AJP - GI Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 293: G817-G823, 2007. First published August 9, 2007; doi:10.1152/ajpgi.00209.2007
0193-1857/07 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/4/G817    most recent
00209.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shang, Q.
Right arrow Articles by Xu, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shang, Q.
Right arrow Articles by Xu, G.

LIVER AND BILIARY TRACT

An overlapping binding site in the CYP7A1 promoter allows activation of FXR to override the stimulation by LXR{alpha}

Quan Shang,1 Luxing Pan,2 Monica Saumoy,1 John Y. L. Chiang,3 G. Stephen Tint,1,2 Gerald Salen,1 and Guorong Xu1,2

1Department of Medicine, University of Medicine and Dentistry of New Jersey, New Jersey Medical School, Newark, New Jersey; 2Medical Research Service, Veterans Affairs Medical Center, East Orange, New Jersey; 3Department of Biochemistry and Molecular Pathology, Northeastern Ohio University College of Medicine, Rootstown, Ohio

Submitted 8 May 2007 ; accepted in final form 4 August 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
The aim of this study was to explore why in rabbits activation of farnesoid X receptor (FXR) is dominant over activated liver X receptor-{alpha} (LXR{alpha}) in the regulation of CYP7A1. We cloned the rabbit CYP7A1 promoter and found a fetoprotein transcription factor (FTF) binding element embedded within the LXR{alpha} binding site (LXRE). Gel shift assays demonstrated that FTF competes with LXR{alpha} for binding to LXRE. Short heterodimer partner (SHP) enhances the competitive ability of FTF. Studies in HepG2 cells showed that SHP combined with FTF had more powerful effect to offset the stimulation of CYP7A1 by LXR{alpha}. Gel shift and chromatin immunoprecipitation assays demonstrated that SHP with FTF diminished LXR{alpha} binding to the CYP7A1 promoter. In vivo studies in rabbits fed cholesterol for 10 days showed that hepatic expression of SHP but not FTF rose and LXR{alpha}-bound LXRE decreased. We propose that the SHP/FTF heterodimer occupies LXRE via the embedded FTF binding element and blocks LXR{alpha} from recruiting to LXRE. Therefore, activation of FXR, which upregulates SHP expression, will eliminate the stimulatory effect of LXR{alpha} on the CYP7A1 promoter because increased levels of SHP combined with FTF diminish the recruitment of LXR{alpha} to CYP7A1 promoter.

cholesterol 7{alpha}-hydroxylase; regulation; LXR binding site; short heterodimer partner; fetoprotein transcription factor; farnesoid X receptor; liver X receptor-{alpha}


RECENT STUDIES SUGGEST THAT the nuclear receptors farnesoid X receptor (FXR) (10, 13, 20) and liver X receptor (LXR{alpha}) (4, 14) inhibit and stimulate CYP7A1 transcription, respectively. In addition, FTF ({alpha}-fetoprotein transcription factor, also named LRH-1 and CPF) is an essential transcriptional factor for CYP7A1 (11). Activation of FXR enhances the expression of its target gene SHP (short heterodimer partner) and suppresses CYP7A1 transcription via the FXR-SHP-FTF cascade by inactivating FTF and abolishing its positive transcriptional effect (5, 9).

It is well known that the response of CYP7A1 expression to dietary cholesterol is opposite in rabbits (23), green monkeys (15), and rats (7, 12, 17, 18). Our own studies have demonstrated that in rabbits fed 2% cholesterol for 10 days, when both FXR and LXR{alpha} were activated, the inhibitory effect of FXR overrode the stimulatory effect of LXR{alpha}. As a result, CYP7A1 expression was suppressed (21). In contrast, in rats fed 2% cholesterol for 7 days when the FXR ligand pool (bile acid pool) was not enlarged, CYP7A1 transcription was upregulated because only LXR{alpha} but not FXR was activated (22). However, when rabbits were fed cholesterol for just 1 day, similar to what is observed in cholesterol-fed rats, CYP7A1 was also upregulated. In this case, the size of the bile acid pool was unchanged such that FXR was not activated and the stimulatory effect of activated LXR{alpha} on CYP7A1 transcription dominated (21). In contrast, in rats fed 2% cholesterol with 1% cholate (an FXR ligand) for 7 days with the bile acid pool enlarged, both FXR and LXR{alpha} were simultaneously activated similar to rabbits fed cholesterol for 10 days. As a result, the inhibitory effect of FXR offsets the stimulatory effect of LXR{alpha}, and CYP7A1 expression was not enhanced. Thus we conclude that activated FXR is dominant over activated LXR{alpha} in the regulation of CYP7A1 transcription in both the rat and the rabbit (22).

In this study, we explored the molecular mechanism by which activated FXR overrides the stimulatory effect of activated LXR{alpha} to downregulate the rabbit CYP7A1 promoter. We investigated the molecular structure of the rabbit CYP7A1 promoter region and found a putative FTF binding site embedded within the LXR binding site. We were then able to demonstrate that this overlapping structure enables activated FXR being dominant in controlling CYP7A1 transcription because it prevents activated LXR{alpha} protein from binding with the CYP7A1 promoter.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Animal studies. Male New Zealand white rabbits (2.5–3.0 kg, n = 36) from Covance (Denver, PA) were used in this study. The rabbits were divided into three groups (n = 12 in each): controls were fed regular rabbit chow (Purina Mills, St Louis) for 10 days and the other two groups of rabbits were fed 1 day and 10 days, respectively, of 2% cholesterol incorporated into the Purina rabbit chow diet. After completion of the feeding experiments, bile fistulas were constructed in half of the rabbits (6 in each group) for measurements of bile acid pool sizes as previously described (24). The liver specimens in another half of animals without bile fistula were collected for determination of hepatic mRNA expression of CYP7A1, FTF, SHP, and ABCA1 by Northern blot analysis and hepatic FTF and SHP protein levels by Western blot analysis. Liver tissue was also used to determine the changes in LXR{alpha}-bound DNA (LXR binding site) by chromatin immunoprecipitation (ChIP) assays.

Electrophoretic mobility shift (gel shift) assays. Double-stranded oligonucleotide probes were obtained by annealing equimolar single-stranded complementary oligonucleotides. The probes corresponding to the rabbit LXR{alpha} binding site (LXRE, 5'-GCTTTGGTCACTCAAGTTCAAGTT-3') and FTF binding site (FTFE, 5'-CTTAGTTCAAGGCTAGTTAA-3') were labeled with {gamma}-[32P]ATP using T4 polynucleotide kinase from the Gel Shift Assay System (Promega). LXR{alpha}, retinoid X receptor (RXR), and FTF proteins were synthesized from the expression plasmids of human (h)LXR{alpha}, hRXR, and hFTF by using the TNT Quick Coupled Transcription/Translation System (Promega). Gel shift analysis was carried out with the Promega Electrophoretic Mobility Shift Assay kit and was conducted with hLXR{alpha} (or 35S-labeled hLXR{alpha}), hRXR, and hFTF (or 35S-labeled hFTF) proteins in a 4% acrylamide gel with either 32P-labeled or unlabeled LXR probes. [35S]methionine hLXR{alpha} and FTF proteins were generated using the TNT Quick Coupled Transcription/Translation System.

Cell culture. HepG2 cells (American Type Culture Collection, Manassas, VA) were grown at 37°C in an atmosphere of 5% CO2. The cells were cultured in Eagle's minimal essential medium (EMEM; American Type Culture Collection, Manassas, VA), supplemented with ampicillin (100 µg/ml) (Sigma) and 10% fetal bovine serum (FBS). Confluent cultures of the cells were grown in 24-well culture plates. Once the cell density reached 80–90%, the medium was replaced with EMEM, supplemented with ampicillin (100 µg/ml) and 10% charcoal/dextran-treated FBS (delipidated). The intact rabbit CYP7A promoter (–1125/+125) was inserted into a pGL3 vector (Promega, Madison, WI). A synthetic Renilla luciferase reporter, phRG-TK (Promega) was used as a luciferase internal standard. Six hundred nanograms of CYP7A1 promoter and 50 ng of phRG-TK vector (internal standard) were cotransfected in each well. In addition to the expression plasmids of CMX-hLXR{alpha} and RXR, pCDM8-hFTF, and CMV-mouse SHP (mSHP), an empty CMV vector (PCDNA 3.1) was added in varying amounts so the total DNA transfected in each well was adjusted to be equal. All plasmids were cotransfected with FuGENG6 reagent (Roche, Indianapolis, IN). In the experiments in which LXR{alpha}/RXR was transfected, 25 µM of the LXR{alpha} agonist 22(R)-hydroxycholesterol and 1 µM of the RXR agonist 9-cis-retinoic acid, were added after an additional 2 h of incubation. Cells were then incubated for another 48 h, harvested, and lysed, and the luciferase activity was assayed by use of the Luciferase Assay System (Promega). The amount of luciferase activity in transfectants was measured using a TD-20/20 luminometer (Turner Designs, Sunnyvale, CA) and normalized to the amount of PHRG-TK luciferase activity. Transfections were carried out in triplicate and each experiment was repeated six times.

ChIP assay. When the chromatin were collected from the variously supplemented HepG 2 cells, ChIP assays were performed by a cross-linking method according to the protocol provided by the manufacturer (Upstate, Temecula, CA). HepG 2 cells (2 x 107) cotransfected with 12 µg of expression plasmid for the rabbit CYP7A1 promoter were applied to 100-mm dishes. To study the effect of FTF and SHP on the rabbit CYP7A1 promoter with activated exogenous LXR{alpha}/RXR, the cells in each experiment were cotransfected with hLXR{alpha} and RXR expression plasmids and with 25 µM of the LXR{alpha} agonist, 22(R)-hydroxycholesterol, and 1 µM of the RXR agonist, 9-cis-retinoic acid. To study the effect of FTF and SHP on CYP7A1 promoter with activated endogenous LXR{alpha}/RXR, only 22(R)- hydroxycholesterol and 9-cis-retinoic acid were added in each experiment. The cells were cotransfected with 4 µg of expression plasmids of hFTF, mSHP, or hFTF+mSHP, respectively.

When ChIP assay was performed for liver tissues from rabbits, chromatin was prepared by the native chromatin method (19). Rabbit liver tissues (0.2 g) were homogenized at ice-cold 0.3 M sucrose buffer solution (60 mm KCl, 15 Mm NaCl, 5 mM MgCl2, 0.1 mM EGTA, 15 mM Tris·HCl, 0.5 mM DTT, 0.1 mM PMSF, and 3.6 ng/ml aprotinin). Nuclei were purified by using the same buffer solution mentioned above except the sucrose concentration in the buffer solution was 1.2 M. Native chromatin fragments were obtained by digestion of the purified nuclei with micrococcal nuclease (MNase enzyme, USB, Cleveland, OH). Chromatin was then purified by dialysis using a dialysis tubing (Spectra/Por Dialysis Membrane, MWCO:10,000, Spectrum Laboratories, Rancho Dominguez, CA).

The chromatin was precipitated using either 1 µg of normal mouse IgG (12-371B, Upstate), a nonspecific antibody, or 10 µg of monoclonal anti-hLXR{alpha} antibody (2ZK8607H, R&D, Minneapolis, MN). The positive control (Input) was chromatin untreated with antibody. The precipitated DNA was then amplified with PCR. The PCR primers for amplification of DNA only containing LXR binding site (–134/+44 in the CYP7A1 promoter) were designed as follows: forward primer 5'-AGGCTAGTTAATACCACTATCTTT and reverse primer 5'-TCATAGATTCTCCCTGTCAGGAGT.

Western blot analysis. After the rabbit liver tissue (200 mg) was homogenized, nuclear proteins were extracted with NE-PER Nuclear and Cytoplasmic Extraction Reagents (Pierce, Rockford, IL). Fifty micrograms of the nuclear proteins were applied and separated on a 4–12% sodium dodecyl sulfate polyacrylamide gel. The gel was then transferred onto a polyvinylidene difluoride membrane (Invitrogen, Carlsbad, CA). The membrane was hybridized with 10 µl of the antibody dilution (FTF: 2 µg/ml and SHP: 0.5 µg/ml) overnight at 4°C. The membrane was then incubated with the horseradish peroxidase-conjugated secondary antibody (Santa Cruz, CA) dilution (1:10,000) for 1 h at room temperature. Monoclonal anti-hLRH-1/NR5A2 antibody and affinity-purified goat anti-human/mouse/rat SHP-1 antibody (R&D Systems, Tokyo, Japan) were used. The resultant immunocomplexes were visualized after incubation with SuperSignal West Pico Chemiluminescent Substrate (Pierce, Rockford, IL) and exposed the membrane via X-ray detection.

Northern blotting analysis. Preparation of rabbit cDNA probes for CYP7A1, SHP, and ABCA1; RNA isolation and hybridization were carried out as previously described (15) except 30 µg of total RNA instead of 10 µg of poly(A)+ were applied when hybridization was performed. In addition, primers for rabbit FTF cDNA probe were as follows: 5'-GGATCCATCTTCCTGGTTACT-3'/5'-CATTCAGGTGCTTGTAGTAGAGG-3'.

Statistical analysis. Data are shown as means ± SD, and were compared statistically by ANOVA followed by the Bonferroni multiple comparisons test. GraphPad InStat V.3 (GraphPad Software, San Diego, CA) was used for all statistical evaluations.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
FTF protein binds to the LXR binding site. In the cloned rabbit CYP7A1 promoter, we identified a putative FTF binding site (–55/–63) (FTF2 in Fig. 1) within the LXR binding site (–55/–70). Using an electrophoretic mobility shift assay, we confirmed that both FTF and LXR{alpha} protein bind to this site. As seen in Fig. 2, we show that a 32P 22-bp construct of the rabbit LXR binding site ([32P]LXRE) containing the embedded FTF binding site bound to the LXR{alpha}/RXR heterodimer (lane 4). The combination of unlabeled LXRE plus [35S]FTF protein (lane 5) or [32P]LXRE with unlabeled FTF protein (lanes 8 and 9) yielded bands with different mobility than of the LXRE-LXR{alpha}/RXR complex alone (lane 4). These results demonstrate that FTF protein can bind to the putative LXR binding site. In addition, the combination of FTF, LXR{alpha}/RXR, and [32P]LXRE (lane 8) results in a band that is separate from the LXRE-LXR{alpha}/RXR band as seen in lane 4 but is similar to the bands in lanes 5 and 9 where only LXRE and FTF protein were added. The result in lane 8 demonstrates that FTF protein can bind to the LXR binding site in the presence of LXR{alpha}/RXR protein.


Figure 1
View larger version (10K):
[in this window]
[in a new window]

 
Fig. 1. A segment of the rabbit CYP7A1 promoter (–51/–150). Boldface type indicates the liver X receptor (LXR) (–55/–70) and {alpha}-fetoprotein transcription factor (FTF) (FTF1, –129/–137) binding sites, respectively. There is another putative FTF biding element, FTF2 (–55/–63), embedded within the LXR binding site.

 

Figure 2
View larger version (59K):
[in this window]
[in a new window]

 
Fig. 2. FTF protein binds to the LXR binding site. Gel shift assays were performed by use of a probe containing the LXR binding element (LXRE: TGGTCACTCAAGTTCA) and the FTF binding site (FTFE: CTTAGTTCAAGGCTAGTTAA) labeled with 32P ([32P]LXRE and [32P]FTFE) or without labeling (LXRE and FTFE). In lane 3, synthesized human FTF (hFTF) protein (3 µl) bound the [32P]FTFE whereas in lane 7, [35S]labeled synthesized hFTF protein ([35S]FTF, 3 µl) bound to nonlabeled FTF probe (FTFE). Synthesized hLXR{alpha} and RXR proteins [LXR/RXR (L/R), 3 µl each] were added in lanes 4 and 8. The concentration of these synthesized proteins was 0.5 µg/µl. Note: the location of the binding complex of LXR/RXR with LXRE is different from that of FTF with LXRE (lanes 5, 8, and 9) because the molecular weight of LXR/RXR is higher than that of FTF. Lysate, negative control, TNT reticulocyte lysate of the Quick Coupled Transcription/Translation System without expression plasmid.

 
It should be noted that in Fig. 2 the binding complex of FTF protein with formal FTF binding site (FTF1 in Fig. 1 or FTFE in Fig. 2) is located in a different position (lanes 3 and 7) from either that of LXRE-FTF (lanes 5, 8, and 9) or LXRE-LXR/RXR (lanes 4 and 8).

FTF competes with LXR{alpha}/RXR for binding to the LXR binding site. Lane 2 in Fig. 3 shows that [32P]LXRE binds to the LXR{alpha}/RXR protein. In lanes 3-6, the LXR binding site was not labeled (LXRE). Instead, we used 35S-labeled LXR{alpha} protein. Since only the LXR{alpha} protein was labeled, the density of the band represents the relative amount of bound LXR{alpha}. The band, which represents the 35S-labeled LXR{alpha}/RXR/LXRE complex, almost disappeared after the amount of added synthesized hFTF protein was increased to 12 µl (lane 5). This result suggests that increasing amounts of FTF protein will prevent the binding of LXR{alpha}.


Figure 3
View larger version (46K):
[in this window]
[in a new window]

 
Fig. 3. FTF competes with LXR{alpha} for binding. Gel shift assays were performed using a probe containing LXR binding element (LXRE) with ([32P]LXRE) or without 32P-labeling (LXRE). [35S]LXR/RXR, 10 µl of 35S-labeled hLXR{alpha} protein and 3 µl of unlabeled hRXR protein. LXR/RXR: 3 µl of unlabeled hLXR{alpha} and hRXR proteins. Three microliters of hFTF protein were added in lane 4 and 12 µl in lane 5. In lane 6, 12 µl of lysate (TNT reticulocyte lysate) was added as negative control protein relative to hFTF protein added in lane 5. The concentration of the synthesized proteins was 0.5 µg/µl.

 
SHP enhances the ability of FTF to prevent LXR{alpha}/RXR from binding to the LXR binding site. To investigate the mechanism by which the inhibitory effect of activated FXR overrides the stimulatory effect of LXR{alpha}, we examined the possible interactions of SHP with FTF and LXR{alpha} when binding with the rabbit CYP7A1 promoter.

The effects of SHP on LXR{alpha} binding to its binding site are shown in the gel-shift assays depicted in Fig. 4. One microliter of TNT-synthesized hFTF protein and LXR{alpha}/RXR were added with the [32P]LXR binding site (lane 3). The resulting band showed faster migration compared with LXR{alpha}/RXR alone (lane 2). The faster migrating band represented the FTF/LXRE binding complex because it has the same mobility as the band in lane 9 where only 32P-labeled LXRE and FTF were applied. When increasing amounts of TNT synthesized mSHP protein were added (lanes 4 and 5) the density of the "faster migrating" bands (FTF protein bound to the LXR binding site) increased in a dose-dependent manner. This result indicated that when SHP is added more LXRE is bound by the same amount of FTF. When LXR{alpha}/RXR was absent, FTF with addition of SHP could also bind much more labeled LXRE (lanes 6 and 7) than FTF alone (lane 9). After adding more SHP (lane 7) with FTF, the density of FTF/LXRE band increases indicating that more 32P-labeled LXRE is bound by the same amount of FTF. In contrast, SHP by itself did not bind to LXRE (lane 8) nor did it reduce LXR{alpha} from binding to its binding site (lane 10).


Figure 4
View larger version (53K):
[in this window]
[in a new window]

 
Fig. 4. SHP enhances the FTF's ability to compete for the LXR binding site. Gel shift assays were performed using a probe containing LXR binding element (LXRE) labeled with 32P. LXR/RXR, 3 µl of hLXR{alpha} and hRXR proteins. Synthesized hFTF (FTF) and mouse SHP (SHP) proteins were used. The concentration of these synthesized proteins was 0.5 µg/µl.

 
Figure 5 shows that when HepG2 cells were transfected with the rabbit CYP7A1 promoter linked to the luciferase reporter, adding as much as 400 ng of hFTF expression plasmid with LXR{alpha}/RXR did not suppress the LXR{alpha}/RXR induced promoter activity. In contrast, when 200 ng of mSHP expression plasmid was added along with 200 and 400 ng of hFTF expression plasmid, promoter activity dropped 25% (19.3 ± 2.3 vs. 25.9 ± 2.5 units, P < 0.05) and 32% (17.5 ± 4.9 vs. 25.8 ± 2.5 units, P < 0.001), respectively, compared with equimolar FTF without SHP. Adding 800 ng of hFTF expression plasmid with 200 ng of hLXR{alpha}/RXR expression plasmids reduced the elevated promoter activity 24% (P < 0.05) from 26.0 ± 3.2 to 19.7 ± 2.8 units. When 200 ng of mSHP expression plasmid was then added with FTF, the promoter activity decreased an additional 36% to 12.7 ± 2.6 unit (P < 0.01).


Figure 5
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 5. Adding SHP to FTF enhances the inhibition of CYP7A1 promoter activity in HepG2 cells. In each experiment (n = 6) HepG2 cells were cotransfected with 600 ng of expression plasmid containing the rabbit CYP7A1 promoter fused to a luciferase reporter gene. Open bars, no SHP was added; shaded bars, 200 ng of expression plasmid for mSHP was added. L/R, 200 ng of expression plasmids for hLXR{alpha} and RXR plus 25 µM 22(R)-hydroxycholesterol and 1 µM 9-cis-retinoic acid. FTF, 200–800 ng of hFTF expression plasmid were added, respectively. P values represent the statistical difference between the paired groups with and without the addition of SHP.

 
Enhancement of the inhibitory effect is due to the combination of FTF with SHP. We then tested whether this additional effect to suppress CYP7A1 promoter activity mentioned above was produced by SHP alone or by combination of SHP with FTF. Increasing amounts of SHP with or without 200 ng of the hFTF expression plasmid were added to evaluate whether the presence of FTF would enhance the inhibitory effect of SHP. Figure 6 shows that SHP reduced the LXR{alpha}/RXR-induced CYP7A1 promoter activity in a dose-dependent manner. When 200 ng of FTF protein was added with SHP, the promoter activity was always significantly lower than with SHP alone regardless of the amount of SHP added. The promoter activity further decreased 25% (P < 0.01), 31% (P < 0.01), and 34% (P < 0.05) when 200 ng of FTF was added to 200, 400, and 800 ng of SHP, respectively (Fig. 6).


Figure 6
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 6. FTF enhances the inhibitory effect of SHP on the CYP7A1 promoter. In each experiment (n = 6) HepG2 cells were cotransfected with 600 ng of expression plasmid containing the rabbit CYP7A1 promoter fused to a luciferase reporter gene. Open bars, no FTF; shaded bars, 200 ng of expression plasmid for hFTF was added. L/R, 200 ng of expression plasmids for hLXR{alpha} and RXR plus 25 µM 22(R)-hydroxycholesterol and 1 µM 9-cis-retinoic acid. SHP, 200–800 ng of expression plasmid for mSHP was added. P values represent the statistical difference between the paired groups with and without the addition of FTF.

 
To further confirm the promoter response of LXR{alpha}, FTF, and SHP in the HepG2 cell experiments and gel shift assays described above, the ChIP assay was performed with HepG2 cell experiments to quantitatively evaluate the difference in amount of LXR{alpha}-bound LXR binding site (DNA) in the rabbit CYP7A1 promoter. The results shown in Fig. 7 indicate the quantities of LXR{alpha} bound DNA containing the LXR binding site before and after treatments with FTF, SHP, and FTF plus SHP. In those HepG2 cells, either exogenous (Fig. 7A) or endogenous (Fig. 7B) LXR{alpha}/RXR was activated. In the former, exogenous LXR{alpha}/RXR and 22(R)-hydroxycholesterol/9-cis-retinoic acid were added, whereas in the latter no exogenous LXR{alpha}/RXR but only 22(R)-hydroxycholesterol/9-cis-retinoic acid were added. The LXR{alpha}-bound DNA precipitated by an LXR{alpha} antibody is expected to be LXR{alpha}-bound LXR binding site because the PCR primer was designed for only amplifying the DNA-containing LXR binding site (–134/+44 in the CYP7A1 promoter). After addition of FTF, the amount of LXR{alpha}-bound DNA slightly decreased compared with that without treatment (L/R in Fig. 7A and Control in Fig. 7B). Adding SHP had little effect on the LXR{alpha}-bound DNA in both A and B. However, when SHP was added together with FTF, LXR{alpha}-bound DNA decreased significantly. Particularly, in the cells with activated endogenous LXR{alpha}/RXR (Fig. 7B), essentially no signal from LXR{alpha}-bound DNA was detected. This result demonstrated conclusively that the combination of SHP with FTF prevented LXR{alpha} protein from binding to the CYP7A1 LXR binding site in the HepG2 cells where LXR{alpha}/RXR was activated.


Figure 7
View larger version (31K):
[in this window]
[in a new window]

 
Fig. 7. SHP combined with FTF prevents activated LXR{alpha} from binding to its natural binding site. The PCR results of LXR{alpha} bound DNA (LXR binding site) estimated by chromatin immunoprecipitation (ChIP) assays. In A and B, DNA was collected from HepG2 cells transfected with 12 µg of expression plasmid for the rabbit CYP7A1 promoter. FTF, transfected 4 µg of hFTF expression plasmid; SHP, transfected 4 µg of mSHP expression plasmid; F/S, transfected 4 µg of both hFTF and mSHP expression plasmids. Ab-LXR{alpha}, LXR{alpha} bound chromatin precipitated by 10 µg anti-LXR{alpha} antibody. IgG, the negative controls where the chromatin was precipitated using 1 µg normal mouse IgG (nonspecific antibody). Input was used as the positive controls where no antibody was used. The PCR primer was designed such that only the region in the rabbit CYP7A1 promoter around the LXR binding site was amplified by PCR. A: HepG 2 cells with activated exogenous LXR{alpha} and RXR. In each group, 4 µg of hLXR{alpha} and RXR expression plasmids (L/R) were transfected with 25 µM 22(R)-hydroxycholesterol and 1 µM 9-cis-retinoic acid. In this experiment, it was amplified 25 cycles in the PCR. B: HepG 2 cells with activated endogenous LXR{alpha}/RXR. In each group, 25 µM 22(R)-hydroxycholesterol and 1 µM 9-cis-retinoic acid were added without exogenous LXR{alpha}/RXR plasmids. It was amplified 32 cycles in the PCR. C: in liver specimens (0.2 g) from rabbits fed 2% cholesterol for 1 day (Ch 1 day) and 10 days (Ch 10 day) or chew only (Ctrl). The target DNA was amplified 32 cycles in the PCR.

 
Hepatic SHP expression increased in rabbits fed cholesterol with expanded bile acid pool size. Hepatic FTF mRNA (Fig. 8A) and protein (Fig. 8B) levels did not change in the rabbits fed 2% cholesterol for either 1 day or 10 days. In the rabbits fed cholesterol for 1 day, when SHP mRNA and protein levels did not increase, CYP7A1 mRNA levels increased 50% and ABCA1 rose twofold. After 10 days of cholesterol feeding, the mRNA levels of CYP7A1 reduced 50% with increase of SHP mRNA expression (2.8-fold) and protein levels (2-fold). In addition, the expression of LXR{alpha} target gene ABCA1 also rose 2.5-fold.


Figure 8
View larger version (34K):
[in this window]
[in a new window]

 
Fig. 8. Changes of FTF and SHP in rabbits fed cholesterol. A: hepatic mRNA expression of CYP7A1, FTF, SHP, and ABCA1 in control rabbits (Ctrl) and rabbits fed 2% cholesterol for 1 day (Ch 1) or 10 days (Ch 10) was measured by Northern blot analysis. Cyclo, cyclophilin was used as an internal standard. Numbers under spots present values relative to the control. B: hepatic SHP and FTF protein levels in control rabbits (Ctrl) and rabbits fed 2% cholesterol for 1 day (Ch 1) or 10 days (Ch 10) was measured by Western blot analysis. Monoclonal anti-hLRH-1/NR5A2 antibody was used for FTF and affinity-purified goat anti-human/mouse/rat SHP-1 antibody, for SHP measurement.

 
The results of ChIP assays in the rabbit liver specimens demonstrated that LXR{alpha}-bound LXR binding site did not change in the liver tissue from rabbits fed 2% cholesterol for 1 day but reduced in rabbits fed cholesterol for 10 days (Fig. 7C).

In rabbits fed 2% cholesterol for 1 day, the FXR ligand (bile acid) pool size did not change compared with the controls (239 ± 58 vs. 212 ± 40 mg, P = not significant). In contrast, after 10 days of cholesterol feeding, the bile acid pool size expanded 1.9-fold (411 ± 71 from 212 ± 40 mg, P < 0.001).


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We have previously reported that FTF is essential in establishing baseline promoter activity of CYP7A1, but increasing its expression did not further upregulate CYP7A1 expression (16). This study demonstrated that there is a functional FTF binding site embedded within the LXR binding site in the rabbit CYP7A1 promoter. It was also found that FTF binds to this LXR binding site and competes with LXR{alpha} for binding to the CYP7A1 promoter. Since SHP has a strong interaction with FTF, this finding provided a molecular basis for the involvement of SHP in the downregulation of CYP7A1 expression despite the stimulatory effect by LXR{alpha}/RXR. We were then able to demonstrate that SHP enhanced the binding of FTF to the LXR binding site (Fig. 4) and that SHP combined with FTF resulted in a further repressive effect on CYP7A1 promoter than either SHP or FTF alone (Figs. 5 and 6). Thus the enhanced inhibitory effect of SHP on CYP7A1 promoter stimulated by activated exogenous LXR/RXR is not merely due to the direct effects of SHP onto FTF (5, 9) and LXR{alpha} (1). Although SHP alone does not directly bind to the LXR binding site, the gel shift assay visibly demonstrated that addition of SHP with FTF reduced the LXR{alpha} ability of binding to its binding site (Fig. 4). Most importantly, the results from the ChIP studies further demonstrated that SHP combined with FTF significantly reduced the amount of LXR{alpha} bound DNA (LXR binding site) in HepG2 cells with either exogenous or endogenous activated LXR{alpha}/RXR (Fig. 7, A and B). Since the PCR primer was designed as such that only LXR{alpha} bound LXR binding site was amplified, the significant reduction of LXR{alpha} bound DNA in ChIP assay confirmed that SHP combined with FTF acted on LXR{alpha} binding to its binding site in CYP7A1 promoter. We reasoned that the combination of SHP with FTF competed with LXR{alpha} for the LXR binding site since the SHP/FTF heterodimer may occupy the downstream FTF binding element embedded within the LXR binding site (FTF2; see Fig. 1). This competition results in blocking LXR{alpha} from binding and diminishing its stimulatory effect. In contrast to the role of FTF, activation of LXR{alpha} is not only essential for the baseline activity of rabbit CYP7A1 promoter but also for upregulating the promoter activity above baseline. We recently reported that mutation of the LXR binding site in the rabbit CYP7A1 promoter resulted in markedly diminished baseline activity as well as a lack of the characteristic upregulation from LXR{alpha} (16). Thus in rabbits the competition of SHP/FTF with LXR{alpha} for binding to the LXR binding site can eventually lead to diminished stimulation of CYP7A1 by LXR{alpha} and, perhaps, even a reduction below its normal baseline transcriptional level. We hypothesize that, in rabbits, the activation of FXR stimulates the expression of its target gene SHP to increase formation of FTF/SHP heterodimers, which occupy the LXR binding site via the embedded FTF binding element and diminish the recruitment of LXR{alpha} as illustrated in Fig. 9.


Figure 9
View larger version (15K):
[in this window]
[in a new window]

 
Fig. 9. Schematic diagram of hypothesized regulatory mechanism. Activation of FXR stimulates the expression of its target gene SHP. The increased amount of SHP forms heterodimers with FTF that occupy the LXR binding site via the embedded FTF binding element that diminishes the recruitment of LXR{alpha} to CYP7A1 promoter. As a result, the stimulatory effect of LXR{alpha} on CYP7A1 transcription is diminished whenever FXR is activated.

 
Recently, it has been suggested that FTF is a negative regulator of CYP7A1 transcription as FTF competes with HNF4 for binding the bile acid response element (BARE)-II where FTF and HNF4 binding sites overlap partially (2, 3). In the present study, similar to the FTF/HNF4 mechanism, we have identified an FTF binding site embedded within the LXR binding site in the BARE-I and propose an FTF/HNF4 mechanism that increased SHP interacts with FTF to compete with LXR{alpha} for BARE-I. We believe that in rabbits dietary cholesterol does not have a direct inhibitory effect on CYP7A1. Feeding with a 2% cholesterol diet for 10 days resulted in an enlarged bile acid (FXR ligand) pool size, which in turn induced activation of FXR. The activated FXR stimulated SHP expression (mRNA/protein) that induced SHP/FTF heterodimers to block LXR{alpha} from recruiting to CYP7A1 promoter. As a result of diminished stimulatory effect of LXR{alpha}, the inhibitory effect of FXR dominated and CYP7A1 expression was repressed. It is important to note that SHP mRNA/protein increased (Fig. 8B) and LXR{alpha} bound LXR binding site decreased (Fig. 7C) only in rabbits fed 2% cholesterol for 10 days where FXR was activated. We have not found an increase of FTF expression (mRNA/protein) in the rabbits after feeding 2% cholesterol for either 1 day or 10 days. Thus, in rabbits, the repression of CYP7A1 after cholesterol feeding was due not to increased expression of FTF but rather to the induced SHP expression by the activation of FXR. It should be noted that in rabbits fed cholesterol CYP7A1 expression could also be induced as long as the FXR ligand pool size did not expand and FXR is not activated to induce more SHP. For example, CYP7A1 expression was increased in rabbits fed cholesterol for 1 day only. In the rat, although the CYP7A1 promoter contains an LXR binding site that is identical to the rabbit, cholesterol feeding does not result in an enlarged bile acid pool but increases the proportion of hydrophilic bile acids in the pool that is not FXR ligands (22). Thus cholesterol feeding does not repress CYP7A1 in the rat. In the human, there is no LXR binding site in CYP7A1 promoter whereas there is an LXR{alpha} binding site in the SHP promoter region. Thus LXR{alpha} does not stimulate but rather inhibits CYP7A1 transcription in humans (6).

It is possible that SHP may directly interact with LXR{alpha} to modulate transcription activity (1) because SHP usually represses nuclear receptor-mediated transactivation by both competition with coactivators for binding to nuclear receptor and its direct inhibitory effect on the nuclear receptor's transcriptional activity (8). However, the direct effect of SHP on LXR{alpha} should be included in the inhibitory effect of SHP alone, as shown in Fig. 6, but it is not responsible for the additional inhibitory effect shown by the combination of SHP and FTF against the stimulatory effect of LXR{alpha}/RXR. These findings raise the additional question of whether the induced SHP expression offsets the stimulatory effect of LXR{alpha} on CYP7A1 transcription by competing with HNF4 for the BARE-II where HNF4 and FTF binding sites overlap (2, 3). In the present study, we have demonstrated by gel shift and ChIP assay that the combination of SHP and FTF diminished the recruitment of LXR{alpha} to its binding site (–54/–70) in BARE-I. Obviously, this effect was independent from the competition of FTF with HNF4 for BARE-II (–129/–147). The effect of FXR action is dominant in the regulation of CYP7A1 because it induced expression of SHP, which competes with both LXR{alpha} and HNF4 via FTF in BARE-I and BARE-II. Although to diminish LXR{alpha} recruitment SHP/FTF heterodimer may not necessarily occupy the LXR binding site, we prefer that steric hindrance is involved as suggested in Fig. 9. This hypothesis is based on the following observations: 1) FTF competes with HNF4 for binding BARE-II where FTF and HNF4 binding sites partially overlap, resulting in repression of CYP7A1 transcription, whereas in the present study FTF competes with LXR{alpha} for the LXR binding site where FTF binding site is totally embedded. 2) Although SHP itself did not bind the LXR binding site, SHP significantly enhanced the ability of FTF to bind the LXR binding site as shown in Fig. 4 (lanes 4, 6, and 7). 3) Gel shift and ChIP assays demonstrated that SHP combined with FTF diminished LXR{alpha} recruitment to its binding site much more strongly than either FTF or SHP alone.

The phenomenon that one transcriptional factor's binding site overlaps with another transcription factor's binding site may commonly exist. In addition to the overlap between the FTF and HNF4 binding sites, the FTF/LXR binding site overlapping structure provides an additional mechanism for regulation of CYP7A1 transcription. Particularly, it explains why activation of FXR overrides the stimulatory effect of LXR{alpha} as seen in our previous animal studies. We expect that further studies will reveal more examples of overlapping sites. This phenomenon provides an additional layer of regulation of these important physiological genes, and we expect that further studies will reveal more examples of similar overlapping sites.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported by grants from the Department of Veterans Affairs, Health Services Research and Development Service, Washington, DC and by grants DK-44442 and DK-58379 from the National Institute of Diabetes and Digestive and Kidney Diseases.


    FOOTNOTES
 

Address for reprint requests and other correspondence: G. Xu, GI Lab (15A), VA Medical Center, 385 Tremont Ave., East Orange, NJ 07018-1095 (e-mail: xugu{at}umdnj.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Brendel C, Schoonjans K, Botrugno OA, Treuter E, Auwerx J. The small heterodimer partner interacts with the liver X receptor {alpha} and represses its transcriptional activity. Mol Endocrinol 16: 2065–2076, 2002.[Abstract/Free Full Text]
  2. Chen W, Owsley E, Yang Y, Stroup D, Chiang JYL. Nuclear receptor-mediated repression of human cholesterol 7{alpha}-hydroxylase gene transcription by bile acids. J Lipid Res 42: 1402–1412, 2001.[Abstract/Free Full Text]
  3. Del Castillo-Olivares A, Campos JA, Pandak WM, Gil G. Role of {alpha}1-fetoprotein transcription factor/LRH-1 in bile acid biosynthesis A known nuclear receptor activator that can act as a suppressor of bile acid biosynthesis. J Biol Chem 279: 16813–16821, 2004.[Abstract/Free Full Text]
  4. Forman BM, Ruan B, Chen J, Schroepfer GJ Jr, Evans RM. The orphan nuclear receptor LXR{alpha} is positively and negatively regulated by distinct products of mevalonate metabolism. Proc Natl Acad Sci USA 94: 10588–10593, 1997.[Abstract/Free Full Text]
  5. Goodwin B, Jones SA, Price RR, Watson MA, McKee DD, Moore LB, Galardi C, Wilson JG, Lewis MC, Roth ME, Maloney PR, Willson TM, Kliewer SA. A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 6: 517–526, 2000.[CrossRef][Web of Science][Medline]
  6. Goodwin B, Watson MA, Kim H, Miao J, Kemper JK, Kliewer SA. Differential regulation of rat and human CYP7A1 by the nuclear oxysterol receptor liver X receptor-alpha. Mol Endocrinol 17: 386–394, 2003.[Abstract/Free Full Text]
  7. Jelinek DF, Andersson S, Slaughter CA, Russell DW. Cloning and regulation of cholesterol 7{alpha}-hydroxylase, the rate-limiting enzyme in bile acid biosynthesis. J Biol Chem 265: 8190–8197, 1990.[Abstract/Free Full Text]
  8. Lee Y, Dell H, Dowhan DH, Hadzopoulou-Cladaras M, Moore DD. The orphan nuclear receptor SHP inhibits hepatocyte nuclear factor 4 and retinoid X receptor transactivation: two mechanisms for repression. Mol Cell Biol 20: 187–195, 2000.[Abstract/Free Full Text]
  9. Lu TT, Makishima M, Repa JJ, Schoonjans K, Kerr TA, Auwerx J, Mangelsdorf DJ. Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell 6: 507–515, 2000.[CrossRef][Web of Science][Medline]
  10. Makishima M, Okamoto AY, Repa JJ, Tu H, Learned RM, Luk A, Hull MV, Lustig KD, Mangelsdorf DJ, Shan B. Identification of a nuclear receptor for bile acids. Science 284: 1362–1365, 1999.[Abstract/Free Full Text]
  11. Nitta M, Ku S, Brown C, Okamoto AY, Shan B. CPF: an orphan nuclear receptor that regulates liver-specific expression of the human cholesterol 7{alpha}-hydroxylase gene. Proc Natl Acad Sci USA 96: 6660–6665, 1999.[Abstract/Free Full Text]
  12. Pandak WM, Li YC, Chiang JTL, Studer EJ, Gurley EC, Heuman DM, Vlahcevic ZR, Hylemon PB. Regulation of cholesterol 7{alpha}-hydroxylase mRNA and transcriptional activity by taurocholate and cholesterol in the chronic biliary diverted rat. J Biol Chem 266: 3416–3421, 1991.[Abstract/Free Full Text]
  13. Parks DJ, Blanchard SG, Bledsoe RK, Chandra G, Consler TG, Kliewer SA, Stimmel JB, Willson TM, Zavacki AM, Moore DD, Lehmann JM. Bile acids: natural ligands for an orphan nuclear receptor. Science 284: 1365–1368, 1999.[Abstract/Free Full Text]
  14. Peet DJ, Truley SD, Ma W, Janowski BA, Lobaccaro JMA, Hammer RE, Mangelsdorf DJ. Cholesterol and bile acid metabolism are impaired in mice lacking the nuclear oxysterol receptor LXR{alpha}. Cell 93: 693–704, 1998.[CrossRef][Web of Science][Medline]
  15. Rudel L, Decheiman C, Wilson M, Scobey M, Anderson R. Dietary cholesterol and downregulation of cholesterol 7{alpha}-hydroxylase and cholesterol absorption in African green monkeys. J Clin Invest 93: 2463–2472, 1994.[Web of Science][Medline]
  16. Shang Q, Pan L, Saumoy M, Chiang JYL, Tint GS, Salen S, Xu G. The stimulatory effect of LXR{alpha} is blocked by SHP despite the presence of a functional LXR{alpha} binding site in the rabbit CYP7A1 promoter. J Lipid Res 47: 997–1004, 2006.[Abstract/Free Full Text]
  17. Shefer S, Nguyen LB, Salen G, Ness GC, Chowdhary IR, Lerner S, Batta AK, Tint GS. Differing effects of cholesterol and taurocholate on steady state hepatic HMG-CoA reductase and cholesterol 7{alpha}-hydroxylase activities and mRNA levels in the rat. J Lipid Res 33: 1193–1200, 1992.[Abstract]
  18. Spady DK, Cuthbert JA. Regulation of hepatic sterol metabolism in the rat. J Biol Chem 267: 5584–5591, 1992.[Abstract/Free Full Text]
  19. Umlauf D, Goto Y, Feil R. Site-specific analysis of histone methylation and acetylation. Methods Mol Biol 287: 99–120, 2004.[Medline]
  20. Wang H, Chen J, Hollister K, Sowers LC, Forman BM. Endogenous bile acids are ligands for the nuclear receptor FXR/BAR. Mol Cell 3: 543–553, 1999.[Web of Science][Medline]
  21. Xu G, Li H, Pan L, Shang L, Honda L, Ananthanarayanan M, Erickson SK, Shneider BL, Shefer S, Bollineni J, Forman BM, Matsuzaki Y, Suchy FJ, Tint GS, Salen G. Farnesoid X receptor (FXR)-mediated downregulation of CYP7A1 dominates LXR{alpha} in long term cholesterol fed NZW rabbits. J Lipid Res 44: 1956–1962, 2003.[Abstract/Free Full Text]
  22. Xu G, Pan L, Li H, Shang Q, Honda A, Shefer S, Bollineni J, Matsuzaki Y, Tint GS, Salen G. Dietary cholesterol stimulates CYP7A1 in rats because farnesoid x receptor is not activated. Am J Physiol Gastrointest Liver Physiol 286: G730–G735, 2004.[Abstract/Free Full Text]
  23. Xu G, Salen G, Shefer S, Ness GC, Nguyen LB, Parker TS, Chen TS, Zhao Z, Donnelly TM, Tint GS. Unexpected inhibition of cholesterol 7{alpha}-hydroxylase by cholesterol in New Zealand White and Watanabe Heritable Hyperlipidemic rabbits. J Clin Invest 95: 1497–1504, 1995.[Web of Science][Medline]
  24. Xu G, Salen G, Shefer S, Tint GS, Kren BT, Nguyen LB, Steer CJ, Chen TS, Salen L, Greenblatt D. Increased bile acid pool inhibits cholesterol 7{alpha}-hydroxylase in cholesterol-fed rabbits. Gastroenterology 113: 1958–1965, 1997.[CrossRef][Web of Science][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
293/4/G817    most recent
00209.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shang, Q.
Right arrow Articles by Xu, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Shang, Q.
Right arrow Articles by Xu, G.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2007 by the American Physiological Society.