|
|
||||||||
REPORTS
1Laboratory of Human Nutrition, Nagoya University Graduate School of Medicine, Nagoya, Japan; 2Department of Pharmacology, Institute of Gastroenterology, Yonsei University College of Medicine, Seoul, Korea; and Departments of 3Medicine and 4Surgery, University of Cincinnati and 5Veterans Administration Medical Center, Cincinnati, Ohio
Submitted 30 June 2006 ; accepted in final form 8 August 2006
ABSTRACT
The role of Slc26a6 (PAT1) on apical Cl/HCO3 exchange and bicarbonate secretion in pancreatic duct cells was investigated using Slc26a6 null and wild-type (WT) mice. Apical Cl/HCO3 exchange activity was measured with the pH-sensitive dye BCECF in microperfused interlobular ducts. The HCO3-influx mode of apical [Cl]i/[HCO3]o exchange (where brackets denote concentration and subscripts i and o denote intra- and extracellular, respectively) was dramatically upregulated in Slc26a6 null mice (P < 0.01 vs. WT), whereas the HCO3-efflux mode of apical [Cl]o/[HCO3]i exchange was decreased in Slc26a6 null mice (P < 0.05 vs. WT), suggesting the unidirectionality of the Slc26a6-mediated HCO3 transport. Fluid secretory rate in interlobular ducts were comparable in WT and Slc26a6 null mice (P > 0.05). In addition, when pancreatic juice was collected from whole animal in basal and secretin-stimulated conditions, neither juice volume nor its pH showed differences between WT and Slc26a6 null mice. Semiquantitative RT-PCR demonstrated more than fivefold upregulation in Slc26a3 (DRA) expression in Slc26a6 knockout pancreas. In conclusion, these results point to the role of Slc26a6 in HCO3 efflux at the apical membrane and also suggest the presence of a robust Slc26a3 compensatory upregulation, which can replace the function of Slc26a6 in pancreatic ducts.
cystic fibrosis transmembrane regulator; cystic fibrosis; sodium bicarbonate exchanger; HCO3 secretion; HCO3 transporters; downregulated in adenoma; putative anion transporter 1
Identifying the apical Cl/HCO3 exchanger(s) in the pancreatic duct has been the subject of numerous investigations. Molecular cloning studies have identified two distinct families of anion exchangers: SLC4 and SLC26. The SLC4 family includes four distinct Na-independent Cl/HCO3 exchangers known as AE1, AE2, AE3, and AE4, with AE1, 2, and 3 exclusively located on the basolateral membrane of epithelial cells (1, 2, 3, 27). AE4 is expressed in the apical membrane of duodenocytes, but its subcellular distribution in the kidney remains controversial (18, 36, 41).
SLC26 isoforms are members of a large, conserved family of anion exchangers, many of which display highly restricted and distinct tissue distribution and share no significant homology to AEs. Overall, ten SLC26 genes or isoforms (SLC26A111) have been cloned (8, 23, 24, 25, 32). Several SLC26 isoforms function as Cl/HCO3 exchangers. These include SLC26A3 (DRA), SLC26A6 (PAT1), SLC26A7 (PAT2), and SLC26A9 (PAT4), with PAT1 and DRA detected on the apical membrane of pancreatic ducts cells (13, 21, 22, 42).
SLC26A6 (PAT1) is a major apical Cl/HCO3 exchanger in the small intestine and mediates majority of PGE2-stimulated bicarbonate secretion in the duodenum (37, 38, 39). On the basis of its localization in the apical membrane of the pancreatic duct and its function as a Cl/HCO3 exchanger, PAT1 has been proposed to be a major contributor to apical HCO3 secretion in the pancreatic duct (13). To ascertain its role in apical Cl/HCO3 exchange and bicarbonate secretion in the pancreatic duct, Slc26a6 null mice and their wild-type (WT) littermates were examined. The results indicated that PAT1 null mice display an intriguing pattern of adaptation in apical Cl/HCO3 exchanger activity in their pancreatic duct cells.
METHODS AND MATERIALS
The following studies were approved by the Ethical Committee on Animal Use for Experiment and Recombinant DNA Experiment Safety Committee of Nagoya University, Japan and by the Committees for the Care and Use of Laboratory Animals at Yonsei University College of Medicine, South Korea and at University of Cincinnati, Cincinnati OH.
Mouse model. Slc26a6 knockout (KO) mice and their WT littermates were used for the experiments. Targeted 129 stem cells were implanted in a C57/BL6 blastocyst, the chimerical mice were bred to C57/BL6, and the progeny were studied (39). The animals used for these studies had been bred for five generations.
Collection and pH measurement of pancreatic juice. SL26A6 gene-disrupted (/) and littermate control mice were fasted overnight and then anesthetized with ketamine (3 mg/20 g body wt) and xylazine (0.2 mg/20 g body wt) by intramuscular injection. The body temperature of mice were maintained by placing the mice on a warm pad (37°C) during the experiments. The abdomen was opened, and the lumen of the common pancreaticobiliary duct was cannulated with a modified 31-gauge needle (TSK Striject, Air-Tite, Virginia Beach, VA). After the proximal end of the common duct was ligated to prevent contamination of bile, the pancreatic juice was collected in PE-10 tube for 30 min. Secreted volume was calibrated by measuring the length of the PE-10 tube filled with pancreatic juice. Mice were then treated with secretin (Sigma, 1 CU/kg sc), and the pancreatic juice was further collected in another PE-10 tube for 30 min after a 5-min interval from the secretin treatment. The collected pancreatic juices were transferred to microtubes embedded with mineral oil to prevent evaporation. The pancreatic juice was then equilibrated with 5% CO2 for 20 min, and the pH of pancreatic juice was measured by using a glass micro-pH combination electrode (Thermo Electron, Beverly, MA).
Isolation of interlobular ducts.
Interlobular pancreatic ducts (diameter
100 µm) were isolated as described previously (12). Mice were killed by cervical dislocation. The pancreas was removed and chopped with scissors into
1-mm3 pieces. The tissue was digested with collagenase and hyaluronidase. Interlobular duct segments were microdissected by using sharpened needles under a dissection microscope. Usually 1015 interlobular duct segments of 300400 µm in length were isolated from one pancreas. The ducts were cultured overnight, during which time the end of the duct segment sealed spontaneously.
Solutions. The standard HCO3-buffered solution contained (in mM) 115 NaCl, 5 KCl, 1 CaCl2, 1 MgCl2, 10 D-glucose, and 25 NaHCO3 and was equilibrated with 95% O2 + 5% CO2. Cl-free HCO3-buffered solutions were made by replacing Cl with glucuronate. High-K+ (70 mM) HCO3-buffered solutions were made by replacing Na+. All solutions were adjusted to pH 7.4 at 37°C.
Measurement of fluid secretory rate.
The fluid secretory rate in isolated ducts was measured with videomicroscopy as described previously (43). The ducts were attached to glass coverslips pretreated with Cell-Tak and were superfused at 37°C on the stage of an inverted microscope. The bright-field images of the ducts were obtained at 5-min intervals by use of a charge-coupled device camera. The initial values for the length (L0), diameter (2R0), and image area (A0) of the duct lumen were measured in the first image of the series. The initial volume (V0) of the duct lumen was calculated, assuming cylindrical geometry, as
R02L0. The luminal surface area of the epithelium (So) was taken to be 2
R0L0. In subsequent images of the series, the luminal image area (A) was expressed as relative area (A/A0). Relative volume (V/V0) was estimated from relative area using V/V0 = (A/A0)3/2. The rate of fluid secretion was calculated from the increment in volume and expressed as the secretory rate per unit luminal area of epithelium (nl·min1·mm2).
Microperfusion of the isolated interlobular ducts. The lumen of the interlobular duct segment was microperfused as described previously (15). Both ends of the duct were cut open with sharpened needles, and one end was cannulated with concentric holding and perfusion pipettes. The bath and luminal solutions were modified separately. The bath was continuously perfused at 37°C.
Measurement of intracellular pH. Intracellular pH (pHi) in the duct cells was estimated by microfluorometry as described previously (18) using the pH-sensitive fluoroprobe BCECF. After cannulation of the duct for luminal perfusion, the duct cells were loaded with BCECF for 10 min by adding acetoxymethyl ester BCECF-AM (2 µM) to the bathing solution. Small regions of the duct epithelium (1020 cells) were illuminated alternately at excitation wavelengths of 430 and 480 nm. Values of pHi were calculated from the fluorescence ratio (F480/F430) measured at 530 nm. The system was calibrated by the high-K+/nigericin technique (35).
Semiquantitative RT-PCR of apical anion exchangers. RNA isolated from pancreas of WT and Slc26a6 KO mice was examined for the expression of Slc26a3, which is the only other known apical Cl/HCO3 exchanger detected in the pancreatic duct (13). In addition, the expression of Slc26a4 (PDS, pendrin), Slc26a11, and Slc4a9 (AE4), the other known apical anion exchangers in epithelial tissues, was examined. For Slc26a3, the following oligonucleotide primers from exon 2 were synthesized and utilized for RT-PCR: 5'- GGCAAAATGATCGAAGCCATAGGG (sense) and 5'-GATGGTCCAGGAATGTC TTGTGATGTC (antisense). The cycling parameters were 94°C, 1 min, then 94°C, 30 s, 68°C, 3 min, 32 cycles. For control in RNA loading, the following oligonucleotide primers from 18S rRNA were used: 5'-CCAGTAAGTGCGGGTCATAAGC (sense) and 5'-GATCCGAGGGCCTCACTAAACC (antisense). This fragment encompasses nucleotides 16451747. For Slc26a4 (PDS or pendrin), the primers TCC CGG TGA AAG TGA ATG TC (sense), and CGC AAT GAC CTC ACT CCT AC (antisense) (accession number NM_011867); for Slc26a11, the primers GGT TCT GGA GTG CAC GCA TAT C (sense), and AAC AAA GGC CAG GGC GAC TC (antisense) (accession number NM_178743); and for Slc4a9 (AE4), the primers CAG AGG AGG AGG AGA CCA TC (sense), and GAT GTT GAT TTC TGG AGC CTT G (antisense) (accession number NM_172830) were used.
Materials. BCECF-AM was obtained from Molecular Probes (Eugene, OR), forskolin was from Sigma (St. Louis, MO), and secretin was from Peptide Institute.
Statistics. Data are presented as the means ± SE unless otherwise indicated. Tests for statistically significant differences were made with Student's t-test.
RESULTS
Basal and forskolin-stimulated fluid secretion in sealed interlobular ducts isolated from WT and Slc26a6 / mice. Isolated interlobular ducts were superfused with the standard HCO3-CO2-buffered solution at 37°C and were then stimulated by forskolin (1 µM), an activator of adenylate cyclase, in the bath. The rate of basal fluid secretion was 0.18 ± 0.05 nl·min1·mm2 (n = 5) in WT ducts and 0.22 ± 0.05 (n = 4) in Slc26a6 / ducts (Fig. 1). The rate of forskolin-stimulated fluid secretion was 0.42 ± 0.02 nl·min1·mm2 in WT ducts and 0.53 ± 0.07 in Slc26a6 / ducts. Basal and forskolin-stimulated fluid secretion were not different between WT and Slc26a6 / ducts.
|
|
Effects of luminal Cl removal on pHi in microperfused interlobular pancreatic ducts isolated from Slc26a6 / mice. Basal pHi of Slc26a6 / ducts in the presence of 25 mM HCO3-5% CO2 was 7.322 ± 0.015 (n = 10), which was not different from that of WT ducts. Surprisingly, removal of luminal Cl (Fig. 2) caused a much larger (P < 0.01) increase of pHi in Slc26a6 / ducts (0.313 ± 0.042 units in 5 min in unstimulated condition and 0.325 ± 0.062 under forskolin stimulation, n = 5) than in WT ducts (representative tracings as Fig. 2A and averaged responses as Fig. 2C). Forskolin stimulation did not cause significant changes in basal pHi.
Imposition of high K+ gradient in the bath caused a small decrease in basal pHi by 0.053 ± 0.005 (n = 5) in 3 min under forskolin stimulation, which is also in contrast to WT ducts (Fig. 2, A and B, in magnified scale). Removal of luminal Cl under high-K+ conditions caused further increase of pHi.
Effects of luminal and bath Cl removal on pHi in microperfused interlobular pancreatic ducts isolated from WT and Slc26a6 / mice. In the next set of experiments, we examined the effect of bath chloride removal on intracellular pH. In WT animals, the increase of pHi by luminal Cl removal was much smaller than that by Cl removal from the bath (0.335 ± 0.054 in 5 min, n = 5, Fig. 3). This is similar to the findings in interlobular ducts from guinea pig pancreas (16). In Slc26a6 null animals, the increase in pHi by Cl removal from the bath (0.130 ± 0.064 in 5 min, n = 5, Fig. 3) was smaller (P < 0.05) than that in WT ducts. These data suggest that another apical Cl/HCO3 exchanger is upregulated and basolateral Cl/HCO3 exchanger is downregulated in Slc26a6 / ducts.
|
30 min before measurement. Initial pHi was not different between WT (7.93 ± 0.02, n = 6) and Slc26a6 / ducts (7.90 ± 0.02, n = 6). After a 3-min period, the luminal solution was switched to standard HCO3-buffered solution containing 124 mM Cl in the presence of forskolin. The rate of pHi decrease on restoring luminal Cl was 0.334 ± 0.053 pH units/min in WT ducts and 0.196 ± 0.028 pH units/min (n = 6) in Slc26a6 / ducts. The activities of apical Cl/HCO3 exchange working for HCO3 efflux were significantly (P < 0.05) smaller in Slc26a6 / ducts.
|
|
|
The present studies examined the role of Slc26a6 (PAT1) in apical Cl/HCO3 exchange and fluid secretion in interlobular pancreatic duct cells and pancreatic fluid and HCO3 secretion in vivo by using Slc26a6 null mice. Our results demonstrated the unexpected, and seemingly paradoxical, upregulation of apical Cl/HCO3 exchanger activity ([Cl]i/[HCO3]o exchange, where brackets denote concentration and subscripts i and o denote intra- and extracellular, respectively) in interlobular ducts of Slc26a6 null animals (Fig. 2). To examine the exchange activity of intracellular HCO3 for luminal Cl across the apical membrane, the interlobular duct cells were depleted of Cl (Fig. 4). This time, however, the apical Cl/HCO3 exchanger activity ([Cl]o/[HCO3]i exchange) was actually decreased in Slc26a6 null mice. Absence of Slc26a6 did not affect basal and cAMP-stimulated fluid secretion in isolated interlobular ducts superfused with the standard HCO3buffered solution (Fig. 1). Similarly, the volume and pH of pure pancreatic juice collected in vivo at both basal and secretin-stimulated conditions were comparable in WT and Slc26a6 null mice (Fig. 5). Slc26a3 (DRA) is strongly upregulated in Slc26a6 KO mouse pancreas (Fig. 6).
As noted, the increase in pHi (mostly due to apical HCO3 influx) on removal of luminal Cl was much larger in Slc26a6 / ducts (Fig. 2). These data are consistent with either the inhibitory effect of Slc26a6 on HCO3 influx in WT animals or the activation of a distinct apical anion exchanger in Slc26a6 null mice. Assuming that Slc26a6 is an electrogenic Cl/HCO3 exchanger with nHCO3 exchanged per Cl, where n is >1, as proposed (28), WT animals may have difficulty taking up HCO3 in native hyperpolarized epithelia in response to Cl removal from the luminal perfusate. This could explain the small effect of luminal Cl removal on intracellular pH in WT ducts (Fig. 2) and in guinea pig ducts (18). Enhanced intracellular alkalinization upon removal of luminal Cl in Slc26a6 null mice (Fig. 2) suggests that another Cl/HCO3 exchanger is upregulated in the apical membrane. Anion exchanger with stoichiometry of >2:1 Cl:HCO3 (compatible with Slc26a3; DRA, Refs. 22, 28) would easily uptake HCO3 when luminal Cl is removed. However, the intracellular alkalinization may also occur by apical HCO3 influx through CFTR and basolateral HCO3 influx via Na+-nHCO3 cotransport, both of which may be activated by depolarization. The former possibility is unlikely because intracellular HCO3 concentration would not exceed luminal HCO3 concentration unless the cells were highly depolarized to approximately zero. In fact, removal of luminal Cl caused pHi increase to
7.7 in Slc26a6 null ducts (Fig. 2A). The extent of intracellular alkalinization upon removal of perfusate chloride may be determined by the electrogenicity of the chloride/base exchanger, the magnitude of membrane potential, and intracellular Cl concentration. It is worth mentioning that these two last parameters may differ between WT and Slc26a6 / ducts and also may be altered by cAMP stimulation. As indicated the activity of basolateral Cl-HCO3 exchange is reduced in Slc26a6 null ducts (Fig. 3). Downregulation of basolateral Cl/HCO3 exchanger (possibly AE2) would be beneficial for HCO3 secretion (analogous to a compensatory regulation) because it works as a base extruder.
Effects of depolarization (by high-K+ in the bath) on pHi were opposite in WT and Slc26a6 null ducts (Fig. 2); depolarization caused a small increase of pHi in WT but caused a decrease in Slc26a6 null ducts, which is compatible to the electrogenic property of Slc26a6. The increase in intracellular HCO3 concentration in WT ducts can be explained by combination of the depolarization-induced inhibition of Slc26a6-mediated exchange of luminal 1Cl for intracellular nHCO3 and an apical HCO3 conductance, and by depolarization-induced activation of basolateral Na+-nHCO3 cotransport. On the contrary, the reduction in intracellular HCO3 concentration in Slc26a6 null ducts can be explained by the activation of apical Cl/HCO3 exchanger of opposite stoichiometry (nCl/1HCO3 exchange), which seems to be upregulated in Slc26a6 null ducts as shown in Fig. 2A.
Although there were significant changes in the apical Cl/HCO3 exchange activity (Figs. 2 and 4), the overall pancreatic fluid and bicarbonate secretions (both at the level of interlobular duct cells and in vivo) were not different between WT and Slc26a6 null mice (Figs. 1 and 5). A possible explanation for this discrepancy is the presence of compensatory mechanisms that overcome the loss of Slc26a6. For example, there would be multiple HCO3 exit mechanisms on the luminal membrane of pancreatic duct cells and abolition of only one of these would not make significant changes in the overall fluid secretions. Indeed, this was the case in the salivary glands, where basolateral K+ channels in acinar cells play a major role in fluid secretion to maintain the membrane potential for Cl exit through luminal Cl channels. Salivary gland acinar cells express both intermediate (IK, also known as Sk4) and large (BK, also known as Slo) conductance Ca2+-activated K+ channels. Deletion of both K+ channels, but not the single deletion of each K+ channel, markedly decreased fluid secretion (26a). Therefore, a future study using the mice deleted with multiple luminal HCO3 transporters would be helpful further in identifying the role of Slc26a6 in pancreatic secretions.
There are few reliable data on in vivo fluid and HCO3 secretion from mouse pancreas (4) owing to the very small volume of secreted fluid. Fluid and HCO3 secretion was usually measured by collection of a mixture of bile-pancreatic juice (34) or duodenal aspiration (10). HCO3 concentration in a mixture of bile-pancreatic juice was 2030 mM and did not significantly increase after stimulation (34). pH of duodenal aspiration after secretin stimulation was
8.1 in WT and
6.6 in cystic fibrosis mice (10). The present study for the first time successfully examined the volume and pH of pure pancreatic juice from mouse. Secretin stimulation increased juice pH from 7.50 to 7.59 in littermate controls, which represents
25% increase of HCO3 concentrations from 30.0 mmol/l in basal secretion to 37.1 mmol/l in secretin-stimulated secretion. However, secretin stimulation increased fluid secretion approximately by fourfold, from 0.12 to 0.45 µl·min1·g body wt1. These results imply that secretin may induce pancreatic secretion by augmenting the secretion of an ion besides HCO3 in mice. Importantly, neither juice volume nor HCO3 secretion were affected by the deletion of Slc26a6 (Fig. 5). Fluid secretory rate under stimulation with 1 µM of forskolin (maximal stimulation with cAMP) in interlobular ducts isolated from WT mice was
0.4 nl·min1·mm2, which is much smaller than secretory rate in guinea pig ducts (
2.0 nl·min1·mm2, Ref. 38) and that in rat ducts (
1.2 nl·min1·mm2, Ref. 20). Another group recently examined fluid secretion in mouse pancreatic ducts (8) and found that interlobular ducts secrete fluid in the absence of HCO3, which depends on basolateral Na+-K+-2Cl cotransport. Thus the mouse pancreatic duct system probably secretes a mixture of NaHCO3 and NaCl, which is consistent with our data of juice pH (
7.6) (Fig. 5). These data indicate that the capacity of HCO3 and fluid transport of mouse pancreatic duct cells is significantly smaller than other species and that the mouse duct cells cannot raise luminal HCO3 concentration to higher than 50 mM. The contribution of Slc26a6 in ductal HCO3 secretion may be small in species such as mice that do not have a very high HCO3 concentration in their pancreatic juice. In pancreatic duct cells of human or guinea pig, which face pancreatic juice containing high HCO3 (up to
140 mM at maximal stimulation) and low Cl, Slc26a6 should play an important role to prevent HCO3 absorption.
Investigation into the electrogenicity of Slc26a6-mediated Cl/HCO3 exchange has been less than conclusive (7, 22, 28). However, an intriguing aspect is the interaction of Slc26 anion exchangers with CFTR (22). Recent studies demonstrated that CFTR interacts with Slc26a6 and Slc26a3 in a synergistic way (22). It was speculated that this interaction might play an important role in CFTR-dependent generation of HCO3-rich pancreatic juice. The authors further suggested that expression of 2HCO3-1Cl exchanger (i.e., Slc26a6) in the proximal duct and 1HCO3-2Cl exchanger (i.e., Slc26a3) in the distal duct could explain HCO3-rich (140 mM) fluid secretion (22).
The results of our studies are in agreement with a model in which two apical Cl/HCO3 exchangers with opposite stoichiometry exist in the apical membrane of the same cell. This model has been depicted in Fig. 7 and explains the present data. Figure 7, left simulates HCO3 and Cl transport across the apical membrane with high Cl in the lumen. It resembles in vivo condition of mouse pancreatic duct and also the experiments shown as Fig. 4 in which Cl was restored to the lumen. Figure 7, right simulates apical anion transport with 0 Cl in the lumen. It resembles in vivo condition of human and guinea pig pancreatic duct and also the experiments shown as Fig. 2 in which Cl was removed from the lumen. Our assumption is that 1) both nHCO3-1Cl exchanger (i.e., Slc26a6) and 1HCO3-nCl exchanger (i.e., Slc26a3) are localized in the apical membrane, and 2) the former is the dominant exchanger in WT ducts, whereas the latter is robustly upregulated in Slc26a6 null ducts. Our studies in Fig. 6 support the notion that Slc26a3 is the dominant apical exchanger in Slc26a6 KO mouse.
|
When luminal Cl is removed, both anion exchangers (Fig. 7) work in an opposite direction (for HCO3 uptake). In WT ducts, cells uptake less HCO3 because nHCO3-1Cl exchanger (Slc26a6) is dominant. The nHCO3-1Cl exchanger does not work easily for HCO3 uptake when cell-negative membrane potential is maintained. In Slc26a6 / null ducts, the upregulated 1HCO3-nCl exchanger, mediated via Dra, easily works for HCO3 uptake. Thus, the magnitude of enhanced intracellular alkalinization upon removal of luminal Cl is larger in Slc26a6 / null ducts.
In conclusion, the apical Cl/HCO3 exchanger activity is dramatically upregulated and cAMP-stimulated fluid secretion remains unchanged in interlobular pancreatic ducts in Slc26a6 null mice. In vivo pancreas, secretin-stimulated bicarbonate secretion, and juice volume remain unchanged in Slc26a6 KO animals. Slc26a3 expression in the pancreas is heavily upregulated in Slc26a6 null mice. We propose that deletion of Slc26a6 in pancreatic duct results in the compensatory upregulation of Slc26a3, which helps maintain bicarbonate secretion and pancreatic juice volume.
GRANTS
These studies were supported by the National Institute of Diabetes and Digestive and Kidney Diseases Grant DK-62809 (M. Soleimani), Japan Society for the Promotion of Science (H. Ishiguro), and 03-PJ10-PG13-GD01-0002 from the Korea Health 21 R&D Project, Ministry of Health and Welfare, Korea (M. G. Lee).
Address for reprint requests and other correspondence: H. Ishiguro, Nagoya Univ. Graduate School of Medicine, Nagoya, Japan (e-mail: ishiguro@htc.nagoya-u.ac.jp); M. Soleimani, Univ. of Cincinnati College of Medicine, 231 Albert Sabin Way MSB 259G, Cincinnati, OH 45267-0508 (e-mail: manoocher.soleimani{at}uc.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
REFERENCES
This article has been cited by other articles:
![]() |
M. R. Dorwart, N. Shcheynikov, D. Yang, and S. Muallem The Solute Carrier 26 Family of Proteins in Epithelial Ion Transport Physiology, April 1, 2008; 23(2): 104 - 114. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |