HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) All Versions of this Article: 292/1/G447    most recent 00286.2006v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Web of Science (10) Citing Articles via Google Scholar Google Scholar Articles by Ishiguro, H. Articles by Soleimani, M. Search for Related Content PubMed PubMed Citation Articles by Ishiguro, H. Articles by Soleimani, M.

REPORTS

Effect of Slc26a6 deletion on apical Cl^–/HCO₃^– exchanger activity and cAMP-stimulated bicarbonate secretion in pancreatic duct

¹Laboratory of Human Nutrition, Nagoya University Graduate School of Medicine, Nagoya, Japan; ²Department of Pharmacology, Institute of Gastroenterology, Yonsei University College of Medicine, Seoul, Korea; and Departments of ³Medicine and ⁴Surgery, University of Cincinnati and ⁵Veterans Administration Medical Center, Cincinnati, Ohio

Submitted 30 June 2006 ; accepted in final form 8 August 2006

ABSTRACT

The role of Slc26a6 (PAT1) on apical Cl^–/HCO₃^– exchange and bicarbonate secretion in pancreatic duct cells was investigated using Slc26a6 null and wild-type (WT) mice. Apical Cl^–/HCO₃^– exchange activity was measured with the pH-sensitive dye BCECF in microperfused interlobular ducts. The HCO₃^–-influx mode of apical [Cl^–]_i/[HCO₃^–]_o exchange (where brackets denote concentration and subscripts i and o denote intra- and extracellular, respectively) was dramatically upregulated in Slc26a6 null mice (P < 0.01 vs. WT), whereas the HCO₃^–-efflux mode of apical [Cl^–]_o/[HCO₃^–]_i exchange was decreased in Slc26a6 null mice (P < 0.05 vs. WT), suggesting the unidirectionality of the Slc26a6-mediated HCO₃^– transport. Fluid secretory rate in interlobular ducts were comparable in WT and Slc26a6 null mice (P > 0.05). In addition, when pancreatic juice was collected from whole animal in basal and secretin-stimulated conditions, neither juice volume nor its pH showed differences between WT and Slc26a6 null mice. Semiquantitative RT-PCR demonstrated more than fivefold upregulation in Slc26a3 (DRA) expression in Slc26a6 knockout pancreas. In conclusion, these results point to the role of Slc26a6 in HCO₃^– efflux at the apical membrane and also suggest the presence of a robust Slc26a3 compensatory upregulation, which can replace the function of Slc26a6 in pancreatic ducts.

cystic fibrosis transmembrane regulator; cystic fibrosis; sodium bicarbonate exchanger; HCO₃^– secretion; HCO₃^– transporters; downregulated in adenoma; putative anion transporter 1

Identifying the apical Cl^–/HCO₃^– exchanger(s) in the pancreatic duct has been the subject of numerous investigations. Molecular cloning studies have identified two distinct families of anion exchangers: SLC4 and SLC26. The SLC4 family includes four distinct Na-independent Cl^–/HCO₃^– exchangers known as AE1, AE2, AE3, and AE4, with AE1, 2, and 3 exclusively located on the basolateral membrane of epithelial cells (1, 2, 3, 27). AE4 is expressed in the apical membrane of duodenocytes, but its subcellular distribution in the kidney remains controversial (18, 36, 41).

SLC26 isoforms are members of a large, conserved family of anion exchangers, many of which display highly restricted and distinct tissue distribution and share no significant homology to AEs. Overall, ten SLC26 genes or isoforms (SLC26A1–11) have been cloned (8, 23, 24, 25, 32). Several SLC26 isoforms function as Cl^–/HCO₃^– exchangers. These include SLC26A3 (DRA), SLC26A6 (PAT1), SLC26A7 (PAT2), and SLC26A9 (PAT4), with PAT1 and DRA detected on the apical membrane of pancreatic ducts cells (13, 21, 22, 42).

SLC26A6 (PAT1) is a major apical Cl^–/HCO₃^– exchanger in the small intestine and mediates majority of PGE₂-stimulated bicarbonate secretion in the duodenum (37, 38, 39). On the basis of its localization in the apical membrane of the pancreatic duct and its function as a Cl^–/HCO₃^– exchanger, PAT1 has been proposed to be a major contributor to apical HCO₃^– secretion in the pancreatic duct (13). To ascertain its role in apical Cl^–/HCO₃^– exchange and bicarbonate secretion in the pancreatic duct, Slc26a6 null mice and their wild-type (WT) littermates were examined. The results indicated that PAT1 null mice display an intriguing pattern of adaptation in apical Cl^–/HCO₃^– exchanger activity in their pancreatic duct cells.

METHODS AND MATERIALS

The following studies were approved by the Ethical Committee on Animal Use for Experiment and Recombinant DNA Experiment Safety Committee of Nagoya University, Japan and by the Committees for the Care and Use of Laboratory Animals at Yonsei University College of Medicine, South Korea and at University of Cincinnati, Cincinnati OH.

Mouse model. Slc26a6 knockout (KO) mice and their WT littermates were used for the experiments. Targeted 129 stem cells were implanted in a C57/BL6 blastocyst, the chimerical mice were bred to C57/BL6, and the progeny were studied (39). The animals used for these studies had been bred for five generations.

Collection and pH measurement of pancreatic juice. SL26A6 gene-disrupted (–/–) and littermate control mice were fasted overnight and then anesthetized with ketamine (3 mg/20 g body wt) and xylazine (0.2 mg/20 g body wt) by intramuscular injection. The body temperature of mice were maintained by placing the mice on a warm pad (37°C) during the experiments. The abdomen was opened, and the lumen of the common pancreaticobiliary duct was cannulated with a modified 31-gauge needle (TSK Striject, Air-Tite, Virginia Beach, VA). After the proximal end of the common duct was ligated to prevent contamination of bile, the pancreatic juice was collected in PE-10 tube for 30 min. Secreted volume was calibrated by measuring the length of the PE-10 tube filled with pancreatic juice. Mice were then treated with secretin (Sigma, 1 CU/kg sc), and the pancreatic juice was further collected in another PE-10 tube for 30 min after a 5-min interval from the secretin treatment. The collected pancreatic juices were transferred to microtubes embedded with mineral oil to prevent evaporation. The pancreatic juice was then equilibrated with 5% CO₂ for 20 min, and the pH of pancreatic juice was measured by using a glass micro-pH combination electrode (Thermo Electron, Beverly, MA).

Isolation of interlobular ducts. Interlobular pancreatic ducts (diameter 100 µm) were isolated as described previously (12). Mice were killed by cervical dislocation. The pancreas was removed and chopped with scissors into 1-mm³ pieces. The tissue was digested with collagenase and hyaluronidase. Interlobular duct segments were microdissected by using sharpened needles under a dissection microscope. Usually 10–15 interlobular duct segments of 300–400 µm in length were isolated from one pancreas. The ducts were cultured overnight, during which time the end of the duct segment sealed spontaneously.

Solutions. The standard HCO₃^–-buffered solution contained (in mM) 115 NaCl, 5 KCl, 1 CaCl₂, 1 MgCl₂, 10 D-glucose, and 25 NaHCO₃ and was equilibrated with 95% O₂ + 5% CO₂. Cl^–-free HCO₃^–-buffered solutions were made by replacing Cl^– with glucuronate. High-K⁺ (70 mM) HCO₃^–-buffered solutions were made by replacing Na⁺. All solutions were adjusted to pH 7.4 at 37°C.

Measurement of fluid secretory rate. The fluid secretory rate in isolated ducts was measured with videomicroscopy as described previously (43). The ducts were attached to glass coverslips pretreated with Cell-Tak and were superfused at 37°C on the stage of an inverted microscope. The bright-field images of the ducts were obtained at 5-min intervals by use of a charge-coupled device camera. The initial values for the length (L₀), diameter (2R₀), and image area (A₀) of the duct lumen were measured in the first image of the series. The initial volume (V₀) of the duct lumen was calculated, assuming cylindrical geometry, as R₀²L₀. The luminal surface area of the epithelium (S_o) was taken to be 2R₀L₀. In subsequent images of the series, the luminal image area (A) was expressed as relative area (A/A₀). Relative volume (V/V₀) was estimated from relative area using V/V₀ = (A/A₀)^3/2. The rate of fluid secretion was calculated from the increment in volume and expressed as the secretory rate per unit luminal area of epithelium (nl·min^–1·mm^–2).

Microperfusion of the isolated interlobular ducts. The lumen of the interlobular duct segment was microperfused as described previously (15). Both ends of the duct were cut open with sharpened needles, and one end was cannulated with concentric holding and perfusion pipettes. The bath and luminal solutions were modified separately. The bath was continuously perfused at 37°C.

Measurement of intracellular pH. Intracellular pH (pH_i) in the duct cells was estimated by microfluorometry as described previously (18) using the pH-sensitive fluoroprobe BCECF. After cannulation of the duct for luminal perfusion, the duct cells were loaded with BCECF for 10 min by adding acetoxymethyl ester BCECF-AM (2 µM) to the bathing solution. Small regions of the duct epithelium (10–20 cells) were illuminated alternately at excitation wavelengths of 430 and 480 nm. Values of pH_i were calculated from the fluorescence ratio (F₄₈₀/F₄₃₀) measured at 530 nm. The system was calibrated by the high-K⁺/nigericin technique (35).

Semiquantitative RT-PCR of apical anion exchangers. RNA isolated from pancreas of WT and Slc26a6 KO mice was examined for the expression of Slc26a3, which is the only other known apical Cl^–/HCO₃^– exchanger detected in the pancreatic duct (13). In addition, the expression of Slc26a4 (PDS, pendrin), Slc26a11, and Slc4a9 (AE4), the other known apical anion exchangers in epithelial tissues, was examined. For Slc26a3, the following oligonucleotide primers from exon 2 were synthesized and utilized for RT-PCR: 5'- GGCAAAATGATCGAAGCCATAGGG (sense) and 5'-GATGGTCCAGGAATGTC TTGTGATGTC (antisense). The cycling parameters were 94°C, 1 min, then 94°C, 30 s, 68°C, 3 min, 32 cycles. For control in RNA loading, the following oligonucleotide primers from 18S rRNA were used: 5'-CCAGTAAGTGCGGGTCATAAGC (sense) and 5'-GATCCGAGGGCCTCACTAAACC (antisense). This fragment encompasses nucleotides 1645–1747. For Slc26a4 (PDS or pendrin), the primers TCC CGG TGA AAG TGA ATG TC (sense), and CGC AAT GAC CTC ACT CCT AC (antisense) (accession number NM_011867); for Slc26a11, the primers GGT TCT GGA GTG CAC GCA TAT C (sense), and AAC AAA GGC CAG GGC GAC TC (antisense) (accession number NM_178743); and for Slc4a9 (AE4), the primers CAG AGG AGG AGG AGA CCA TC (sense), and GAT GTT GAT TTC TGG AGC CTT G (antisense) (accession number NM_172830) were used.

Materials. BCECF-AM was obtained from Molecular Probes (Eugene, OR), forskolin was from Sigma (St. Louis, MO), and secretin was from Peptide Institute.

Statistics. Data are presented as the means ± SE unless otherwise indicated. Tests for statistically significant differences were made with Student's t-test.

RESULTS

Basal and forskolin-stimulated fluid secretion in sealed interlobular ducts isolated from WT and Slc26a6 –/– mice. Isolated interlobular ducts were superfused with the standard HCO₃^–-CO₂-buffered solution at 37°C and were then stimulated by forskolin (1 µM), an activator of adenylate cyclase, in the bath. The rate of basal fluid secretion was 0.18 ± 0.05 nl·min^–1·mm^–2 (n = 5) in WT ducts and 0.22 ± 0.05 (n = 4) in Slc26a6 –/– ducts (Fig. 1). The rate of forskolin-stimulated fluid secretion was 0.42 ± 0.02 nl·min^–1·mm^–2 in WT ducts and 0.53 ± 0.07 in Slc26a6 –/– ducts. Basal and forskolin-stimulated fluid secretion were not different between WT and Slc26a6 –/– ducts.

View larger version (14K): [in this window] [in a new window]   Fig. 1. Basal and forskolin-stimulated fluid secretion in sealed interlobular pancreatic ducts. Sealed interlobular pancreatic ducts isolated from wild-type (WT) and Sls26a6 –/– (KO) mice were superfused with the standard HCO3–-CO2-buffered solution, and forskolin (1 µM) was added to the bath. A and B: time course of fluid secretory rate in WT (n = 5) and Slc26a6 –/– ducts (n = 4). C: averaged values of basal and forskolin-stimulated fluid secretion. Means ± SE are shown.

View larger version (11K): [in this window] [in a new window]   Fig. 2. Effects of luminal Cl– removal on intracellular pH in microperfused interlobular pancreatic ducts. A: representative tracing. Initially, the bath and lumen of the duct segments were separately perfused with the standard HCO3–-buffered solution containing 124 mM Cl–. At the time indicated, the luminal perfusate was switched to Cl–-free HCO3–-buffered solution (Cl– replaced with glucuronate), forskolin (1 µM) was applied to the bath, and the bath perfusate was switched to high-K+ (70 mM) solutions. Experiments are each representative of 5 experiments. B: effects of high K+ are shown in magnified scale. C: summation of results. The averaged responses of intracellular pH upon removal of luminal Cl– (means ± SE, n = 5).

Effects of luminal Cl^– removal on pH_i in microperfused interlobular pancreatic ducts isolated from Slc26a6 –/– mice. Basal pH_i of Slc26a6 –/– ducts in the presence of 25 mM HCO₃^–-5% CO₂ was 7.322 ± 0.015 (n = 10), which was not different from that of WT ducts. Surprisingly, removal of luminal Cl^– (Fig. 2) caused a much larger (P < 0.01) increase of pH_i in Slc26a6 –/– ducts (0.313 ± 0.042 units in 5 min in unstimulated condition and 0.325 ± 0.062 under forskolin stimulation, n = 5) than in WT ducts (representative tracings as Fig. 2A and averaged responses as Fig. 2C). Forskolin stimulation did not cause significant changes in basal pH_i.

Imposition of high K⁺ gradient in the bath caused a small decrease in basal pH_i by 0.053 ± 0.005 (n = 5) in 3 min under forskolin stimulation, which is also in contrast to WT ducts (Fig. 2, A and B, in magnified scale). Removal of luminal Cl^– under high-K⁺ conditions caused further increase of pH_i.

Effects of luminal and bath Cl^– removal on pH_i in microperfused interlobular pancreatic ducts isolated from WT and Slc26a6 –/– mice. In the next set of experiments, we examined the effect of bath chloride removal on intracellular pH. In WT animals, the increase of pH_i by luminal Cl^– removal was much smaller than that by Cl^– removal from the bath (0.335 ± 0.054 in 5 min, n = 5, Fig. 3). This is similar to the findings in interlobular ducts from guinea pig pancreas (16). In Slc26a6 null animals, the increase in pH_i by Cl^– removal from the bath (0.130 ± 0.064 in 5 min, n = 5, Fig. 3) was smaller (P < 0.05) than that in WT ducts. These data suggest that another apical Cl^–/HCO₃^– exchanger is upregulated and basolateral Cl^–/HCO₃^– exchanger is downregulated in Slc26a6 –/– ducts.

View larger version (13K): [in this window] [in a new window]   Fig. 3. Effects of luminal and bath Cl– removal on intracellular pH in microperfused interlobular pancreatic ducts. Initially, the bath and lumen of the duct segments were separately perfused with the standard HCO3–-buffered solution and stimulated by forskolin (1 µM). Thereafter, the luminal perfusate and/or the bath solution was switched to Cl–-free HCO3–-buffered solution. Experiments are each representative of 5 experiments.

View larger version (13K): [in this window] [in a new window]   Fig. 4. Effects of restoring luminal Cl– on intracellular pH in microperfused interlobular pancreatic ducts. Before measurement, intracellular Cl– was depleted as much as possible by perfusing both the bath and lumen with Cl–-free HCO3–-buffered solution in the presence of forskolin (1 µM). At the time indicated, Cl– was restored to the lumen by switching the luminal perfusate to the standard HCO3–-buffered solution containing 124 mM Cl–. The initial rate of pHi decline (the line was overlaid on the trace) was calculated as a measure of exchange activity of intracellular HCO3– for luminal Cl–. Experiments are each representative of 6 experiments.

View larger version (17K): [in this window] [in a new window]   Fig. 5. pH measurement and volume of pure pancreatic juice collected in vivo under secretin stimulation. Pancreatic juice volume and pH were comparable in WT and Slc26a6 null mice.

View larger version (52K): [in this window] [in a new window]   Fig. 6. Expression of Slc26 bicarbonate transporters in the pancreas of Slc26a6 KO mouse. A: ethidium bromide staining of agarose gel depicting Slc26a3 RT-PCR. B: summation of results. C: ethidium bromide staining of agarose gels depicting the expression of Slc26a4 (PDS; pendrin), Slc4a9 (AE4), and Slc26a11. Positive controls for Slc26a4, AE4, and Slc26a11 are shown in the kidney (right panels in Fig. 6C).

The present studies examined the role of Slc26a6 (PAT1) in apical Cl^–/HCO₃^– exchange and fluid secretion in interlobular pancreatic duct cells and pancreatic fluid and HCO₃^– secretion in vivo by using Slc26a6 null mice. Our results demonstrated the unexpected, and seemingly paradoxical, upregulation of apical Cl^–/HCO₃^– exchanger activity ([Cl^–]_i/[HCO₃^–]_o exchange, where brackets denote concentration and subscripts i and o denote intra- and extracellular, respectively) in interlobular ducts of Slc26a6 null animals (Fig. 2). To examine the exchange activity of intracellular HCO₃^– for luminal Cl^– across the apical membrane, the interlobular duct cells were depleted of Cl^– (Fig. 4). This time, however, the apical Cl^–/HCO₃^– exchanger activity ([Cl^–]_o/[HCO₃^–]_i exchange) was actually decreased in Slc26a6 null mice. Absence of Slc26a6 did not affect basal and cAMP-stimulated fluid secretion in isolated interlobular ducts superfused with the standard HCO₃^–buffered solution (Fig. 1). Similarly, the volume and pH of pure pancreatic juice collected in vivo at both basal and secretin-stimulated conditions were comparable in WT and Slc26a6 null mice (Fig. 5). Slc26a3 (DRA) is strongly upregulated in Slc26a6 KO mouse pancreas (Fig. 6).

As noted, the increase in pH_i (mostly due to apical HCO₃^– influx) on removal of luminal Cl^– was much larger in Slc26a6 –/– ducts (Fig. 2). These data are consistent with either the inhibitory effect of Slc26a6 on HCO₃^– influx in WT animals or the activation of a distinct apical anion exchanger in Slc26a6 null mice. Assuming that Slc26a6 is an electrogenic Cl^–/HCO₃^– exchanger with nHCO₃^– exchanged per Cl^–, where n is >1, as proposed (28), WT animals may have difficulty taking up HCO₃^– in native hyperpolarized epithelia in response to Cl^– removal from the luminal perfusate. This could explain the small effect of luminal Cl^– removal on intracellular pH in WT ducts (Fig. 2) and in guinea pig ducts (18). Enhanced intracellular alkalinization upon removal of luminal Cl^– in Slc26a6 null mice (Fig. 2) suggests that another Cl^–/HCO₃^– exchanger is upregulated in the apical membrane. Anion exchanger with stoichiometry of >2:1 Cl^–:HCO₃^– (compatible with Slc26a3; DRA, Refs. 22, 28) would easily uptake HCO₃^– when luminal Cl^– is removed. However, the intracellular alkalinization may also occur by apical HCO₃^– influx through CFTR and basolateral HCO₃^– influx via Na⁺-nHCO₃^– cotransport, both of which may be activated by depolarization. The former possibility is unlikely because intracellular HCO₃^– concentration would not exceed luminal HCO₃^– concentration unless the cells were highly depolarized to approximately zero. In fact, removal of luminal Cl^– caused pH_i increase to 7.7 in Slc26a6 null ducts (Fig. 2A). The extent of intracellular alkalinization upon removal of perfusate chloride may be determined by the electrogenicity of the chloride/base exchanger, the magnitude of membrane potential, and intracellular Cl^– concentration. It is worth mentioning that these two last parameters may differ between WT and Slc26a6 –/– ducts and also may be altered by cAMP stimulation. As indicated the activity of basolateral Cl^–-HCO₃^– exchange is reduced in Slc26a6 null ducts (Fig. 3). Downregulation of basolateral Cl^–/HCO₃^– exchanger (possibly AE2) would be beneficial for HCO₃^– secretion (analogous to a compensatory regulation) because it works as a base extruder.

Effects of depolarization (by high-K⁺ in the bath) on pH_i were opposite in WT and Slc26a6 null ducts (Fig. 2); depolarization caused a small increase of pH_i in WT but caused a decrease in Slc26a6 null ducts, which is compatible to the electrogenic property of Slc26a6. The increase in intracellular HCO₃^– concentration in WT ducts can be explained by combination of the depolarization-induced inhibition of Slc26a6-mediated exchange of luminal 1Cl^– for intracellular nHCO₃^– and an apical HCO₃^– conductance, and by depolarization-induced activation of basolateral Na⁺-nHCO₃^– cotransport. On the contrary, the reduction in intracellular HCO₃^– concentration in Slc26a6 null ducts can be explained by the activation of apical Cl^–/HCO₃^– exchanger of opposite stoichiometry (nCl^–/1HCO₃^– exchange), which seems to be upregulated in Slc26a6 null ducts as shown in Fig. 2A.

Although there were significant changes in the apical Cl^–/HCO₃^– exchange activity (Figs. 2 and 4), the overall pancreatic fluid and bicarbonate secretions (both at the level of interlobular duct cells and in vivo) were not different between WT and Slc26a6 null mice (Figs. 1 and 5). A possible explanation for this discrepancy is the presence of compensatory mechanisms that overcome the loss of Slc26a6. For example, there would be multiple HCO₃^– exit mechanisms on the luminal membrane of pancreatic duct cells and abolition of only one of these would not make significant changes in the overall fluid secretions. Indeed, this was the case in the salivary glands, where basolateral K⁺ channels in acinar cells play a major role in fluid secretion to maintain the membrane potential for Cl^– exit through luminal Cl^– channels. Salivary gland acinar cells express both intermediate (IK, also known as Sk4) and large (BK, also known as Slo) conductance Ca²⁺-activated K⁺ channels. Deletion of both K⁺ channels, but not the single deletion of each K⁺ channel, markedly decreased fluid secretion (26a). Therefore, a future study using the mice deleted with multiple luminal HCO₃^– transporters would be helpful further in identifying the role of Slc26a6 in pancreatic secretions.

There are few reliable data on in vivo fluid and HCO₃^– secretion from mouse pancreas (4) owing to the very small volume of secreted fluid. Fluid and HCO₃^– secretion was usually measured by collection of a mixture of bile-pancreatic juice (34) or duodenal aspiration (10). HCO₃^– concentration in a mixture of bile-pancreatic juice was 20–30 mM and did not significantly increase after stimulation (34). pH of duodenal aspiration after secretin stimulation was 8.1 in WT and 6.6 in cystic fibrosis mice (10). The present study for the first time successfully examined the volume and pH of pure pancreatic juice from mouse. Secretin stimulation increased juice pH from 7.50 to 7.59 in littermate controls, which represents 25% increase of HCO₃^– concentrations from 30.0 mmol/l in basal secretion to 37.1 mmol/l in secretin-stimulated secretion. However, secretin stimulation increased fluid secretion approximately by fourfold, from 0.12 to 0.45 µl·min^–1·g body wt^–1. These results imply that secretin may induce pancreatic secretion by augmenting the secretion of an ion besides HCO₃^– in mice. Importantly, neither juice volume nor HCO₃^– secretion were affected by the deletion of Slc26a6 (Fig. 5). Fluid secretory rate under stimulation with 1 µM of forskolin (maximal stimulation with cAMP) in interlobular ducts isolated from WT mice was 0.4 nl·min^–1·mm^–2, which is much smaller than secretory rate in guinea pig ducts (2.0 nl·min^–1·mm^–2, Ref. 38) and that in rat ducts (1.2 nl·min^–1·mm^–2, Ref. 20). Another group recently examined fluid secretion in mouse pancreatic ducts (8) and found that interlobular ducts secrete fluid in the absence of HCO₃^–, which depends on basolateral Na⁺-K⁺-2Cl^– cotransport. Thus the mouse pancreatic duct system probably secretes a mixture of NaHCO₃ and NaCl, which is consistent with our data of juice pH (7.6) (Fig. 5). These data indicate that the capacity of HCO₃^– and fluid transport of mouse pancreatic duct cells is significantly smaller than other species and that the mouse duct cells cannot raise luminal HCO₃^– concentration to higher than 50 mM. The contribution of Slc26a6 in ductal HCO₃^– secretion may be small in species such as mice that do not have a very high HCO₃^– concentration in their pancreatic juice. In pancreatic duct cells of human or guinea pig, which face pancreatic juice containing high HCO₃^– (up to 140 mM at maximal stimulation) and low Cl^–, Slc26a6 should play an important role to prevent HCO₃^– absorption.

Investigation into the electrogenicity of Slc26a6-mediated Cl^–/HCO₃^– exchange has been less than conclusive (7, 22, 28). However, an intriguing aspect is the interaction of Slc26 anion exchangers with CFTR (22). Recent studies demonstrated that CFTR interacts with Slc26a6 and Slc26a3 in a synergistic way (22). It was speculated that this interaction might play an important role in CFTR-dependent generation of HCO₃^–-rich pancreatic juice. The authors further suggested that expression of 2HCO₃^–-1Cl^– exchanger (i.e., Slc26a6) in the proximal duct and 1HCO₃^–-2Cl^– exchanger (i.e., Slc26a3) in the distal duct could explain HCO₃^–-rich (140 mM) fluid secretion (22).

The results of our studies are in agreement with a model in which two apical Cl^–/HCO₃^– exchangers with opposite stoichiometry exist in the apical membrane of the same cell. This model has been depicted in Fig. 7 and explains the present data. Figure 7, left simulates HCO₃^– and Cl^– transport across the apical membrane with high Cl^– in the lumen. It resembles in vivo condition of mouse pancreatic duct and also the experiments shown as Fig. 4 in which Cl^– was restored to the lumen. Figure 7, right simulates apical anion transport with 0 Cl^– in the lumen. It resembles in vivo condition of human and guinea pig pancreatic duct and also the experiments shown as Fig. 2 in which Cl^– was removed from the lumen. Our assumption is that 1) both nHCO₃^–-1Cl^– exchanger (i.e., Slc26a6) and 1HCO₃^–-nCl^– exchanger (i.e., Slc26a3) are localized in the apical membrane, and 2) the former is the dominant exchanger in WT ducts, whereas the latter is robustly upregulated in Slc26a6 null ducts. Our studies in Fig. 6 support the notion that Slc26a3 is the dominant apical exchanger in Slc26a6 KO mouse.

View larger version (14K): [in this window] [in a new window]   Fig. 7. Schematic diagram demonstrating apical and basolateral bicarbonate transporters in interlobular pancreatic duct.

When luminal Cl^– is removed, both anion exchangers (Fig. 7) work in an opposite direction (for HCO₃^– uptake). In WT ducts, cells uptake less HCO₃^– because nHCO₃^–-1Cl^– exchanger (Slc26a6) is dominant. The nHCO₃^–-1Cl^– exchanger does not work easily for HCO₃^– uptake when cell-negative membrane potential is maintained. In Slc26a6 –/– null ducts, the upregulated 1HCO₃^–-nCl^– exchanger, mediated via Dra, easily works for HCO₃^– uptake. Thus, the magnitude of enhanced intracellular alkalinization upon removal of luminal Cl^– is larger in Slc26a6 –/– null ducts.

In conclusion, the apical Cl^–/HCO₃^– exchanger activity is dramatically upregulated and cAMP-stimulated fluid secretion remains unchanged in interlobular pancreatic ducts in Slc26a6 null mice. In vivo pancreas, secretin-stimulated bicarbonate secretion, and juice volume remain unchanged in Slc26a6 KO animals. Slc26a3 expression in the pancreas is heavily upregulated in Slc26a6 null mice. We propose that deletion of Slc26a6 in pancreatic duct results in the compensatory upregulation of Slc26a3, which helps maintain bicarbonate secretion and pancreatic juice volume.

GRANTS

These studies were supported by the National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-62809 (M. Soleimani), Japan Society for the Promotion of Science (H. Ishiguro), and 03-PJ10-PG13-GD01-0002 from the Korea Health 21 R&D Project, Ministry of Health and Welfare, Korea (M. G. Lee).

FOOTNOTES

Address for reprint requests and other correspondence: H. Ishiguro, Nagoya Univ. Graduate School of Medicine, Nagoya, Japan (e-mail: ishiguro@htc.nagoya-u.ac.jp); M. Soleimani, Univ. of Cincinnati College of Medicine, 231 Albert Sabin Way MSB 259G, Cincinnati, OH 45267-0508 (e-mail: manoocher.soleimani{at}uc.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

REFERENCES

1. Alper SL. Genetic diseases of acid-base transporters. Annu Rev Physiol 64: 899–923, 2002.[CrossRef][Web of Science][Medline]
2. Alper SL, Darman RB, Chernova MN, Dahl NK. The AE gene family of Cl/HCO₃^– exchangers. J Nephrol 15, Suppl 5: S41–S53, 2002.
3. Alper SL. Molecular physiology of SLC4 anion exchangers. Exp Physiol 91: 153–161, 2006.[Abstract/Free Full Text]
4. Argent BE, Gray MA, Steward MC, Case RM. Cell physiology of pancreatic ducts. In: Physiology of the Gastrointestinal Tract (4^th ed.), edited by Johnson LR. San Diego, CA: Elsevier, 2005.
5. Argent BE, Githens S, Kalser S, Longnecker DS, Metzgar R, Williams JA. The pancreatic duct cell. Pancreas 7: 403–419, 1992.[Web of Science][Medline]
6. Ashton N, Argent BE, Green R. Characteristics of fluid secretion from isolated rat pancreatic ducts stimulated with secretin and bombesin. J Physiol 435: 533–546, 1991.[Abstract/Free Full Text]
7. Chernova MN, Jiang L, Friedman DJ, Darman RB, Lohi H, Kere J, Vandorpe DH, Alper SL. Functional comparison of mouse slc26a6 anion exchanger with human SLC26A6 polypeptide variants: differences in anion selectivity, regulation, and electrogenicity. J Biol Chem 280: 8564–8580, 2005.[Abstract/Free Full Text]
8. Dawson PA, Markovich D. Pathogenetics of the human SLC26 transporters. Curr Med Chem 12: 385–396, 2005.[Web of Science][Medline]
9. Fernandez-Salazar MP, Pascua P, Calvo JJ, Lopez MA, Case RM, Steward MC, and San Roman JI. Basolateral anion transport mechanisms underlying fluid secretion by mouse, rat and guinea-pig pancreatic ducts. J Physiol 556: 415–428, 2004.[Abstract/Free Full Text]
10. Freedman SD, Kern HF, Scheele GA. Pancreatic acinar cell dysfunction in CFTR(–/–) mice is associated with impairments in luminal pH and endocytosis. Gastroenterology 121: 950–957, 2001.[CrossRef][Web of Science][Medline]
11. Freedman SD, Scheele GA. Acid-base interactions during exocrine pancreatic secretion. Primary role for ductal bicarbonate in acinar lumen function. Ann NY Acad Sci 713: 199–206, 1994.[Web of Science][Medline]
12. Gray MA, Winpenny JP, Porteous DJ, Dorin JR, Argent BE. CFTR and calcium-activated chloride currents in pancreatic duct cells of a transgenic CF mouse. Am J Physiol Cell Physiol 266: C213–C221, 1994.[Abstract/Free Full Text]
13. Greeley T, Shumaker H, Wang Z, Schweinfest CW, Soleimani M. Downregulated in adenoma and putative anion transporter are regulated by CFTR in cultured pancreatic duct cells. Am J Physiol Gastrointest Liver Physiol 281: G1301–G1308, 2001.[Abstract/Free Full Text]
14. Ishiguro H, Steward MC, Lindsay AR, Case RM. Accumulation of intracellular HCO₃^– by Na⁺-HCO₃^– cotransport in interlobular ducts from guinea-pig pancreas. J Physiol 495: 169–178, 1996.[Abstract/Free Full Text]
15. Ishiguro H, Steward MC, Wilson RW, Case RM. Bicarbonate secretion in interlobular ducts from guinea-pig pancreas. J Physiol 495: 179–191, 1996.[Abstract/Free Full Text]
16. Ishiguro H, Naruse S, Steward MC, Kitagawa M, Ko SB, Hayakawa T, Case RM. Fluid secretion in interlobular ducts isolated from guinea-pig pancreas. J Physiol 511: 407–422, 1998.[Abstract/Free Full Text]
17. Ishiguro H, Naruse S, Kitagawa M, Hayakawa T, Case RM, Steward MC. Luminal ATP stimulates fluid and HCO₃^– secretion in guinea-pig pancreatic duct. J Physiol 519: 551–558, 1999.[Abstract/Free Full Text]
18. Ishiguro H, Naruse S, Kitagawa M, Suzuki A, Yamamoto A, Hayakawa T, Case RM, Steward MC. CO₂ permeability and bicarbonate transport in microperfused interlobular ducts isolated from guinea-pig pancreas. J Physiol 528: 305–315, 2000.[Abstract/Free Full Text]
19. Ko SB, Luo X, Hager H, Rojek A, Choi JY, Licht C, Suzuki M, Muallem S, Nielsen S, Ishibashi K. AE4 is a DIDS-sensitive Cl^–/HCO₃^– exchanger in the basolateral membrane of the renal CCD and the SMG duct. Am J Physiol Cell Physiol 283: C1206–C1218, 2002.[Abstract/Free Full Text]
20. Ko SBH, Naruse S, Kitagawa M, Ishiguro H, Furuya S, Mizuno N, Wang Y, Yoshikawa T, Suzuki A, Shimano S, Hayakawa T. Aquaporins in rat pancreatic interlobular ducts. Am J Physiol Gastrointest Liver Physiol 282: G324–G331, 2002.[Abstract/Free Full Text]
21. Ko SB, Shcheynikov N, Choi JY, Luo X, Ishibashi K, Thomas PJ, Kim JY, Kim KH, Lee MG, Naruse S, Muallem S. A molecular mechanism for aberrant CFTR-dependent HCO₃^– transport in cystic fibrosis. EMBO J 21: 5662–5672, 2002.[CrossRef][Web of Science][Medline]
22. Ko SB, Zeng W, Dorwart MR, Luo X, Kim KH, Millen L, Goto H, Naruse S, Soyombo A, Thomas PJ, Muallem S. Gating of CFTR by the STAS domain of SLC26 transporters. Nat Cell Biol 6: 343–350, 2004.[CrossRef][Web of Science][Medline]
23. Lohi H, Kujala M, Kerkela E, Saarialho-Kere U, Kestila M, Kere J. Mapping of five new putative anion transporter genes in human and characterization of SLC26A6, a candidate gene for pancreatic anion exchanger. Genomics 70: 102–112, 2000.[CrossRef][Web of Science][Medline]
24. Lohi H, Kujala M, Makela S, Lehtonen E, Kestila M, Saarialho-Kere U, Markovich D, Kere J. Functional characterization of three novel tissue-specific anion exchangers SLC26A7, -A8, and -A9. J Biol Chem 277: 14246–14254, 2002.[Abstract/Free Full Text]
25. Mount DB, Romero MF. The SLC26 gene family of multifunctional anion exchangers. Pflügers Arch 447: 710–721, 2004.[CrossRef][Web of Science][Medline]
26. Novak I. Keeping up with bicarbonate. J Physiol 528: 235, 2000.[Free Full Text]
26. Romanenko VG, Tetsuji N, Begenisich T, Melvin J. Use of knockout mice to dissect the role of K⁺ channels in submandibular gland function. Frontiers in Epithelial Transport, Focused Meeting of The Physiological Society, Manchester, UK, April 2006, p. 31.
27. Romero MF. Molecular pathophysiology of SLC4 bicarbonate transporters. Curr Opin Nephrol Hypertens 14: 495–501, 2005.[Web of Science][Medline]
28. Shcheynikov N, Wang Y, Park M, Ko SB, Dorwart M, Naruse S, Thomas PJ, Muallem S. Coupling modes and stoichiometry of Cl^–/HCO₃^– exchange by slc26a3 and slc26a6. J Gen Physiol 127: 511–524, 2006.[Abstract/Free Full Text]
29. Shumaker H, Amlal H, Frizzell R, Ulrich CD, Soleimani M. CFTR drives Na⁺-nHCO^–₃ cotransport in pancreatic duct cells: a basis for defective HCO^–₃ secretion in CF. Am J Physiol Cell Physiol 276: C16–C25, 1999.[Abstract/Free Full Text]
30. Sohma Y, Gray MA, Imai Y, Argent BE. HCO₃^– transport in a mathematical model of the pancreatic ductal epithelium. J Membr Biol 176: 77–100, 2000.[CrossRef][Web of Science][Medline]
31. Soleimani M, Ulrich CD. How cystic fibrosis affects pancreatic ductal bicarbonate secretion. Med Clin North Am 84: 641–655, x, 2000.[CrossRef][Web of Science][Medline]
32. Soleimani M, Xu J. The role of SLC26 chloride/base exchangers in the kidney in health and disease. Semin Nephrology. In Press.
33. Steward MC, Ishiguro H, Case RM. Mechanisms of bicarbonate secretion in the pancreatic duct. Annu Rev Physiol 67: 377–409, 2005.[CrossRef][Web of Science][Medline]
34. Takiguchi S, Suzuki S, Sato Y, Kanai S, Miyasaka K, Jimi A, Shinozaki H, Takata Y, Funakoshi A, Kono A, Minowa O, Kobayashi T, Noda T. Role of CCK-A receptor for pancreatic function in mice: a study in CCK-A receptor knockout mice. Pancreas 24: 276–283, 200.
35. Thomas JA, Buchsbaum RN, Zimniak A, Racker E. Intracellular pH measurements in Ehrlich ascites tumor cells utilizing spectroscopic probes generated in situ. Biochemistry 18: 2210–2218, 1979.[CrossRef][Medline]
36. Tsuganezawa H, Kobayashi K, Iyori M, Araki T, Koizumi A, Watanabe S, Kaneko A, Fukao T, Monkawa T, Yoshida T, Kim DK, Kanai Y, Endou H, Hayashi M, Saruta T. A new member of the HCO3^– transporter superfamily is an apical anion exchanger of beta-intercalated cells in the kidney. J Biol Chem 276: 8180–8189, 2001.[Abstract/Free Full Text]
37. Tuo B, Riederer B, Wang Z, Colledge WH, Soleimani M, Seidler U. Involvement of the anion exchanger SLC26A6 in prostaglandin E2- but not forskolin-stimulated duodenal. Gastroenterology 130: 349–358, 2006.[CrossRef][Web of Science][Medline]
38. Wang Z, Petrovic S, Mann E, Soleimani M. Identification of an apical Cl^–/HCO3^– exchanger in the small intestine. Am J Physiol Gastrointest Liver Physiol 282: G573–G579, 2002.[Abstract/Free Full Text]
39. Wang Z, Wang T, Petrovic S, Tuo B, Riederer B, Barone S, Lorenz JN, Seidler U, Aronson PS, Soleimani M. Renal and intestinal transport defects in Slc26a6-null mice. Am J Physiol Cell Physiol 288: C957–C965, 2005.[Abstract/Free Full Text]
40. Whitcomb DC, Ermentrout GB. A mathematical model of the pancreatic duct cell generating high bicarbonate concentrations in pancreatic juice. Pancreas 29: e30–e40, 2004.[CrossRef][Web of Science][Medline]
41. Xu J, Barone S, Petrovic S, Wang Z, Seidler U, Riederer B, Ramaswamy K, Dudeja PK, Shull GE, Soleimani M. Identification of an apical Cl^–/HCO₃^– exchanger in gastric surface mucous and duodenal villus cells. Am J Physiol Gastrointest Liver Physiol 285: G1225–G1234, 2003.[Abstract/Free Full Text]
42. Xu J, Henriksnas J, Barone S, Witte D, Shull GE, Forte JG, Holm L, Soleimani M. SLC26A9 is expressed in gastric surface epithelial cells, mediates Cl^–/HCO₃^– exchange, and is inhibited by NH4⁺. Am J Physiol Cell Physiol 289: C493–C505, 2005.[Abstract/Free Full Text]
43. Yamamoto A, Ishiguro H, Ko SB, Suzuki A, Wang Y, Hamada H, Mizuno N, Kitagawa M, Hayakawa T, Naruse S. Ethanol induces fluid hypersecretion from guinea-pig pancreatic duct cells. J Physiol 551: 917–926, 2003.[Abstract/Free Full Text]

This article has been cited by other articles:

				M.-H. Chang, C. Plata, A. Sindic, W. K. Ranatunga, A.-P. Chen, K. Zandi-Nejad, K. W. Chan, J. Thompson, D. B. Mount, and M. F. Romero Slc26a9 Is Inhibited by the R-region of the Cystic Fibrosis Transmembrane Conductance Regulator via the STAS Domain J. Biol. Chem., October 9, 2009; 284(41): 28306 - 28318. [Abstract] [Full Text] [PDF]

				A. K. Stewart, A. Yamamoto, M. Nakakuki, T. Kondo, S. L. Alper, and H. Ishiguro Functional coupling of apical Cl-/HCO3- exchange with CFTR in stimulated HCO3- secretion by guinea pig interlobular pancreatic duct Am J Physiol Gastrointest Liver Physiol, June 1, 2009; 296(6): G1307 - G1317. [Abstract] [Full Text] [PDF]

				M. R. Dorwart, N. Shcheynikov, D. Yang, and S. Muallem The Solute Carrier 26 Family of Proteins in Epithelial Ion Transport Physiology, April 1, 2008; 23(2): 104 - 114. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 292/1/G447    most recent 00286.2006v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Web of Science (10) Citing Articles via Google Scholar Google Scholar Articles by Ishiguro, H. Articles by Soleimani, M. Search for Related Content PubMed PubMed Citation Articles by Ishiguro, H. Articles by Soleimani, M.