Am J Physiol Gastrointest Liver Physiol 292: G215-G222, 2007.
First published August 17, 2006; doi:10.1152/ajpgi.00188.2006
0193-1857/07 $8.00
MUCOSAL BIOLOGY
Rapid expansion of intestinal secretory lineages following a massive small bowel resection in mice
Michael A. Helmrath,1,2
Jerry J. Fong,1
Christopher M. Dekaney,1 and
Susan J. Henning2,3
1Michael E. DeBakey Department of Surgery, Departments of 2Pediatrics and 3Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas
Submitted 3 May 2006
; accepted in final form 14 August 2006
 |
ABSTRACT
|
|---|
Following massive small bowel resection (SBR) in mice, there are sustained increases in crypt depth and villus height, resulting in enhanced mucosal surface area. The early mechanisms responsible for resetting and sustaining this increase are presently not understood. We hypothesized that expansion of secretory lineages is an early and sustained component of the adaptive response. This was assessed in the ileum by quantitative morphometry at 12 h, 36 h, 7 days, and 28 days and by quantitative RT-PCR of marker mRNAs for proliferation and differentiated goblet, Paneth cell, and enterocyte genes at 12 h after 50% SBR or sham operation. As predicted, SBR elicited increases of both crypt and villus epithelial cells, which were sustained though the 28 days of the experiment. Significant increases in the overall number and percentage of both Paneth and goblet cells within intestinal epithelium occurred by 12 h and were sustained up to 28 days after SBR. The increases of goblet cells after SBR were initially observed within villi at 12 h, with marked increases occurring in crypts at 36 h and 7 days. Consistent with this finding, qRT-PCR demonstrated significant increases in the expression of mRNAs associated with proliferation (c-myc) and differentiated goblet cells (Tff3, Muc2) and Paneth cells (lysozyme), whereas mRNA associated with differentiated enterocytes (sucrase-isomaltase) remained unchanged. From these data, we speculate that early expansion of intestinal secretory lineages within the epithelium of the ileum occurs following SBR, possibly serving to amplify the signal responsible for initiating and sustaining intestinal adaptation.
intestinal adaptation; intestinal failure; Paneth cells; goblet cells
INTESTINAL ADAPTATION AFTER small bowel resection (SBR) is a complex process resulting in a marked increase in proliferation to expand the mucosal surface area of the remaining intestine. Animal models evaluating the adaptive response after intestinal resection have demonstrated that sustained increases in crypt depth and villus height are observed, indicating steady-state set points for these parameters are increased after resection (24). However, the cellular mechanisms by which both crypt depth and villus height are reset and sustained after intestinal resection are not well understood. Clinical experience indicates that the adaptive process usually leads to complete and long-lasting functional compensation after modest intestinal loss. However, after massive intestinal loss, the adaptive response is often insufficient, leaving a patient with intestinal failure and the prolonged requirement for administration of parenteral nutrition (PN) to sustain adequate nourishment and fluid balance. In contrast to animal models, studies performed on PN-dependent patients with short-bowel syndrome have not demonstrated sustained increases in mucosal crypt depth or villus height, suggesting either a different adaptive mechanism occurs in humans for expanding mucosal surface area or an insufficient adaptative response has occurred resulting in intestinal failure (37). Previous animal studies have demonstrated the ability of various growth factors (7, 13, 18, 29, 31), luminal nutrients (7, 9, 20), pancreaticobiliary secretions (2, 33), and mesenchymal factors (25) to augment the adaptive response, yet no treatments in animals or humans have demonstrated sustained increases above the baseline parameters of adaptation without continued administration of the given factor. Understanding the mechanisms that allow the remaining intestine to sense the need to reset and maintain a higher rate of epithelial proliferation, producing enhanced mucosal surface area, may give insight essential for the management of patients with intestinal failure.
Intestinal stem cells reside near the base of the crypt, providing immature progeny, which continue to divide as they migrate up the crypt until they differentiate into either intestinal absorptive cells (enterocytes) or secretory lineages (goblet, Paneth, and enteroendocrine cells). Absorptive enterocytes comprise
90% of the cells in the entire epithelium and are responsible for the terminal digestion and absorption of luminal nutrients. The goblet cells are distributed throughout the crypts and villi and produce epithelial-protective mucins, as well as trefoil factor-3 (Tff3), which is ultimately involved in postinjury repair of the small bowel (3). The third cell type is the Paneth cell, which resides at the base of the crypt and is classically believed to have an antimicrobial function in the small intestine (4, 11). The adjacent location of these cells to the intestinal stem cell zone and recent research demonstrating their secretion of cytokines, growth factors, and other products, including soluble Wnt proteins known to regulate proliferation (10, 12, 30), raises the possibility of a potential role for Paneth cells initiating and maintaining the adaptive response. The fourth lineage is the enteroendocrine cells that comprise only 1% of the intestinal epithelium, producing numerous factors that act both locally and systemically, which may also influence epithelial proliferation and differentiation (28). The overall percentage of secretory lineages within the intestinal epithelium gradually increases from proximal to distal, with the greatest percentage being found in the terminal ileum. Interestingly, the adaptive response, as measured by changes in morphological parameters, follows the same pattern, as the distal ileum adapts to a far greater extent following resection than that seen within the proximal jejunum (8, 33, 34).
To date, the effect of SBR on enterocytes has been extensively studied (14); however, the response of intestinal secretory lineages after resection is not well documented. The purpose of this study, therefore, was to determine the effect of resection-induced adaptation on lineage allocation of intestinal secretory cells within the terminal ileum. We hypothesized that expansion of secretory lineages is an early and sustained component of the adaptive response. In addition, further evaluation of mRNAs associated with proliferation (c-myc) and differentiated goblet cells (Tff3, Muc2), Paneth cells (lysozyme) and enterocytes (sucrase-isomaltase) were assessed at the earliest time point (12 h) to confirm expansion of secretory lineages.
 |
METHODS
|
|---|
Animals and experimental design.
The Baylor College of Medicine Institutional Animal Care and Use Committee approved the protocol for this study. Male C57BL/6J mice (weight range 2531 g; Jackson ImmunoResearch Laboratories, Bar Harbor, ME) were housed in groups of 5 at 21°C on 12:12-h dark-light cycle with wood chip bedding and were allowed to acclimate 5 days before being assigned to undergo either a sham operation or 50% SBR. On the basis of previous experience defining the murine model for SBR, the diet was changed from regular chow to a liquid diet (Micro-Stablized Rodent Liquid Diet LAD 101/101A, Purina Mills, St. Louis, MO) 2 days before the operation and maintained for the duration of the experiment to avoid intestinal obstruction of solid food at the anastomosis (14). Animals used as nonoperated controls (n = 5) were similarly acclimated to liquid diet for 2 days before harvesting tissue. All operations were performed under sterile conditions and with the aid of the operating microscope (x7 magnification) using inhaled 2% isofluorane and oxygen (90%) for anesthesia. Through a midline incision, the intestines were eviscerated in all animals, and the ileocecal junction was identified. Sham operations (n = 5 per time point) consisted of division and reanastomosis of the bowel
7 cm proximal to the ileocecal junction (transection only). In mice undergoing SBR (n = 5 per time point), the small bowel was divided 7 cm proximal to the ileocecal junction and 8 cm distal to the ligament of Trietz, and the mesentery of the resected intestine was ligated, resulting in the removal of 15 cm of the intervening small intestine (50% resection). Intestinal continuity was restored using an end-to-end, single-layered anastomosis with interrupted 90 monofilament sutures. Mice were hydrated with 12 ml of warm intraperitoneal saline and the abdomen closed with a running suture. Liquid diet was provided immediately postoperatively, and the mice were maintained on the liquid diet throughout the study.
Mice were euthanized by cervical dislocation, while under 2% isoflurane anesthesia at 12 h, 36 h, 7 days, and 28 days postoperatively. A separate group of mice (n = 5) undergoing sham and SBR also received an intraperitoneal injection of bromodeoxyuridine (BrdU; 120 mg/kg) at the time of operation and were euthanized at 12 h. Intestinal contents were flushed with saline and gently expressed with cotton swabs. The first centimeter proximal and distal to the anastomosis was discarded, the subsequent centimeter proximal (jejunum) and distal (ileum) were fixed with 10% neutral buffered formalin for histological evaluation. The following distal 2 cm (ileum) was frozen in liquid nitrogen and stored at 80°C until RNA was isolated. Tissue from nonoperated mice was harvested in a similar fashion.
Histology.
Formalin-fixed and paraffin-embedded specimens were oriented to provide cut sections perpendicular with the longitudinal axis of the bowel and 5-µm-thick sections mounted on poly-L-lysine slides. Goblet cells were identified using Alcian blue staining with a light eosin counter stain. Paneth cells were identified by lysozyme immunohistochemistry, and enteroendocrine cells were stained using chromogranin A immunohistochemistry, both with light hematoxylin counterstaining. Routine immunohistochemistry was used to determine BrdU incorporation. All histological analyses were performed in a blinded manner. As our goal was to focus on the hyperplastic response of secretory lineages as a percentage of the entire epithelium following SBR, the total number of epithelial cells within entire crypts and along one side of the villi was counted as a measure of adaptation. For each animal, the total number of epithelial cells and lysozyme-positive Paneth cells within 10 intact crypts, in which a single layer of epithelium was identified, were counted to determine the percentage of Paneth cells. Similarly, the total number of epithelial cells and number of Alcian blue-stained goblet cells from the crypt-villus junction up to the tip of 10 villi, in which the central lymphatic vessel and a single layer of epithelium were identified and scored to determine the percentage of goblet cells. Percentage of goblet cells within crypts could not be determined as the absolute number of nuclei associated with enterocytes and goblet cells was obscured by the marked numbers of Alcian blue-stained cells throughout the crypts after SBR at 36 h and 7 days. To overcome this difficulty, only the total number of Alcian blue cells was determined within crypts. The low frequency of enteroendocrine cells detected within intact crypts and villi, as determined by chromograinin A staining precluded quantitative analysis.
RNA isolation and quantitative RT-PCR.
Total RNA was isolated using a guanidine isothiocyanate/cesium chloride method (19, 23). All RNA samples were DNase treated using the Turbo DNA-free kit (Ambion, Austin, TX) following instructions of the manufacturer. Quantitative real-time PCR was performed using Applied Biosystems 7500 Real-Time PCR System and Taqman One-step RT-PCR Master Mix Reagents Kit (Applied Biosystems, Foster City, CA), according to manufacturer's instructions. Primer and probe sets for c-myc (Assay ID Mm00487803_m1), lysozyme (Mm00727183_s1), Muc2 (Mm00458299_m1), Tff3 (Mm00495590_m1), Math1 (Mm00476035_s1), Hes1 (Mm00468601_m1), and
-actin (Mm00607939_s1) were purchased from Applied Biosystems Taqman Gene Expression/Assay on Demand sets (Applied Biosystems). Primer and probe sequences for sucrase-isomaltase (accession no. XM_143332) were forward primer TTCAAGAAATCACAACATTCAATTTACTAG; reverse primer CTAAAACTTTCTTTGACATTTGAGCAA; and probe AGGCAAGATCCTGTTTCCTGGAATGAAACT. Samples from each tissue were analyzed in triplicate. Data were analyzed using the 
Ct method with
-actin mRNA as the constitutive marker (1, 27). Pooled RNA from nonoperated intact terminal ileum harvested 57 cm proximal to the cecum from 5 adult C57BL/6J mice was used as the reference.
Statistical analyses.
All quantitative results are presented as means ± SE. For the morphometry data, the analyses were based on the assumption that the 10 crypts used for counting the Paneth cells, and the 10 villi used for counting the goblet cells were selected at random. For each animal the 10 observed crypt and villus counts were collapsed into an average value. The average values were used to generate means ± SE (n = 5) and were compared among the three groups (nonoperated, sham, SBR) at each time point using ANOVA with correction for multiple comparisons using the Tukey's procedure. Two-way ANOVAs were conducted with repeated measures to investigate the effect of treatment, time, and the interaction of treatment and time on cell means. These analyses did not include the control group as control data were available for only one time point. The t-test was used to compare the gene expression between groups for each gene. For all parameters, P < 0.05 was considered the level of significance.
 |
RESULTS
|
|---|
Qualitative overview.
Postoperative survival after SBR was 90% based on data from all time points studied. All surviving mice used for the study were healthy and vigorous throughout the experiment. Representative histological sections from ileums of SBR mice demonstrate the well-described robust adaptive changes in both crypts and villi compared with sham-operated animals (Fig. 1). In addition, histological sections from unoperated controls maintained on liquid diet for 48 h were used to evaluate the overall operative effect (both sham and SBR) on secretory lineages. Early increases in the overall number of goblet cells within villi, as assessed by Alcian blue staining, are appreciated in SBR compared with sham animals 12 h postoperation (Fig. 1A). Whereas early increased staining occurred following resection within the upper villus at 12 h, a different staining pattern involving significant increases in the overall number of Alcian blue-positive cells throughout the crypt is seen at 36 h and 7 days yet returns to the original distribution pattern, although with increased staining of goblet cells at 28 days in SBR vs. sham-operated animals. Representative high-power images of Alcian blue-stained sections comparing sham and SBR 7 days after resection clearly demonstrate the increased staining pattern of goblet cells throughout crypts (Fig. 2).

View larger version (118K):
[in this window]
[in a new window]
|
Fig. 1. Photomicrographs of histological sections taken from the distal ileum of unoperated mice and animals at 12 h, 36 h, 7 days, and 28 days following either sham operation or 50% small bowel resection (SBR). A: representative sections of Alcian blue-stained goblet cells with light eosin counter staining (magnification x160). B: representative sections of Paneth cells labeled by lysozyme immunohistochemisty with light hematoxylin counterstaining (magnification x320).
|
|

View larger version (126K):
[in this window]
[in a new window]
|
Fig. 2. High-power photomicrographs (magnification x640) of sections taken from the ileum at 7 days following either sham operation or SBR. Numerous Alcian blue-stained goblet cells are seen throughout the crypts (white arrows) following SBR, as well as granule containing Paneth cells (black arrows) which typically reside at the base of the crypt.
|
|
Similar to the findings of early increased staining of goblet cells within villi, intestinal resection resulted in markedly increased lysozyme staining confined to the base of crypts in mice 12 h after SBR compared with sham-operated animals (Fig. 1B). By 36 h, lysozyme-positive cells were observed throughout the mid and upper portion of crypts, a pattern that remains evident 7 days postoperation (Fig. 2, black arrows). We postulate that these newly stained cells are recently differentiated Paneth cells migrating to the base of the crypt. Increased lysozyme staining is evident 28 days postoperative in SBR vs. sham, yet the staining at this point is confined to the base of the crypt.
Immunohistochemical chromogranin A staining of enteroendocrine cells was also performed on these sections. The overall staining of these cells generally appeared to be increased within crypts and villi in sections from SBR mice compared with sham at 7 days. However, determining the relative change in the percentage of these cells within the entire epithelium from SBR vs. sham mice was not deemed possible due to the overall sparse distribution of these cells within quantifiable crypts and villi (as described in METHODS).
As we observed an early increase in both goblet and Paneth cells following resection, the thymidine analog BrdU was administered intraperitoneally following sham or SBR to a separate group of mice (n = 5) as a marker of proliferation within intestinal lineages. Although increased incorporation was seen within the ileal crypts of mice following SBR, consistent with increased proliferation, no staining of goblet cells (within villi or crypts) or Paneth cells was seen (Fig. 3). This finding suggests that the early expansion of Alcian blue staining cells within the villus and lysozyme-positive Paneth cells at the base of crypts is not a result of newly formed cells.

View larger version (141K):
[in this window]
[in a new window]
|
Fig. 3. Photomicrographs of BrdU immunohistochemistry (x400) taken from the ileum of sham-operated and SBR mice 12 h after surgery and intraperitoneal administration of BrdU. Although SBR increased the incorporation of BrdU within crypts, consistant with increased proliferation, no staining was observed in any goblet or Paneth cells.
|
|
Quantitative morphometry.
Intestinal adaptation was verified after SBR by counting the number of epithelial cells within entire crypts and along one side of villi. As Paneth cells occupy the base of crypts, to avoid a bias toward one side or the other, we decided to count all epithelial cells within each crypt and then divide the final number in half as a representation of crypt depth. As can be seen in Fig. 4A, after SBR, significant increases in ileal crypt cell number were detectable as early as 12 h. In contrast, significant increases in the number of epithelial cells per villi were not observed until 36 h after SBR. Interestingly, total crypt cell numbers showed a modest decrease in sham-operated mice compared with nonoperated controls at 36 h and 7 days (P < 0.01 in both cases), returning to baseline at 28 days. For both crypts and villi, the two-way ANOVA revealed significant interaction between treatment and time, indicating that the effect of SBR became more pronounced with time after surgery.

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 4. Number of epithelial cells representing crypt depth (A) and villus height (B) from the ileum of unoperated (open bar), sham-operated (hatched bars), and 50% SBR (solid bars) mice 12 h, 36 h, 7 days, and 28 days following surgery (n = 5 animals/group). On the basis of univariate analysis, significant differences (*P < 0.05) between sham operation and SBR are shown. The two-way ANOVA indicated significant treatment (P < 0.0001) and treatment x time interaction (P < 0.0001) effects for both the crypt and villus cells.
|
|
A marked increase in both the number (Fig. 5A) and percentage (Fig. 5B) of goblet cells on the villi was observed in the SBR animals at the earliest time point studied (12 h). At this time, sham-operated animals also showed a modest, but significant, increase in the overall percentage of goblet cells within the terminal ileal epithelium compared with nonoperated controls (P < 0.05). The total number and percentage of villus goblet cells remained significantly elevated within the epithelium from SBR compared with sham-operated mice at 36 h, 7 days, and 28 days postoperatively (Fig. 5, A and B). Although the effects of SBR were still apparent at 28 days, the overall trend was back toward baseline at this time point, and this decline is statistically significant as indicated by the interaction seen in the two-way ANOVA. In contrast to the villus goblet cells, overall changes in the number of goblet cells within crypts were not evident at 12 h (sham-operated 3.1 ± 0.3 vs. SBR 3.0 ± 0.2). Significant increases in crypt goblet cell numbers were found at 36 h (sham-operated 2.8 ± 0.2 vs. SBR 6.2 ± 0.4; P < 0.01), peaking at 7 days (sham-operated 2.7 ± 03 vs. SBR 8.8 ± 0.6; P < 0.01), with return to baseline at 28 days (sham-operated 2.9 ± 0.4 vs. SBR 3.7 ± 0.6).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 5. Number (A) and percentage (B) of goblet cells per villi from the ileum of unoperated (open bar), sham-operated (hatched bars), and 50% SBR (solid bars) mice 12 h, 36 h, 7 days, and 28 days following surgery (n = 5 animals/group). On the basis of univariate analysis, significant differences (*P < 0.05) between sham operation and SBR are shown. The two-way ANOVA indicated significant treatment (P < 0.0001) and treatment x time interaction (P < 0.0001) effects for both the number and percentage of goblet cells.
|
|
The total number of Paneth cells within the ileal crypt was significantly elevated by 12 h after SBR compared with sham, a trend that continued to increase at 36 h and then plateau through 28 days (Fig. 6A). Sham-operation significantly reduced the total number of Paneth cells within the epithelium of crypts at all time points studied compared with nonoperated controls (P < 0.01 in all cases). The effect of SBR on Paneth cell number (Fig. 6A) exceeded that of total crypt cells (Fig. 4A). Thus when Paneth cells were expressed as a percentage of crypt cells (Fig. 6B), significant increases were apparent at all time points. Unlike goblet cells, which appear to be trending back to baseline (Fig. 5B), the ratio of the percentage of Paneth cells from SBR vs. sham-operated animals remained elevated through 28 days.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 6. Number (A) and percentage (B) of Paneth cells per crypt from the ileum of unoperated (open bar), sham-operated (hatched bars), and 50% SBR (solid bars) mice 12 h, 36 h, 7 days, and 28 days following surgery (n = 5 animals/group). On the basis of univariate analysis, significant differences (*P < 0.05) between sham operation and SBR are shown. The two-way ANOVA indicated significant treatment (P < 0.0001) and treatment x time interaction (P < 0.0001) effects for the number of Paneth cells. There were treatment (P < 0.0001), time (P < 0.0001), and treatment x time interaction (P = 0.03) effects for the percent of Paneth cells.
|
|
In contrast to the patterns observed for the goblet cells and Paneth cells, the absolute number and percentage of enterocytes was decreased in SBR compared with sham-operated mice 12 h after resection. (Fig. 7) By 36 h, when the effects of increased proliferation in SBR mice became apparent, the total number of enterocytes was increased (Fig. 7A), yet the percentage of enterocytes within the ileal epithelium remained significantly decreased (Fig. 7B), returning to baseline only at 28 days.

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 7. Number (A) and percentage (B) of enterocytes per villi from the ileum of unoperated (open bar), sham-operated (hatched bars), and 50% SBR (solid bars) mice 12 h, 36 h, 7 days, and 28 days after surgery (n = 5 animals/group). On the basis of univariate analysis, significant differences (*P < 0.05) between sham operation and SBR are shown. The two-way ANOVA indicated significant treatment (P < 0.0001), time (P < 0.0001), and treatment x time interaction (P < 0.0001) effects for both the number and percentage of enterocytes.
|
|
Assessment of mRNA changes.
Early changes in the percentage of intestinal secretory lineages identified histologically lead us to evaluate changes in mRNA levels of genes associated with proliferation and terminal differentiation of enterocytes, goblet, and Paneth cells within ileal homogenates taken from nonoperated animals and mice 12 h after either sham-operation or SBR. As can be seen in Fig. 8, SBR resulted in significant elevation of c-myc compared with sham-operated mice, consistent with an increase in proliferation seen after intestinal resection. Expression of Muc2 and Tff3 mRNAs, related to goblet cell production of epithelial protective mucus, were significantly greater in SBR compared with sham. Likewise, expression of the antimicrobial Paneth cell marker lysozyme was found to be significantly elevated in SBR vs. sham-operated mice at 12 h, consistent with the increased percentage of Paneth cells seen in Fig. 6. In contrast, mRNA levels for sucrase-isomaltase, an enterocyte marker, were not affected by SBR.

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 8. Relative abundance of mRNA markers for proliferation (c-myc), goblet cells (Tff3 and Muc2), Paneth cells (lysozyme), and enterocytes (sucrase-isomaltase, SI) in distal ileal homogenates from sham-operated (hatched bars) and 50% SBR (solid bars) mice 12 h after surgery (n = 5 animals/group). Each mRNA was measured by quantitative RT-PCR and compared with expression levels from nonoperated distal ileal homogenates. Values are expressed as means + SE. Significant differences using the t-test (*P < 0.05) are shown.
|
|
 |
DISCUSSION
|
|---|
After the loss of small bowel in animal models, the remaining intestine compensates by increasing the overall mucosal surface area. The mechanism by which the intestine is able to sense the need to increase and sustain proliferation required to support augmented crypt depth and villus height is not currently understood. In this study, we hypothesized that early changes in the overall allocation of epithelial progenitors toward secretory lineages occur after SBR. We report that adaptation in our murine model is evident as early as 12 h after SBR, as the number of cells within ileal crypts is significantly greater compared with sham-operated animals. This adaptive response is sustained in animals after SBR at all time points studied beyond 36 h, as measured by significant increases in both crypt and villus cell numbers up to 28 days after surgery. Consistent with our hypothesis, early significant increases in the number and percentage of goblet and Paneth cells within adapting ileal epithelium are demonstrated after SBR. All data presented were obtained from evaluation of the residual ileum after intestinal resection in our murine model. The adaptive response and allocation of enterocytes, goblet and Paneth cells was also assessed within jejunal epithelium following resection and found to be similar to that presented from the ileum, yet more modest (data not shown).
The vast majority of studies evaluating the adaptive process following intestinal resection has focused on changes within the absorptive enterocyte lineage, yet few reports have investigated the role of secretory lineages during this important response. In 1981, Bjerknes and Cheng performed a detailed study on a limited number of mice 1 and 3 wk after a 30% proximal resection (5). Although the only significant increase found in the absolute percentage of secretory lineages within the entire jejunal epithelium was enteroendocrine cells at 1 wk, they also observed changes in the overall distribution of goblet and Paneth cells. The resection-induced presence of Paneth and goblet cells within crypt cell positions typically considered to contain undifferentiated dividing epithelial precursors, lead these authors to postulate the resetting of a new steady state of epithelium production toward secretory lineages. The limited adaptive response observed within the proximal jejunum following a 30% resection may have masked the lineage changes we observed in the ileum after 50% SBR. As the overall goal of the Bjerknes and Cheng study was to document that a new steady state occurred following resection, early changes responsible for resetting this compartment were not evaluated.
Our findings of increased goblet cells following intestinal resection is supported by recent studies demonstrating both an increase in overall number and density of goblet cells 1 wk after SBR in rats (16, 26), yet other studies following SBR in rats have not reported an affect of resection on goblet cell number (21, 32). Differences in species of animals, extent, and location of intestinal resection, methods used to quantify overall changes of goblet cells, time points studied, and location of adapting intestine examined may account for the discrepancies between studies. As the purpose of our study was to evaluate early changes within epithelial secretory lineages, which may affect adaptation, we studied mice at 12 h and 36 h after SBR. To our knowledge, no studies to date have evaluated the early effects of SBR on the allocation of secretory lineages. In this study, we report the greatest increase in goblet cell number and percentage occurs within the villi by 12 h after SBR and that at this same time point, a significant increase in the mRNA expression of the proliferative marker c-myc has occurred. Despite this finding, our detailed histological examination demonstrating early increases in goblet cells does not appear to be due to dividing epithelial progeny becoming allocated toward goblet cells, given the early increase is occurring within villi and lack of BrdU uptake within the first 12 h after resection within these cells. A rapid switch of villus enterocytes to a goblet phenotype is consistent with the decreased numbers of enterocytes observed 12 h after SBR (Fig. 7). This finding is similar to other forms of mucosal injury that have shown early restitution of the epithelium by increased number of villus goblet cells within hours of injury (15, 22). In situ hybridization data demonstrating increased expression of Tff3 mRNA within nonsecretory cells in the crypt and villus after various forms of injury, including surgical anastomosis in the small intestine and colon, provides additional evidence to the potential plasticity of otherwise committed absorptive enterocytes after injury (35). Our finding of increased expression of differentiated mRNA goblet cell markers (Tff3, Muc2) 12 h after SBR further supports stimulation of epithelial lineages to expand and produce factors, which may play a role in the adaptive response after intestinal resection.
Similar to goblet cells, the early increase in both the number and percentage of Paneth cells occurred 12 h after SBR. This finding was supported by the significant increase in the mRNA for the Paneth cell marker lysozyme and did not appear to be due to proliferation as we did not observe incorporation of BrdU within these cells. The increase in Paneth cell number and percentage was sustained out to 28 days in our study. Other studies have demonstrated increased overall numbers of Paneth cells at 7 days after SBR, but these findings were not statistically significant (5). During this study, we found it technically difficult to quantify Paneth cells within histological sections, which may explain differences between studies. Our ultimate methods for quantification required lysozyme immunohistochemical staining of Paneth cells from tissue sections that clearly demonstrated a single epithelium throughout the crypt, often requiring numerous sections to be taken from each animal studied. The sustained increase of Paneth cells in our study may reflect their increased life span (21 days) compared with other epithelial lineages (35 days) (6) and may also support an important role for Paneth cells regulating proliferation within the adapting crypt. Data supporting this statement include the finding that Paneth cells produce Wnt factors and other cytokines capable of regulating proliferation and allocation of epithelial cells (6, 12). Evaluating the effect of SBR on the Paneth cell production of these factors may reveal important regulatory mechanisms of the adaptive response.
Recent data supporting the overall expression of two opposing basic helical-loop-helical factors Hes1 and Math1 appear important to intestinal fate determination of epithelial progeny, with unopposed expression of Hes 1 leading to absorptive lineages and overexpression of Math1 leading to secretory lineages. (17, 36) In our study, no changes in Hes1 and Math1 mRNA levels were observed in SBR vs sham-operated mice 12 h after operation (data not shown). Despite the lack of significant changes in the overall expression of mRNA within whole ileal samples after resection, relative changes in their expression within intestinal progeny still may be playing an important role in the ultimate fate determination. Exploring the molecular mechanisms underlying the increase in secretory lineages after SBR will be an interesting future avenue. We predict at least three distinct mechanisms: 1) a rapid one occurring on the villi responsible for the phenotype switch of a subpopulation of enterocytes to goblet cells; 2) a rapid one within crypts hastening conversion of Paneth progenitors to fully differentiated Paneth cells; 3) a more sustained response causing villus lengthening and thus functional adaptation.
In summary, early increases in the overall percentage of secretory lineages within intestinal epithelium occur during the adaptive response of the small bowel after SBR. The rapid increase in Paneth and goblet cells may be an important mechanism during intestinal adaptation after SBR. Future studies taking advantage of genetically engineered mice lacking these intestinal lineages will provide important insight into the role of secretory lineages during intestinal adaptation.
 |
GRANTS
|
|---|
Histological staining and immunohistochemistry was performed by the Texas Gulf Coast Digestive Disease Center Morphology Core [supported by National Institutes of Health (NIH) Grant P30 DK-56338]. This work was also supported by NIH Grants K08 DK-067395 and T32 HL-6699-01A1.
 |
ACKNOWLEDGMENTS
|
|---|
We thank Claudia Kozinetz for the assistance in statistical analyses of all data.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: M. A. Helmrath, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030 USA (e-mail: helmrath{at}bcm.tmc.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- ABIPRISM. 7700 Sequence Detection System. User Bulletin #2. Foster City, CA: PE Applied Biosystems, 2001.
- Altmann GG. Influence of bile and pancreatic secretions on the size of the intestinal villi in the rat. Am J Anat 132: 167177, 1971.[CrossRef][ISI][Medline]
- Beck PL, Wong JF, Li Y, Swaminathan S, Xavier RJ, Devaney KL, and Podolsky DK. Chemotherapy- and radiotherapy-induced intestinal damage is regulated by intestinal trefoil factor. Gastroenterology 126: 796808, 2004.[CrossRef][ISI][Medline]
- Bjerknes M and Cheng H. The stem-cell zone of the small intestinal epithelium. I. Evidence from Paneth cells in the adult mouse. Am J Anat 160: 5163, 1981.[CrossRef][ISI][Medline]
- Bjerknes M and Cheng H. The stem-cell zone of the small intestinal epithelium. IV. Effects of resecting 30% of the small intestine. Am J Anat 160: 93103, 1981.[CrossRef][ISI][Medline]
- Cheng H and Leblond CP. Origin, differentiation and renewal of the four main epithelial cell types in the mouse small intestine. V. Unitarian theory of the origin of the four epithelial cell types. Am J Anat 141: 537562, 1974.[CrossRef][ISI][Medline]
- Dahly EM, Gillingham MB, Guo Z, Murali SG, Nelson DW, Holst JJ, and Ney DM. Role of luminal nutrients and endogenous GLP-2 in intestinal adaptation to mid-small bowel resection. Am J Physiol Gastrointest Liver Physiol 284: G670G682, 2003.[Abstract/Free Full Text]
- Dowling RH and Booth CC. Structural and functional changes following small intestinal resection in the rat. Clin Sci 32: 139149, 1967.[ISI][Medline]
- Feldman EJ, Dowling RH, McNaughton J, and Peters TJ. Effects of oral versus intravenous nutrition on intestinal adaptation after small bowel resection in the dog. Gastroenterology 70: 712719, 1976.[ISI][Medline]
- Fukuzawa H, Sawada M, Kayahara T, Morita-Fujisawa Y, Suzuki K, Seno H, Takaishi S, and Chiba T. Identification of GM-CSF in Paneth cells using single-cell RT-PCR. Biochem Biophys Res Commun 312: 897902, 2003.[CrossRef][ISI][Medline]
- Garabedian EM, Roberts LJJ, McNevin MS, and Gordon JI. Examining the role of Paneth cells in the small intestine by lineage ablation in transgenic mice. J Biol Chem 272: 2372923740, 1997.[Abstract/Free Full Text]
- Gregorieff A, Pinto D, Begthel H, Destree O, Kielman M, and Clevers H. Expression pattern of Wnt signaling components in the adult intestine. Gastroenterology 129: 626638, 2005.[CrossRef][ISI][Medline]
- Hartmann B, Hare KJ, Kissow H, Thulesen J, Poulsen SS, and Holst JJ. GLP-2 induces additional, but reversible, intestinal growth in rats adapted to intestinal resection (Abstract). Gastroenterology 124: A-273, 2003.
- Helmrath MA, VanderKolk WE, Can G, Erwin CR, and Warner BW. Intestinal adaptation following massive small bowel resection in the mouse. J Am Coll Surg 183: 441449, 1996.[ISI][Medline]
- Ikeda H, Yang CL, Tong J, Nishimaki H, Masuda K, Takeo T, Kasai K, and Itoh G. Rat small intestinal goblet cell kinetics in the process of restitution of surface epithelium subjected to ischemia-reperfusion injury. Dig Dis Sci 47: 590601, 2002.[CrossRef][ISI][Medline]
- Jarboe MD, Juno RJ, Stehr W, Bernal NP, Profitt S, Erwin CR, and Warner BW. Epidermal growth factor receptor signaling regulates goblet cell production after small bowel resection. J Pediatr Surg 40: 9297, 2005.[CrossRef][ISI][Medline]
- Jensen J, Pedersen EE, Galante P, Hald J, Heller RS, Ishibashi M, Kageyama R, Guillemot F, Serup P, and Madsen OD. Control of endodermal endocrine development by Hes-1. Nat Genet 24: 3644, 2000.[CrossRef][ISI][Medline]
- Juno RJ, Williams JL, Knott AW, Erwin CR, O'Brien DP, and Warner BW. A serum factor after intestinal resection stimulates epidermal growth factor receptor signaling and proliferation in intestinal epithelial cells. Surgery 132: 377383, 2002.[CrossRef][ISI][Medline]
- Leeper LL and Henning SJ. Development and tissue distribution of sucrase-isomaltase mRNA in rats. Am J Physiol Gastrointest Liver Physiol 258: G52G58, 1990.[Abstract/Free Full Text]
- Levine GM, Deren JJ, and Yezdimir E. Small-bowel resection. Oral intake is the stimulus for hyperplasia. Am J Dig Dis 21: 542546, 1976.[CrossRef][ISI][Medline]
- Lukish J, Schwartz MZ, Rushin JM, and Riordan GP. A comparison of the effect of growth factors on intestinal function and structure in short bowel syndrome. J Pediatr Surg 32: 16521655, 1997.[CrossRef][ISI][Medline]
- Masuda K, Ikeda H, Kasai K, Fukuzawa Y, Nishimaki H, Takeo T, and Itoh G. Diversity of restitution after deoxycholic acid-induced small intestinal mucosal injury in the rat. Dig Dis Sci 48: 21082115, 2003.[CrossRef][ISI][Medline]
- Nanthakumar NN and Henning SJ. Ontogeny of sucrase-isomaltase gene expression in rat intestine: responsiveness to glucocorticoids. Am J Physiol Gastrointest Liver Physiol 264: G306G311, 1993.[Abstract/Free Full Text]
- O'Brien DP, Nelson LA, Huang FS, and Warner BW. Intestinal adaptation: structure, function, and regulation. Semin Pediatr Surg 10: 5664, 2001.[CrossRef][Medline]
- Rubin DC, Swietlicki EA, Iordanov H, Fritsch C, and Levin MS. Novel goblet cell gene related to IgGFcgammaBP is regulated in adapting gut after small bowel resection. Am J Physiol Gastrointest Liver Physiol 279: G1003G1010, 2000.[Abstract/Free Full Text]
- Rubin DC, Swietlicki EA, Iordanov H, Fritsch C, and Levin MS. Novel goblet cell gene related to IgGFcgammaBP is regulated in adapting gut after small bowel resection. Am J Physiol Gastrointest Liver Physiol 279: G1003G1010, 2000.[Abstract/Free Full Text]
- Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, and Reed MW. Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: comparison of endpoint and real-time methods. Anal Biochem 285: 194204, 2000.[CrossRef][ISI][Medline]
- Schonhoff SE, Giel-Moloney M, and Leiter AB. Minireview: Development and differentiation of gut endocrine cells. Endocrinology 145: 26392644, 2004.[Abstract/Free Full Text]
- Scott RB, Kirk D, MacNaughton WK, and Meddings JB. GLP-2 augments the adaptive response to massive intestinal resection in rat. Am J Physiol Gastrointest Liver Physiol 275: G911G921, 1998.[Abstract/Free Full Text]
- Seno H, Sawada M, Fukuzawa H, Morita-Fujisawa Y, Takaishi S, Hiai H, and Chiba T. Involvement of tumor necrosis factor alpha in intestinal epithelial cell proliferation following Paneth cell destruction. Scand J Gastroenterol 37: 154160, 2002.[CrossRef][ISI][Medline]
- Stern LE, Erwin CR, O'Brien DP, Huang F, and Warner BW. Epidermal growth factor is critical for intestinal adaptation following small bowel resection. Microsc Res Tech 51: 138148, 2000.[CrossRef][ISI][Medline]
- Washizawa N, Gu LH, Gu L, Openo KP, Jones DP, and Ziegler TR. Comparative effects of glucagon-like peptide-2 (GLP-2), growth hormone (GH), and keratinocyte growth factor (KGF) on markers of gut adaptation after massive small bowel resection in rats. J Parenter Enteral Nutr 28: 399409, 2004.[Abstract/Free Full Text]
- Williamson RC and Bauer FL. Evidence for an enterotropic hormone: compensatory hyperplasia in defunctioned bowel. Br J Surg 65: 736739, 1978.[ISI][Medline]
- Williamson RC, Buchholtz TW, and Malt RA. Humoral stimulation of cell proliferation in small bowel after transection and resection in rats. Gastroenterology 75: 249254, 1978.[ISI][Medline]
- Xian CJ, Howarth GS, Mardell CE, Cool JC, Familari M, Read LC, and Giraud AS. Temporal changes in TFF3 expression and jejunal morphology during methotrexate-induced damage and repair. Am J Physiol Gastrointest Liver Physiol 277: G785G795, 1999.[Abstract/Free Full Text]
- Yang Q, Bermingham NA, Finegold M, and Zoghbi HY. Requirement of Math1 for secretory cell lineage commitment in the mouse intestine. Science 294: 21552158, 2001.[Abstract/Free Full Text]
- Ziegler TR, Fernandez-Estivariz C, Gu LH, Bazargan N, Umeakunne K, Wallace TM, Diaz EE, Rosado KE, Pascal RR, Galloway JR, Wilcox JN, and Leader LM. Distribution of the H+/peptide transporter PepT1 in human intestine: up-regulated expression in the colonic mucosa of patients with short-bowel syndrome. Am J Clin Nutr 75: 922930, 2002.[Abstract/Free Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
E. Q. Haxhija, H. Yang, A. U. Spencer, H. Koga, X. Sun, and D. H. Teitelbaum
Modulation of mouse intestinal epithelial cell turnover in the absence of angiotensin converting enzyme
Am J Physiol Gastrointest Liver Physiol,
July 1, 2008;
295(1):
G88 - G98.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. M. Dekaney, J. J. Fong, R. J. Rigby, P. K. Lund, S. J. Henning, and M. A. Helmrath
Expansion of intestinal stem cells associated with long-term adaptation following ileocecal resection in mice
Am J Physiol Gastrointest Liver Physiol,
November 1, 2007;
293(5):
G1013 - G1022.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2007 by the American Physiological Society.