidase (ACOX), rat Sp1, and rat Cdx2 were predeveloped TaqMan Assay Reagents (Applied Biosystems). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA was also measured as an internal control with GAPDH Control Reagent (Applied Biosystems).

Data analysis. Data are expressed as means ± SE. The statistical significance of differences between the groups was analyzed with one-way ANOVA followed by Scheffé F post hoc testing in the experiment using Caco-2 cells and multiple concentrations of WY-14643 as a ligand. In other experiments, the nonpaired t-test was used. Two or three experiments were conducted, and representative results are shown.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Fasting-induced expression of intestinal PEPT1 is accompanied by increased mRNA level of PPAR{alpha} in rats. In general, energy depletion by fasting causes a shift in whole body fuel utilization from glucose and fat in the fed state to almost exclusively fat. Under our experimental conditions, 48-h fasting led to reductions in body weight and blood glucose level and dramatic increment in serum free fatty acid level, reflecting the metabolic switching mentioned above (Fig. 1). Under this condition, we determined mRNA levels of intestinal PEPT1 and PPAR{alpha} (Fig. 2). The transcription factor Sp1 and caudal-related homeobox protein Cdx2 were also measured because we recently demonstrated that PEPT1 is transcriptionally regulated by Sp1 and Cdx2 (33, 34). As expected, fasting significantly induced mRNA levels of PEPT1, consistent with our previous result (30). The expression level of PPAR{alpha} was increased to twofold by fasting, whereas the increments in Sp1 and Cdx2 were smaller than that in PPAR{alpha}.


Figure 1
View larger version (9K):
[in this window]
[in a new window]
 
Fig. 1. Effects of fasting on body weight (A), blood glucose (B), and serum free fatty acids (C) in rats. Blood glucose and serum free fatty acid levels in 48-h fasted or fed rats were determined as described in MATERIALS AND METHODS. Data are means ± SE for 5 rats. **Significantly different from fed rats (P < 0.01).

 

Figure 2
View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2. Effects of fasting on mRNA levels of peptide cotransporter 1 (PEPT1), peroxisome proliferator-activated receptor (PPAR){alpha}, Sp1, and Cdx2 in rat small intestine. Total RNA was isolated from the small intestine of 48-h fasted or fed rats, transcribed to cDNA, and subjected to real-time PCR analysis. The results corrected by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) levels are means ± SE for 5 rats. **Significantly different from fed rats (P < 0.01).

 
Expression of PEPT1 mRNA is induced by PPAR{alpha} ligand WY-14643 in Caco-2 cells. To assess the potential involvement of PPAR{alpha} in PEPT1 expression, we treated an intestinal model system, Caco-2 cells just before and after confluence, for 24 h with the PPAR{alpha} ligand WY-14643 and measured the expression levels of PEPT1 mRNA and the activity of [3H]Gly-Sar uptake (Fig. 3). PEPT1 mRNA expression levels and the activity of [3H]Gly-Sar uptake were significantly increased in response to WY-14643 in the cells of both stages. Thus it was suggested that the induction of PEPT1 mRNA by WY-14643 led to a concomitant increase of the transport function. Next, Caco-2 cells were treated with the PPAR{alpha} ligand WY-14643 and increasing concentrations of the PPAR{gamma} ligand pioglitazone and the PPARbeta/{delta} ligand GW-501516 (Fig. 4). The activity of [3H]Gly-Sar uptake increased only when PPAR{alpha} ligand WY-14643 was administered.


Figure 3
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 3. Expression of PEPT1 mRNA and [3H]glycylsarcosine ([3H]Gly-Sar) uptake in Caco-2 cells treated with WY-14643. Twenty-four hours after WY-14643 treatment, Caco-2 cells were subjected to total RNA isolation or [3H]Gly-Sar uptake experiment on day 4 and day 11. The concentrations of WY-14643 were set to 100 and 200 µM on day 4 and 200 µM on day 11. Total RNA was transcribed to cDNA and subjected to real-time PCR analysis. For the uptake experiment, Caco-2 cells were incubated with 25 µM [3H]Gly-Sar for 15 min at 37°C. Data are means ± SE for 3 monolayers. Data of mRNA analysis are corrected by GAPDH levels. **Significantly different from control (0.1% DMSO) (P < 0.01).

 

Figure 4
View larger version (12K):
[in this window]
[in a new window]
 
Fig. 4. [3H]Gly-Sar uptake in Caco-2 cells treated with PPAR ligands for 24 h. WY-14643, pioglitazone, and GW-501516 were used as the ligands for PPAR{alpha}, -{gamma}, and -beta/{delta}, respectively. The day after treatment (day 4), Caco-2 cells were incubated with 25 µM [3H]Gly-Sar for 15 min at 37°C. Data are means ± SE for 3 monolayers. **Significantly different from control (0.1% DMSO) (P < 0.01).

 
Effect of WY-14643 on expression levels of intestinal PEPT1 mRNA in rats. We subsequently administered WY-14643 (50 mg/kg) orally to fed rats for 5 days to examine the effect of PPAR{alpha} ligand on PEPT1 expression in vivo. For comparison, the mRNA levels of SGLT1 were also determined. SGLT1 is expressed at the brush-border membranes of intestinal epithelial cells (11) as PEPT1 but is reported to show no significant change in its expression level during fasting (14). As expected, mRNA levels of PEPT1 were significantly increased by WY-14643, whereas those of SGLT1 were not changed (Fig. 5).


Figure 5
View larger version (11K):
[in this window]
[in a new window]
 
Fig. 5. mRNA levels of PEPT1, Na+-glucose cotransporter (SGLT)1, and GAPDH in the small intestine of rats dosed with WY-14643 (50 mg/kg) for 5 days. Total RNA was isolated from the small intestine, transcribed to cDNA, and subjected to real-time PCR analysis. Data are means ± SE for 3 rats. *Significantly different from control (P < 0.05).

 
Effect of fasting on expression levels of intestinal PEPT1 in PPAR{alpha}-null mice. To confirm the contribution of PPAR{alpha} to fasting-induced PEPT1 expression, we measured mRNA levels of PEPT1 in the small intestine of wild-type and PPAR{alpha}-null mice (Fig. 6). Fasting induced the expression of PEPT1 and PPAR{alpha} in wild-type mice as in rats, although the induction of PPAR{alpha} was not statistically significant. In contrast, this fasting response of PEPT1 was completely abolished in PPAR{alpha}-null mice, indicating the critical role of PPAR{alpha} in this response.


Figure 6
View larger version (8K):
[in this window]
[in a new window]
 
Fig. 6. mRNA levels of PEPT1 and PPAR{alpha} in the small intestine of fasted or fed wild-type (+/+) and PPAR{alpha}-null (–/–) mice. Total RNA was isolated from the small intestine of 48-h fasted or fed mice, transcribed to cDNA, and subjected to real-time PCR analysis. Data corrected by GAPDH levels are means ± SE for 6 mice. *Significantly different from fed mice of the same genotype (P < 0.05).

 
Effect of fasting on expression levels of renal PEPT1 in PPAR{alpha}-null mice. PEPT1 is also expressed in the kidney, although its expression level is much lower than that in the small intestine. Thus we investigated the effect of fasting on expression levels of PEPT1 and PPAR{alpha} in the kidney (Fig. 7). For comparison, mRNA levels of ACOX, which is a peroxisomal beta-oxidation enzyme and a representative PPAR{alpha} target gene, were simultaneously determined. In contrast to the intestine, renal PEPT1 was not induced by fasting in either wild-type or PPAR{alpha}-null mice, which is in agreement with our previous result in rats (30). ACOX expression was markedly enhanced, although the PPAR{alpha} level did not show significant elevation. These results suggested that the lack of fasting-induced response of renal PEPT1 was not due to insufficient levels of endogenous ligands or PPAR{alpha}.


Figure 7
View larger version (14K):
[in this window]
[in a new window]
 
Fig. 7. mRNA levels of PEPT1, PPAR{alpha}, and PPAR{alpha} target gene acyl-CoA oxidase (ACOX) in the kidney of fasted or fed wild-type and PPAR{alpha}-null mice. Total RNA was isolated from the kidney cortex of 48-h fasted or fed mice, transcribed to cDNA, and subjected to real-time PCR analysis. Data corrected by GAPDH levels are means ± SE for 6 mice. **Significantly different from fed mice of the same genotype (P < 0.01).

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
In the present study, we investigated the regulatory mechanism underlying the augmentation of intestinal PEPT1 in fasting. In agreement with previous results (4, 8), it was confirmed that the serum concentration of free fatty acids and the expression level of intestinal PPAR{alpha} mRNA were increased under our experimental condition. We showed that PPAR{alpha} played a critical role in the augmentation of intestinal PEPT1 as a fasting response mainly through PPAR{alpha}-null mice. In support of the knockout mouse data, we used Caco-2 cells to show that the PPAR{alpha} ligand WY-14643 upregulated PEPT1, because Caco-2 cells expressed endogenous PPAR{alpha} (data not shown). Several studies have used Caco-2 cells as an intestinal model for activating PPAR target genes by synthetic PPAR{alpha} ligands (19, 32, 37). Furthermore, the effect of WY-14643 on PEPT1 expression was also observed in vivo in rats. These findings led us to speculate that elevated free fatty acids serve as a metabolic signal and activate intestinal PPAR{alpha}, resulting in the augmentation of PEPT1 in an adaptive response to fasting.

With regard to the roles of PPAR{alpha} in the small intestine, there are several studies. PPAR{alpha} is reported to be involved in lipid absorption through regulation of fatty acid binding protein (7). In addition, PPAR{alpha} influences cholesterol absorption through modulation of ATP binding cassette transporter A1 activity in the intestine (18). PPAR{alpha} also regulates other intestinal genes such as CYP1A1 (32), bile acid binding protein (19), retinol-binding protein (37), and 17beta-hydroxysterol dehydrogenase type 11 (25). The presented function of PPAR{alpha}, i.e., augmentation of PEPT1, is quite different from those previously demonstrated from the point of view that peptide absorption was implicated as a target. In fasting, sloughing of mucosal cells into the intestinal lumen is observed (23), resulting in atrophy of mucosa and decreased mucosal weight. It may be possible to speculate that increased PEPT1 minimizes the loss of nitrogen by efficient absorption of small peptides derived from sloughing cells or secreted hormones. Furthermore, induced PEPT1 will lead to efficient absorption of peptides immediately after food is given again. It has also been reported that PPAR{alpha} downregulates the hepatic genes involved in amino acid metabolism, leading to an overall decrease of amino acid degradation (17). It seems reasonable to suppose that PPAR{alpha} functions to minimize the loss of body amino acids both by suppressing amino acid degradation and by increasing peptide absorption during fasting.

In contrast to the small intestine, no PEPT1 induction was observed in the kidney, suggesting different regulatory mechanisms for PEPT1 between them. This cannot be explained solely by the lack of activation of renal PPAR{alpha}, because the expression of the representative PPAR{alpha} target gene, ACOX, was markedly increased. PPAR{alpha} and free fatty acids may be necessary but not sufficient for the induction of renal PEPT1.

In our previous and present study, the fasting response of PEPT1 was discussed mainly from the findings obtained in rats or mice. In humans, WY-14643 induced the expression of PEPT1 in a human intestinal cell line, Caco-2. This result, together with the fact that plasma free fatty acids are also increased during fasting in humans (36), suggested that a similar regulation of PEPT1 by PPAR{alpha} might exist also in humans. To test the possibility that PPAR{alpha} directly regulates the human PEPT1 promoter, we searched for the potential PPAR response element (PPRE) on the promoter as far as 10 kb upstream of the transcription start site and found several proposed PPREs. However, none of these sites, which were subcloned upstream of the PEPT1 proximal promoter, enhanced basal promoter activity in response to WY-14643 treatment in Caco-2 cells (data not shown). Alternatively, it is possible that PPAR{alpha} stimulates the expression of other transcription factors that regulate PEPT1. mRNA levels of Sp1 and Cdx2 were increased in fasted rats. However, these factors may not be responsible for the augmentation of PEPT1 by PPAR{alpha} because the PEPT1 promoter activity responsive to Sp1 or Cdx2 was not altered by WY-14643 treatment (data not shown). The functional PPRE and/or other regulatory region related to PPAR{alpha} may be located in more distal regions or intronic regions.

The observation that PPAR{alpha} regulates PEPT1 expression raises the question of whether the administration of PPAR{alpha} agonist increases PEPT1 function in the clinical situation. This issue is important from the viewpoint of clinical drug-drug interaction because PPAR{alpha} ligands belonging to the fibrate class have been used widely as hypolipidemic drugs. Oral dosing of WY-14643 in rats resulted in increase of PEPT1 expression. It is unclear whether clinically used PPAR{alpha} ligands affect the expression of human intestinal PEPT1 in vivo. Further studies will be needed to estimate the change in the clinical pharmacokinetics of PEPT1 substrates and the impact on its therapeutic effects.

In conclusion, we demonstrated that PPAR{alpha} plays a critical role in the augmentation of PEPT1 during fasting. We propose a novel function of PPAR{alpha} in the small intestine, that is, the regulation of nitrogen absorption through PEPT1 as an adaptive response to fasting.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This work was supported by the 21st Century Center of Excellence Program "Knowledge Information Infrastructure for Genome Science," a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology of Japan, and a Grant-in-Aid for Research on Advanced Medical Technology from the Ministry of Health, Labor and Welfare of Japan.


    FOOTNOTES
 

Address for reprint requests and other correspondence: K. Inui, Dept. of Pharmacy, Kyoto Univ. Hospital, Sakyo-ku, Kyoto 606-8507, Japan (e-mail: inui{at}kuhp.kyoto-u.ac.jp)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Adibi SA. Regulation of expression of the intestinal oligopeptide transporter (Pept-1) in health and disease. Am J Physiol Gastrointest Liver Physiol 285: G779–G788, 2003.[Abstract/Free Full Text]
  2. Ashida K, Katsura T, Motohashi H, Saito H, and Inui K. Thyroid hormone regulates the activity and expression of the peptide transporter PEPT1 in Caco-2 cells. Am J Physiol Gastrointest Liver Physiol 282: G617–G623, 2002.[Abstract/Free Full Text]
  3. Berlioz F, Maoret JJ, Paris H, Laburthe M, Farinotti R, and Rozé C. {alpha}2-Adrenergic receptors stimulate oligopeptide transport in a human intestinal cell line. J Pharmacol Exp Ther 294: 466–472, 2000.[Abstract/Free Full Text]
  4. Dallman MF, Akana SF, Bhatnagar S, Bell ME, Choi S, Chu A, Horsley C, Levin N, Meijer O, Soriano LR, Strack AM, and Viau V. Starvation: early signals, sensors, and sequelae. Endocrinology 140: 4015–4023, 1999.[Abstract/Free Full Text]
  5. Daniel H. Molecular and integrative physiology of intestinal peptide transport. Annu Rev Physiol 66: 361–384, 2004.[CrossRef][Web of Science][Medline]
  6. Daniel H and Herget M. Cellular and molecular mechanisms of renal peptide transport. Am J Physiol Renal Physiol 273: F1–F8, 1997.[Abstract/Free Full Text]
  7. Desvergne B and Wahli W. Peroxisome proliferator-activated receptors: nuclear control of metabolism. Endocr Rev 20: 649–688, 1999.[Abstract/Free Full Text]
  8. Escher P, Braissant O, Basu-Modak S, Michalik L, Wahli W, and Desvergne B. Rat PPARs: quantitative analysis in adult rat tissues and regulation in fasting and refeeding. Endocrinology 142: 4195–4202, 2001.[Abstract/Free Full Text]
  9. Fujita T, Majikawa Y, Umehisa S, Okada N, Yamamoto A, Ganapathy V, and Leibach FH. {sigma}-Receptor ligand-induced up-regulation of the H+/peptide transporter PEPT1 in the human intestinal cell line Caco-2. Biochem Biophys Res Commun 261: 242–246, 1999.[CrossRef][Web of Science][Medline]
  10. Gangopadhyay A, Thamotharan M, and Adibi SA. Regulation of oligopeptide transporter (Pept-1) in experimental diabetes. Am J Physiol Gastrointest Liver Physiol 283: G133–G138, 2002.[Abstract/Free Full Text]
  11. Hediger MA and Rhoads DB. Molecular physiology of sodium-glucose cotransporters. Physiol Rev 74: 993–1026, 1994.[Free Full Text]
  12. Hihi AK, Michalik L, and Wahli W. PPARs: transcriptional effectors of fatty acids and their derivatives. Cell Mol Life Sci 59: 790–798, 2002.[CrossRef][Web of Science][Medline]
  13. Horiba N, Masuda S, Takeuchi A, Takeuchi D, Okuda M, and Inui K. Cloning and characterization of a novel Na+-dependent glucose transporter (NaGLT1) in rat kidney. J Biol Chem 278: 14669–14676, 2003.[Abstract/Free Full Text]
  14. Ihara T, Tsujikawa T, Fujiyama Y, and Bamba T. Regulation of PepT1 peptide transporter expression in the rat small intestine under malnourished conditions. Digestion 61: 59–67, 2000.[CrossRef][Web of Science][Medline]
  15. Inui K and Terada T. Dipeptide transporters. In: Membrane Transporters as Drug Targets, edited by Amidon GL and Sadée W. New York: Plenum, 1999, p. 269–288.
  16. Kersten S, Seydoux J, Peters JM, Gonzalez FJ, Desvergne B, and Wahli W. Peroxisome proliferator-activated receptor alpha mediates the adaptive response to fasting. J Clin Invest 103: 1489–1498, 1999.[Web of Science][Medline]
  17. Kersten S, Mandard S, Escher P, Gonzalez FJ, Tafuri S, Desvergne B, and Wahli W. The peroxisome proliferator-activated receptor alpha regulates amino acid metabolism. FASEB J 15: 1971–1978, 2001.[Abstract/Free Full Text]
  18. Knight BL, Patel DD, Humphreys SM, Wiggins D, and Gibbons GF. Inhibition of cholesterol absorption associated with a PPAR alpha-dependent increase in ABC binding cassette transporter A1 in mice. J Lipid Res 44: 2049–2058, 2003.[Abstract/Free Full Text]
  19. Landrier JF, Thomas C, Grober J, Zaghini I, Petit V, Poirier H, Niot I, and Besnard P. The gene encoding the human ileal bile acid-binding protein (I-BABP) is regulated by peroxisome proliferator-activated receptors. Biochim Biophys Acta 1735: 41–49, 2005.[Medline]
  20. Leibach FH and Ganapathy V. Peptide transporters in the intestine and the kidney. Annu Rev Nutr 16: 99–119, 1996.[CrossRef][Web of Science][Medline]
  21. Leone TC, Weinheimer CJ, and Kelly DP. A critical role for the peroxisome proliferator-activated receptor {alpha} (PPAR{alpha}) in the cellular fasting response: the PPAR{alpha}-null mouse as a model of fatty acid oxidation disorders. Proc Natl Acad Sci USA 96: 7473–7478, 1999.[Abstract/Free Full Text]
  22. Matthews DM. Intestinal absorption of peptides. Physiol Rev 55: 537–608, 1975.[Free Full Text]
  23. McManus JP and Isselbacher KJ. Effect of fasting versus feeding on the rat small intestine. Morphological, biochemical, and functional differences. Gastroenterology 59: 214–221, 1970.[Web of Science][Medline]
  24. Meredith D and Boyd CA. Structure and function of eukaryotic peptide transporters. Cell Mol Life Sci 57: 754–778, 2000.[CrossRef][Web of Science][Medline]
  25. Motojima K. 17Beta-hydroxysteroid dehydrogenase type 11 is a major peroxisome proliferator-activated receptor alpha-regulated gene in mouse intestine. Eur J Biochem 271: 4141–4146, 2004.[Web of Science][Medline]
  26. Naruhashi K, Sai Y, Tamai I, Suzuki N, and Tsuji A. Pept1 mRNA expression is induced by starvation and its level correlates with absorptive transport of cefadroxil longitudinally in the rat intestine. Pharm Res 19: 1417–1423, 2002.[CrossRef][Web of Science][Medline]
  27. Nielsen CU, Amstrup J, Steffansen B, Frokjaer S, and Brodin B. Epidermal growth factor inhibits glycylsarcosine transport and hPepT1 expression in a human intestinal cell line. Am J Physiol Gastrointest Liver Physiol 281: G191–G199, 2001.[Abstract/Free Full Text]
  28. Ogihara H, Suzuki T, Nagamachi Y, Inui K, and Takata K. Peptide transporter in the rat small intestine: ultrastructural localization and the effect of starvation and administration of amino acids. Histochem J 31: 169–174, 1999.[CrossRef][Web of Science][Medline]
  29. Pan X, Terada T, Irie M, Saito H, and Inui K. Diurnal rhythm of H+-peptide cotransporter in the rat small intestine. Am J Physiol Gastrointest Liver Physiol 283: G57–G64, 2002.[Abstract/Free Full Text]
  30. Pan X, Terada T, Okuda M, and Inui K. Altered diurnal rhythm of intestinal peptide transporter by fasting and its effects on the pharmacokinetics of ceftibuten. J Pharmacol Exp Ther 307: 626–632, 2003.[Abstract/Free Full Text]
  31. Pan X, Terada T, Okuda M, and Inui K. The diurnal rhythm of the intestinal transporters SGLT1 and PEPT1 is regulated by the feeding conditions in rats. J Nutr 134: 2211–2215, 2004.[Abstract/Free Full Text]
  32. Seree E, Villard PH, Pascussi JM, Pineau T, Maurel P, Nguyen QB, Fallone F, Martin PM, Champion S, Lacarelle B, Savouret JF, and Barra Y. Evidence for a new human CYP1A1 regulation pathway involving PPAR-alpha and 2 PPRE sites. Gastroenterology 127: 1436–1445, 2004.[CrossRef][Web of Science][Medline]
  33. Shimakura J, Terada T, Katsura T, and Inui K. Characterization of the human peptide transporter PEPT1 promoter: Sp1 functions as a basal transcriptional regulator of human PEPT1. Am J Physiol Gastrointest Liver Physiol 289: G471–G477, 2005.[Abstract/Free Full Text]
  34. Shimakura J, Terada T, Shimada Y, Katsura T, and Inui K. The transcription factor Cdx2 regulates the intestine-specific expression of human peptide transporter 1 through functional interaction with Sp1. Biochem Pharmacol 71: 1581–1588, 2006.[CrossRef][Web of Science][Medline]
  35. Shiraga T, Miyamoto K, Tanaka H, Yamamoto H, Taketani Y, Morita K, Tamai I, Tsuji A, and Takeda E. Cellular and molecular mechanisms of dietary regulation on rat intestinal H+/peptide transporter PepT1. Gastroenterology 116: 354–362, 1999.[CrossRef][Web of Science][Medline]
  36. Stannard SR, Thompson MW, Fairbairn K, Huard B, Sachinwalla T, and Thompson CH. Fasting for 72 h increases intramyocellular lipid content in nondiabetic, physically fit men. Am J Physiol Endocrinol Metab 283: E1185–E1191, 2002.[Abstract/Free Full Text]
  37. Suruga K, Mochizuki K, Suzuki R, Goda T, and Takase S. Regulation of cellular retinol-binding protein type II gene expression by arachidonic acid analogue and 9-cis retinoic acid in Caco-2 cells. Eur J Biochem 262: 70–78, 1999.[Web of Science][Medline]
  38. Terada T, Saito H, Mukai M, and Inui K. Recognition of beta-lactam antibiotics by rat peptide transporters, PEPT1 and PEPT2, in LLC-PK1 cells. Am J Physiol Renal Physiol 273: F706–F711, 1997.[Abstract/Free Full Text]
  39. Terada T and Inui K. Peptide transporters: structure, function, regulation and application for drug delivery. Curr Drug Metab 5: 85–94, 2004.[CrossRef][Web of Science][Medline]
  40. Terada T, Irie M, Okuda M, and Inui K. Genetic variant Arg57His in human H+/peptide cotransporter 2 causes a complete loss of transport function. Biochem Biophys Res Commun 316: 416–420, 2004.[CrossRef][Web of Science][Medline]
  41. Terada T, Shimada Y, Pan X, Kishimoto K, Sakurai T, Doi R, Onodera H, Katsura T, Imamura M, and Inui K. Expression profiles of various transporters for oligopeptides, amino acids and organic ions along the human digestive tract. Biochem Pharmacol 70: 1756–1763, 2005.[CrossRef][Web of Science][Medline]
  42. Thamotharan M, Bawani SZ, Zhou X, and Adibi SA. Functional and molecular expression of intestinal oligopeptide transporter (Pept-1) after a brief fast. Metabolism 48: 681–684, 1999.[CrossRef][Web of Science][Medline]
  43. Van den Berghe G. The role of the liver in metabolic homeostasis: implications for inborn errors of metabolism. J Inherit Metab Dis 14: 407–420, 1991.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
M. Tsuda, T. Terada, T. Mizuno, T. Katsura, J. Shimakura, and K.-i. Inui
Targeted Disruption of the Multidrug and Toxin Extrusion 1 (Mate1) Gene in Mice Reduces Renal Secretion of Metformin
Mol. Pharmacol., June 1, 2009; 75(6): 1280 - 1286.
[Abstract] [Full Text] [PDF]


Home page
Poult. Sci.Home page
C. R. Mott, P. B. Siegel, K. E. Webb Jr., and E. A. Wong
Gene Expression of Nutrient Transporters in the Small Intestine of Chickens from Lines Divergently Selected for High or Low Juvenile Body Weight
Poult. Sci., November 1, 2008; 87(11): 2215 - 2224.
[Abstract] [Full Text] [PDF]


Home page
J ANIM SCIHome page
E. R. Gilbert, E. A. Wong, and K. E. Webb Jr.
BOARD-INVITED REVIEW: Peptide absorption and utilization: Implications for animal nutrition and health
J Anim Sci, September 1, 2008; 86(9): 2135 - 2155.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
H. Saito, T. Terada, J. Shimakura, T. Katsura, and K.-i. Inui
Regulatory mechanism governing the diurnal rhythm of intestinal H+/peptide cotransporter 1 (PEPT1)
Am J Physiol Gastrointest Liver Physiol, August 1, 2008; 295(2): G395 - G402.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Chen, T. Terada, K. Ogasawara, T. Katsura, and K.-i. Inui
Adaptive responses of renal organic anion transporter 3 (OAT3) during cholestasis
Am J Physiol Renal Physiol, July 1, 2008; 295(1): F247 - F252.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
S. Kalujnaia, I. S. McWilliam, V. A. Zaguinaiko, A. L. Feilen, J. Nicholson, N. Hazon, C. P. Cutler, and G. Cramb
Transcriptomic approach to the study of osmoregulation in the European eel Anguilla anguilla
Physiol Genomics, November 14, 2007; 31(3): 385 - 401.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
291/5/G851    most recent
00171.2006v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (6)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shimakura, J.
Right arrow Articles by Inui, K.-i.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shimakura, J.
Right arrow Articles by Inui, K.-i.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2006 by the American Physiological Society.