AJP - GI AJP: Renal Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 294: G99-G108, 2008. First published October 25, 2007; doi:10.1152/ajpgi.00272.2007
0193-1857/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/1/G99    most recent
00272.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masamune, A.
Right arrow Articles by Shimosegawa, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masamune, A.
Right arrow Articles by Shimosegawa, T.

INFLAMMATION/IMMUNITY/MEDIATORS

NADPH oxidase plays a crucial role in the activation of pancreatic stellate cells

Atsushi Masamune,* Takashi Watanabe,* Kazuhiro Kikuta, Kennichi Satoh, and Tooru Shimosegawa

Division of Gastroenterology, Tohoku University Graduate School of Medicine, Sendai, Miyagi, Japan

Submitted 15 June 2007 ; accepted in final form 24 October 2007


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Activated pancreatic stellate cells (PSCs) play an important role in pancreatic fibrosis and inflammation, where oxidative stress is implicated in the pathogenesis. NADPH oxidase might be a source of reactive oxygen species (ROS) in the injured pancreas. This study aimed to clarify the expression and regulation of cell functions by NADPH oxidase in PSCs. PSCs were isolated from rat and human pancreas tissues. Expression of NADPH oxidase was assessed by reverse transcription-PCR and immunostaining. Intracellular ROS production was assessed using 2',7'-dichlorofluorescin diacetate. The effects of diphenylene iodonium (DPI) and apocynin, inhibitors of NADPH oxidase, on key parameters of PSC activation were evaluated in vitro. In vivo, DPI (at 1 mg·kg body wt–1·day–1) was administered in drinking water to 10-wk-old male Wistar Bonn/Kobori rats for 10 wk and to rats with chronic pancreatitis induced by dibutyltin dichloride (DBTC). PSCs expressed key components of NADPH oxidase (p22phox, p47phox, NOX1, gp91phox/NOX2, NOX4, and NOX activator 1). PDGF-BB, IL-1β, and angiotensin II induced ROS production, which was abolished by DPI and apocynin. DPI inhibited PDGF-induced proliferation, IL-1β-induced chemokine production, and expression of {alpha}-smooth muscle actin and collagen. DPI inhibited transformation of freshly isolated cells to a myofibroblast-like phenotype. In addition, DPI inhibited the development of pancreatic fibrosis in Wistar Bonn/Kobori rats and in rats with DBTC-induced chronic pancreatitis. In conclusion, PSCs express NADPH oxidase to generate ROS, which mediates key cell functions and activation of PSCs. NADPH oxidase might be a potential target for the treatment of pancreatic fibrosis.

pancreatitis; pancreatic fibrosis; oxidative stress


IN 1998, STAR-SHAPED CELLS in the pancreas, namely pancreatic stellate cells (PSCs), were identified and characterized (2, 5). Their counterparts in the liver are well-known hepatic stellate cells. PSCs are present mainly in the periacinar space and have long cytoplasmic processes that encircle the base of the acinus (2, 5, 34). PSCs are estimated to constitute nearly 4% of the total pancreatic cells (34). In normal pancreas, stellate cells are quiescent and can be identified by the presence of vitamin A-containing lipid droplets in the cytoplasm. In response to pancreatic injury or inflammation, they are transformed ("activated") from their quiescent into myofibroblast-like phenotype, characterized by the disappearance of intracellular lipid droplets and the expression of {alpha}-smooth muscle actin ({alpha}-SMA) and extracellular matrix components such as type I collagen, type III collagen, and fibronectin. Upon activation, PSCs actively proliferate, migrate, and produce proinflammatory cytokines and chemokines. Many of the morphological and metabolic changes associated with the activation of PSCs in animal models of fibrosis also occur when the cells are grown in serum-containing medium in culture on plastic (2, 5, 34). There is accumulating evidence that activated PSCs play a pivotal role in the development of pancreatic fibrosis (2, 5, 17, 26, 34). In addition, PSCs may participate in the pathogenesis of acute pancreatitis (26, 34). Obviously, control of the activation of PSCs and their cell functions is a potential target for the treatment of pancreatic fibrosis and inflammation.

Oxidative stress has been implicated in the pathogenesis of acute and chronic pancreatitis (9, 13). Along this line, previous studies have suggested a role of intracellular oxidant in the activation and cell functions, especially collagen synthesis, of PSCs (3, 27). Antioxidants such as plant polyphenols inhibited the activation and cell functions of PSCs (29, 30). NADPH oxidase might be a source of oxidants in injured pancreas. NADPH oxidase is an enzyme primarily found in professional phagocytes such as neutrophils and macrophages (4, 7). NADPH oxidase is a multicomponent enzyme; the classical phagocytic NADPH oxidase is composed of the membrane-bound subunits p22phox and gp91phox (also termed as NOX2), as well as the cytosolic subunits including p67phox and p47phox (4, 7). Upon activation, the cytosolic subunits translocate to the membrane to form the active NADPH oxidase complex. The activated oxidase produces extracellular superoxide that plays a major role in host defense against microbial infection. In addition, NADPH oxidase has been found in a number of nonphagocytic cells including vascular smooth muscle cells (15), fibroblasts (31), and hepatic stellate cells (6). Nonphagocytic NADPH oxidase is structurally and functionally similar to phagocytic NADPH oxidase, but some features are different (8, 39). For example, unlike the phagocytic type, nonphagocytic NADPH oxidase is constitutively active, producing relatively low levels of reactive oxygen species (ROS) under basal conditions and generating higher levels of oxidants in response to cytokines and growth factors. Increased ROS production results in the stimulation of redox-sensitive intracellular signaling pathways (8, 39). Another difference is related to several homologues that replace classical components (7). Vascular smooth muscle cells express NOX1, NOX3, and NOX4 to replace gp91phox/NOX2.

The expression and regulation of cell functions by NADPH oxidase in PSCs have yet to be clarified. We show here that PSCs express key components of NADPH oxidase to generate ROS, which mediate key cell functions and activation of PSCs. In addition, diphenylene iodonium (DPI), an inhibitor of NADPH oxidase (7), inhibited the development of pancreatic fibrosis in vivo, suggesting that NADPH oxidase is a potential target for the treatment of pancreatic fibrosis.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Materials and Animals

Rabbit anti-p22phox and mouse anti-p47phox antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Goat anti-type I collagen antibody was purchased from Southern Biotechnology (Birmingham, AL). Collagenase P, recombinant human IL-1β, and rat PDGF-BB were from Roche Diagnostics (Mannheim, Germany). All other reagents were from Sigma-Aldrich (St. Louis, MO) unless specifically described. Male Wistar, Wistar Bonn/Kobori (WBN/Kob), and Lewis rats were from Japan SLC (Hamamatsu, Japan). All animal procedures were performed in accordance with the National Institutes of Health Animal Care and Use Guidelines.

Cell Culture

Rat PSCs were prepared from the pancreas tissues of male Wistar rats weighing 200–250 g, with the use of the Nycodenz solution (Nycomed Pharma, Oslo, Norway) as previously described (25). Human PSCs were isolated from the resected normal pancreas of patients undergoing operation for pancreatic cancer as previously described (35), under the approval by the Ethics Committee of Tohoku University School of Medicine. Human colonic cancer Colo205 cells were obtained from American Type Culture Collection (Manassas, VA). Cells were maintained in Ham's F-12/DMEM supplemented with 10% heat-inactivated FBS (MP Biomedicals, Irvine, CA), penicillin sodium, and streptomycin sulfate. Experiments were performed using rat PSCs between passages 2 and 4 and human PSCs between passages 3 and 7 after isolation except for those using freshly isolated rat PSCs. Unless specifically described, we incubated PSCs in serum-free medium for 24 h before the addition of experimental reagents. For some experiments, DPI and apocynin were added 30 min before the addition of the stimuli.

Expression of NADPH Oxidase

Reverse transcription-PCR. Total RNA was prepared using RNeasy total RNA preparation kit (Qiagen, Valencia, CA). Total RNA (200 ng) was reverse transcribed, and the resultant cDNA was subjected to PCR. Primer sequences and expected size of the PCR products are shown in Table 1. Cycle condition was as follows: preheating at 94°C for 2 min, followed by 33 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 1 min, and then a final extension at 72°C for 10 min. Five of the 30 µl of the PCR products were separated by 1.5% agarose gel electrophoresis and visualized under ultraviolet light after staining with ethidium bromide.


View this table:
[in this window]
[in a new window]

 
Table 1. Sequences of PCR primer sets used to amplify NADPH oxidase

 
Immunofluorescent staining. Immunofluorescent staining was performed as previously described (28). Human PSCs were directly plated on µ-slides (ibidi, Munich, Germany) and fixed with methanol for 10 min at –20°C. After being blocked with 10% normal goat serum, cells were incubated with rabbit anti-p22phox or mouse anti-p47phox antibody overnight at 4°C. After being washed, cells were incubated with fluorescein-conjugated goat anti-rabbit (for p22phox) or anti-mouse (for p47phox) IgG antibody (Jackson Immunoresearch, West Grove, PA) for 1 h. After being washed, cells were analyzed for fluorescence using a confocal laser scanning microscope (ECLIPSE TE2000-U, Nikon, Tokyo, Japan). Nuclear counterstaining was performed using propidium iodide.

Immunostaining. The pancreas tissues were removed from 20-wk-old male WBN/Kob rats and fixed by immersion in 4% paraformaldehyde overnight at 4°C. The specimens were embedded in regular paraffin wax and cut into 4-µm sections. Immunostaining for p47phox was performed as previously described (29) using a streptavidin-biotin-peroxidase complex detection kit (Histofine Kit; Nichirei, Tokyo, Japan). Tissue sections were deparaffinized and rehydrated in PBS. Endogenous peroxidase activity was blocked by incubation with 0.3% hydrogen peroxide for 30 min. After immersion in 10% normal rabbit serum for 1 h, the sections were incubated with mouse anti-p47phox antibody (at 1:100 dilution) overnight at 4°C. The slides were incubated with biotinylated rabbit anti-mouse IgG antibody for 45 min, followed by peroxidase-conjugated streptavidin for 30 min. Finally, color was developed by incubating the slides for several minutes with diaminobenzidine (Dojindo, Kumamoto, Japan). Immunostaining for glial fibrillary acidic protein (GFAP) and {alpha}-SMA was performed in a similar manner.

Measurement of ROS Production

Intracellular ROS production was assessed as previously described (6). Human PSCs were loaded with the redox-sensitive dye 2',7'-dichlorofluorescin diacetate (DCF-DA; at 10 µM) for 20 min at 37°C. Cells were gently washed with serum-free medium and stimulated with the agonists. The fluorescent 2',7'-dichlorofluorescin was detected using a confocal laser scanning microscope. For some experiments, cells were treated with DPI (at 10 µM) or apocynin (at 100 µM) for 15 min prior to the stimulation with the agonists. Experiments were repeated three times, which gave similar results.

Cell Proliferation Assay

Serum-starved rat PSCs were left untreated or treated with PDGF in the absence or presence of DPI in a 96-well tissue culture plate (Becton Dickinson, Franklin Lakes, NJ). Cell proliferation was assessed using a commercial kit [Cell proliferation ELISA, 5-bromo-2'-deoxyuridine (BrdU); Roche Diagnostics] according to the manufacturer's instruction. This is a colorimetric immunoassay based on the measurement of BrdU incorporation during DNA synthesis. After 24-h incubation with experimental reagents, cells were labeled with BrdU for 3 h. Cells were fixed and incubated with peroxidase-conjugated anti-BrdU antibody. Then the peroxidase substrate 3,3',5,5'-tetramethylbenzidine was added, and BrdU incorporation was quantitated by differences in absorbance at wavelength 370 minus 492 nm.

Real-Time PCR

The levels of {alpha}1(I)procollagen, {alpha}1(III)procollagen, and {alpha}-SMA mRNAs were examined by real-time PCR as previously described (29). Total RNA (~100 ng) was reverse transcribed in a volume of 20 µl. The resultant cDNA (2 µl) was subjected to real-time PCR with the LightCycler-FastStart DNA Master SYBR Green I kit (Roche Diagnostics), using the LightCycler instrument (Roche Diagnostics). Specific primer sets were as follows (listed 5'-3'; forward and reverse, respectively): {alpha}1(I)procollagen, TCACCTACAGCACGCTTG and GGTCTGTTTCCAGGGTTG; {alpha}1(III)procollagen, ATATCAAACACGCAAGGC and GATTAAAGCAAGAGGAACAC; {alpha}-SMA, TGTGCTGGACTCTGGAGATG and GATCACCTGCCCATCAGG; GAPDH, ACATCATCCCTGCATCCACT and GGGAGTTGCTGTTGAAGTCA. Reactions were performed in a volume of 20 µl containing 0.5 µM primers and 2.5 mM MgCl2. The PCR protocol consisted of an initial denaturation step at 95°C for 10 min and 50 cycles of denaturation (95°C for 15 s), annealing (60°C for 10 s), and extension (72°C for 10 s). For each step, the temperature transition rate was 20°C/s. Melting curve analyses were performed to confirm the PCR product identity and to differentiate specific amplification from nonspecific products by denaturation (95°C for 10 s), annealing (65°C for 10 s), and a slow heating to 95°C (temperature transition rate, 0.1°C/s), combined with a continuous fluorescence measurement at 0.2°C increments. After completion of PCR, the copy number of the target molecules was calculated by plotting fluorescence vs. cycle number. As a standard curve, we used the linear regression line based on the data of standard crossing points (threshold cycle) vs. the logarithm of standard sample concentrations. The expression levels of target genes were evaluated by the ratio of the target mRNA to that of GAPDH.

Chemokine Assay

Serum-starved rat PSCs were left untreated or treated with IL-1β in the absence or presence of DPI or apocynin for 24 h. The levels of monocyte chemoattractant protein (MCP)-1 and cytokine-induced neutrophil chemoattractant (CINC)-1 in the culture supernatants were measured by ELISA (MCP-1 assay from Pierce Chemical, Rockford, IL, and CINC-1 assay from Amersham Biosciences UK, Little Chalfont, Buckinghamshire, UK) according to the manufacturers' instruction.

Luciferase Assay

Luciferase assay was performed as previously described (30) using the luciferase expression vectors containing two consensus NF-{kappa}B-binding sites (GGGACTTTCC) or activator protein-1 (AP-1)-binding sites (TGACTCA), which were kindly provided by Dr. Naofumi Mukaida (Kanazawa University, Japan). PSCs (~1 x 106) were transfected with 2 µg of the luciferase expression vector, along with 40 ng of pRL-TK vector (Promega, Madison, WI) as an internal control, using the FuGENE6 reagent (Roche Diagnostics). After 24 h, the transfected cells were treated with IL-1β in the absence or presence of DPI for an additional 24 h. At the end of the incubation, cell lysates were prepared using Pica Gene kit (Toyo Ink, Tokyo, Japan), and the light intensities were measured using a model Lumat LB9507 Luminescence Reader (EG&G Berthold, Bad Wildbad, Germany).

Western Blot Analysis

Activation of MAPKs was examined by Western blot analysis using anti-phosphospecific MAPK antibodies (Cell Signaling, Beverly, MA) as previously described (28). Cells were lysed, and total cell lysates (~100 µg) were fractionated on a 10% SDS-polyacrylamide gel. They were transferred to a nitrocellulose membrane (Bio-Rad, Hercules, CA), and the membrane was incubated overnight at 4°C with rabbit antibodies against phosphorylated MAPKs. After incubation with peroxidase-conjugated goat anti-rabbit IgG antibody, proteins were visualized with the use of an ECL kit (Amersham Biosciences UK). The levels of total MAPKs, {alpha}-SMA, type I collagen, I{kappa}B-{alpha}, and GAPDH were determined in a similar manner.

Effect of DPI on Spontaneous Activation of PSCs in Culture

Freshly isolated PSCs were incubated with or without DPI (at 5 µM) in serum-free medium for 1 h, and then FBS was added at the final concentration of 5%. After 5-day incubation, morphological changes characteristic of PSC activation were assessed after staining with GFAP.

Effect of DPI on the Development of Pancreatic Fibrosis In Vivo

WBN/Kob rats model. After an adaptation period of 3 wk, DPI was administered orally in drinking water (1 mg·kg body wt–1·day–1) to 10-wk-old male WBN/Kob rats continuously until they were euthanized after 20 wk of age. This dose was shown to be well tolerated and effective in long-term studies in the rats (11, 22). Control rats received the drinking water containing vehicle (0.02% DMSO). Each group consisted of six animals. There were no significant differences in body weight development between the two groups. Pancreas specimens were routinely fixed in 4% paraformaldehyde in PBS and embedded in paraffin. Tissue sections were stained with hematoxylin and eosin (H & E) or Sirius red, which preferentially labels collagen fibrils with red color. Immunostaining for {alpha}-SMA was also performed.

Dibutyltin dichloride model. Chronic pancreatitis was induced in male Lewis rats by single administration of 7 mg/kg dibutyltin dichloride (DBTC) as previously reported (19). Starting 7 days before the administration of DBTC, DPI was administered orally in drinking water (1 mg·kg body wt–1·day–1) until 28 days after the administration when rats were euthanized. Tissue sections were stained with H & E or Sirius red.

Statistical Analysis

The results were expressed as means ± SD. Experiments were performed at least three times, and similar results were obtained. Differences between the groups were evaluated by ANOVA, followed by Fishers test for post hoc analysis. A P value <0.05 was considered statistically significant.


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Rat and human PSCs expressed key components of NADPH oxidase. Freshly isolated PSCs were induced to transform to a myofibroblast-like phenotype by culture on plastic in serum-containing medium. Progressive activation of PSCs was demonstrated by their expression of {alpha}-SMA (data not shown). Reverse transcription-PCR showed that all of rat quiescent, rat culture-activated, and human activated PSCs expressed mRNAs for p22phox, p47phox, gp91phox/NOX2, NOX1, and NOX4 (Fig. 1A). In our experimental system, p67phox and NOX3 were not detected. With the use of the same primer sets, p67phox and NOX3 were detected in human monocytic THP-1 cells and hepatoma HepG2 cells, respectively (data not shown). Human PSCs expressed NOX activator 1 but not NOX organizer 1 (Fig. 1B). Expression of NOX organizer 1 was detected in human colon cancer Colo205 cells. Expression of p22phox and p47phox in human PSCs was confirmed by immunofluorescent staining (Fig. 1, C and D); p22phox and p47phox expression was observed mainly in the membrane and cytoplasm, respectively. In vivo, p47phox expression was observed in the fibrotic areas in the pancreas of WBN/Kob rats, a model of spontaneous chronic pancreatitis (Fig. 1E). Of note, pancreatic acinar cells were negative for p47phox expression.


Figure 1
View larger version (85K):
[in this window]
[in a new window]

 
Fig. 1. Pancreatic stellate cells (PSCs) expressed key components of NADPH oxidase. A: total RNA was prepared from rat freshly isolated PSCs, rat culture-activated PSCs, and human activated PSCs. Expression of NADPH oxidase was examined by reverse transcription-PCR. The predicted sizes of the PCR products are shown in Table 1. All of rat freshly isolated, rat culture-activated, and human activated PSCs expressed p22phox, p47phox, gp91phox/NOX2, NOX1, and NOX4. sm, size marker (100-bp ladder). B: total RNA was prepared from human PSCs (P) and human colon cancer Colo205 cells (Co). Expression of NOX activator 1 (NOXA1) and NOX organizer 1 (NOXO1) was examined by reverse transcription-PCR. C and D: expression of p22phox (C) and p47phox (D) was examined by immunofluorescent staining. Nuclear counterstaining was performed using propidium iodide. Expression of p22phox and p47phox was observed mainly in the membrane and cytoplasm, respectively. E: expression of p47phox in the pancreas of Wistar Bonn/Kobori (WBN/Kob) rats was examined by immunostaining. p47phox expression was observed in the fibrotic areas, whereas pancreatic acinar cells were negative.

 
Cytokines and growth factors induced ROS production through NADPH oxidase system in PSCs. We examined the effects of cytokines and growth factors on ROS production. Oxidized DCF fluorescence was increased inside the cells in response to PDGF-BB, IL-1β, and angiotensin II, whereas fluorescence was barely detectable without the stimulation (Fig. 2). Increased ROS production was abolished in the presence of NADPH oxidase inhibitors DPI and apocynin, suggesting a role of the NADPH oxidase for ROS production.


Figure 2
View larger version (31K):
[in this window]
[in a new window]

 
Fig. 2. NADPH oxidase mediates reactive oxygen species (ROS) production in PSCs. Rat PSCs loaded with the redox-sensitive dye dichlorofluorescin diacetate (DCF-DA) (at 5 µM) were left untreated (control, Cont) or treated with IL-1β (at 2 ng/ml), PDGF-BB (at 25 ng/ml), or angiotensin II (Ang II, at 100 nM) in the absence (–) or presence of diphenylene iodonium (DPI) (at 10 µM) or apocynin (Apo, at 100 µM). The fluorescent 2',7'-dichlorofluorescin was detected using a confocal laser scanning microscope.

 
DPI inhibited proliferation and chemokine production in PSCs. PDGF-BB significantly increased proliferation of rat PSCs (Fig. 3A). PDGF-induced proliferation was inhibited by DPI in a dose-dependent manner. In these experiments, DPI up to 25 µM did not affect cell viability during the incubation as assessed by a trypan blue exclusion test (data not shown). Proliferation of PSCs was unaffected by inhibitors of other flavoprotein oxidases, including mitochondrial complex I inhibitor (rotenone, at 1 µM), mitochondrial complex III inhibitor (antimycin, at 1 µM), xanthine oxidase (allopurinol, at 1 mM), or nitric oxide synthase inhibitor (N{omega}-nitro-L-arginine methyl, at 1 mM) (data not shown).


Figure 3
View larger version (19K):
[in this window]
[in a new window]

 
Fig. 3. DPI inhibited proliferation and chemokine production in PSCs. Serum-starved rat PSCs were left untreated (Cont) or treated with PDGF-BB (at 25 ng/ml, A) or IL-1β (at 2 ng/ml, B) in the presence of DPI at the indicated concentrations (at µM) or apocynin (Apo, at 100 µM) for 24 h. A: DNA synthesis was assessed by 5-bromo-2'-deoxyuridine (BrdU) incorporation ELISA, and the optical density (O.D. 370-O.D. 492) of the sample is shown. B: monocyte chemoattractant protein-1 (MCP-1) and cytokine-induced neutrophil chemoattractant-1 (CINC-1) levels in the culture supernatant were determined by ELISA. Data shown are expressed as means + SD (n = 6). **P < 0.01 vs. respective positive control (PDGF or IL-1β treatment only).

 
Activated PSCs may acquire the ability to modulate the recruitment and activation of inflammatory cells, at least in part through the expression of chemokines MCP-1 and CINC-1 (26). IL-1β induced MCP-1 and CINC-1 production, and DPI decreased the chemokine production in a dose-dependent manner (Fig. 3B). Apocynin, another inhibitor of NADPH oxidase (37), inhibited PDGF-induced proliferation and IL-1-induced chemokine production (Fig. 3).

DPI decreased the expression of {alpha}-SMA and collagen. It has been shown that activated PSCs express {alpha}-SMA and produce extracellular matrix such as type I and type III collagens (2, 5). DPI decreased the levels of {alpha}-SMA, {alpha}1(I) procollagen, and {alpha}1(III) procollagen mRNAs (Fig. 4, A and B). DPI also decreased the expression of {alpha}-SMA and type I collagen at the protein level (Fig. 4C).


Figure 4
View larger version (20K):
[in this window]
[in a new window]

 
Fig. 4. DPI decreased the expression of {alpha}-smooth muscle actin ({alpha}-SMA) and collagen. Rat PSCs were incubated with DPI at the indicated concentrations (A and B) or 10 µM (C) in serum-free medium. A and B: after 24-h incubation, total RNA was prepared, reverse transcribed, and the resultant cDNA was subjected to real-time PCR with the LightCycler instrument. The levels of {alpha}-SMA, {alpha}1(I) procollagen, and {alpha}1(III) procollagen mRNAs were evaluated by the ratio of the target mRNA to that of GAPDH. Data are shown as means + SD (% of the control, n = 5). **P < 0.01 vs. DPI at 0 µM. C: after 48-h incubation, total cell lysates (~100 µg) were prepared, and the levels of {alpha}-SMA, type I collagen, and GAPDH were determined by Western blot analysis.

 
DPI inhibited activation of MAPKs and AP-1 but not NF-{kappa}B. DPI inhibited IL-1β-induced activation of AP-1 but not of NF-{kappa}B (Fig. 5A). DPI did not affect IL-1-induced degradation of I{kappa}B-{alpha} (data not shown), further supporting the notion that DPI did not inhibit NF-{kappa}B activation. It has been shown that activation of MAPKs plays a key role in the PDGF-induced proliferation and IL-1-induced chemokine production in PSCs (25, 29, 30). DPI inhibited IL-1β- and PDGF-induced activation of ERK, JNK, and p38 MAPK (Fig. 5, B and C).


Figure 5
View larger version (34K):
[in this window]
[in a new window]

 
Fig. 5. DPI inhibited the activation of activator protein-1 (AP-1) and MAPKs but not of NF-{kappa}B. A: rat PSCs were transfected with the luciferase vectors (2x NF-{kappa}B or 2x AP-1), along with pRL-TK vector as an internal control. After 24 h, the transfected cells were left untreated (control, Cont) or treated with IL-1β (at 2 ng/ml) in the presence of DPI at the indicated concentrations (at µM). After another 24-h incubation, intracellular luciferase activities (RLU) were determined. The data are represented as means ± SD, calculated from 3 independent experiments as fold induction compared with the activity observed in control. B and C: rat PSCs were left untreated (Cont) or treated with IL-1β (at 2 ng/ml) or PDGF-BB (at 25 ng/ml) in the presence of DPI at the indicated concentrations (at µM) for 15 min. Total cell lysates were prepared, and the levels of MAPKs (phosphorylated and total) were determined by Western blot analysis.

 
DPI inhibited the transformation of freshly isolated PSCs. After 5 days, PSCs cultured in serum-containing medium without DPI showed transformation to a myofibroblast-like phenotype, whereas PSCs cultured in serum-free medium remained quiescent (Fig. 6, A and B). PSCs cultured in the presence of DPI (at 5 µM) were small and circular, with lipid droplets present in many cells (Fig. 6C). To rule out the possibility that the effects of DPI might have been due to its cytotoxicity, DPI was withdrawn from PSCs that had been treated with it for 5 days. Within 2 days after withdrawal of DPI, PSCs had acquired the activated phenotype (Fig. 6D).


Figure 6
View larger version (107K):
[in this window]
[in a new window]

 
Fig. 6. DPI inhibited the transformation of freshly isolated PSCs. Freshly isolated rat PSCs were treated with serum-free medium only (A) or 5% FBS in the absence (B) or presence (C) of DPI (at 5 µM). After 5-day incubation, morphological changes were assessed after staining with glial fibrillary acidic protein (GFAP). PSCs treated with DPI were still small and circular, with lipid droplets still present in many cells. D: DPI was withdrawn from PSCs that had been treated with it in the presence of 5% FBS for 5 days. Two days after the withdrawal of DPI, PSCs showed the typical phenotype of activated PSCs. Original magnification: x10 objective except for the inset in C (x40 objective).

 
DPI inhibited the development of pancreatic fibrosis in vivo. Finally, we examined whether DPI inhibited the development of pancreatic fibrosis in vivo. For this purpose, we employed WBN/Kob rats, an experimental model of spontaneous chronic pancreatitis (33). The pancreas of the control rats was severely atrophic, whereas that of the DPI-treated rats had an almost intact appearance (Fig. 7, A and B). All control rats had focal severe inflammation in the pancreas. Infiltration of inflammatory cells, degeneration and disappearance of acinar cells, and interlobular and intralobular fibrosis were observed in the control group (Fig. 7C). DPI improved gross alterations of the pancreas (Fig. 7, B and D); this protective effect was accompanied by decreased collagen accumulation, as assessed by Sirius red staining (Fig. 7, E and F). {alpha}-SMA-positive cells were localized in the periacinar fibrotic areas and vascular walls in the control group (Fig. 7G). In contrast, {alpha}-SMA-positive cells were observed only in the vascular walls in most of the specimens in the DPI-treated group (Fig. 7H).


Figure 7
View larger version (115K):
[in this window]
[in a new window]

 
Fig. 7. DPI inhibited the development of pancreatic fibrosis in WBN/Kob rats. DPI was administered in drinking water (1 mg·kg body wt–1·day–1) to 10-wk-old male WBN/Kob rats for 10 wk. A and B: gross appearance of the pancreas in the control (A) and DPI-treated (B) groups. CH: representative histological appearance of the pancreas in the control (C and E) and DPI-treated (D and F) groups [C and D, hematoxylin and eosin (H & E) staining; E and F, Sirius red staining; G and H, immunostaining for {alpha}-SMA]. Original magnification: x4 (CF) or x10 (G and H) objective.

 
DPI also inhibited the development of pancreatic fibrosis in another experimental model of chronic pancreatitis induced by DBTC (Fig. 8). Collectively, our results showed that DPI inhibited the development of pancreatic fibrosis in vivo using two experimental models of chronic pancreatitis.


Figure 8
View larger version (153K):
[in this window]
[in a new window]

 
Fig. 8. DPI inhibited the development of pancreatic fibrosis in dibutyltin dichloride (DBTC)-induced chronic pancreatitis. Chronic pancreatitis was induced in male Lewis rats by single administration of 7 mg/kg DBTC. Starting 7 days before the administration of DBTC, DPI was administered orally in drinking water (1 mg·kg body wt–1·day–1) until 28 days after the administration, when rats were euthanized. Representative histological appearance of the pancreas in the control (A and C) and DPI-treated (B and D) groups (A and B, H & E staining; C and D, Sirius red staining). Original magnification: x4 objective.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
We showed here that PSCs, the major fibrogenic cells in the injured pancreas, expressed key components of NADPH oxidase, which mediated intracellular ROS production induced by IL-1, PDGF, and angiotensin II. DPI, an inhibitor of NADPH oxidase, inhibited key parameters of PSC activation including proliferation, chemokine production, and expression of {alpha}-SMA and collagen genes. Apocynin, another inhibitor of NADPH oxidase (37), inhibited proliferation and chemokine production. DPI inhibited the spontaneous activation of freshly-isolated cells to a myofibroblast-like phenotype, supporting the idea that pro-oxidant production by PSCs might serve as an autocrine/paracrine stimulant during transformation (3). In addition, DPI inhibited the development of pancreatic fibrosis in WBN/Kob rats and in rats with DBTC-induced chronic pancreatitis. Collectively, these results suggest a role of NADPH oxidase in the activation and cell functions of PSCs, constituting a potential target for the treatment of pancreatic fibrosis. Our results agree with the previous studies showing the profibrogenic role of NADPH oxidase in the liver (1, 6) and heart (32). These inhibitory effects were not due to the cytotoxicity of DPI, but it should be noted that DPI might inhibit other flavin-containing enzymes including xanthine oxidase, mitochondrial complexes I and III, and nitric oxide synthase (7). We found that proliferation of PSCs was unaffected by inhibitors of these flavin-containing enzymes. Furthermore, apocynin, another inhibitor of NADPH oxidase, inhibited ROS production induced by cytokines and growth factors in PSCs. Apocynin also inhibited PDGF-induced proliferation and IL-1-induced chemokine production. Collectively, the results obtained herein using DPI were likely to reflect the inhibition of NADPH oxidase, although the role of other flavin-containing enzymes was not be completely excluded.

Not all NADPH oxidase homologues were expressed in PSCs; all of rat quiescent, rat culture-activated, and human activated PSCs did not express p67phox and NOX3. Expression of NADPH oxidase is cell-type specific and might be even different dependent on the location (7, 23). Immunostaining in WBN/Kob rats herein showed that pancreatic acinar cells were negative for p47phox expression, supporting the previous study showing that p47phox and p67phox were absent in rat isolated pancreatic acini (16). In phagocyte-type NADPH oxidase, p67phox plays an important role in superoxide production by directly interacting with NOX2 (14). In contrast, p67phox is scarcely expressed in nonphagocytic cells including vascular smooth muscle cells (23), similar to the absence of p67phox in PSCs. On the other hand, there were some differences in NADPH oxidase expression between PSCs and hepatic stellate cells, a counterpart of PSCs in the liver. Culture-activated hepatic stellate cells expressed mRNAs for p47phox, gp91phox, and NOX1, whereas quiescent cells did not express p47phox and gp91phox (6). Another report showed that IL-90 human hepatic stellate cell line and mouse hepatic stellate cells expressed p22phox, p47phox, p67phox, and gp91phox (1). The functionally important components of the NADPH oxidase and their potential interactions in PSCs remain to be clarified. Because several homologues are expressed, further studies are needed to clarify which NOX is the dominant functional homologue important for oxidase performance in PSCs. Interestingly, it has been shown that NOX4 mediates transforming growth factor-β1-induced transformation of fibroblasts to myofibroblasts (12).

In contrast to the relatively high levels of ROS produced by the phagocytic NADPH oxidase for microbicidal activity, most nonphagocytic cells produce low amounts of ROS that stimulate intracellular signaling pathways (7, 8). A variety of signal transduction and gene expression systems might be influenced by NADPH oxidase, including AP-1, NF-{kappa}B, and MAPKs. We showed here that DPI inhibited the activation of MAPKs and AP-1 but not of NF-{kappa}B. These findings agree with the previous study showing that DPI inhibited angiotensin II-induced activation of ERK, JNK, p38 MAPK, and AP-1 in hepatic stellate cells (6). Although it is possible that NF-{kappa}B is regulated by ROS-generating system that is not inhibited by DPI in PSCs, the failure of NF-{kappa}B inhibition agrees with our previous findings in PSCs that antioxidant polyphenols failed to inhibit NF-{kappa}B activation (29, 30). It has been recognized that redox-dependent activation of NF-{kappa}B is cell and stimulus specific, as opposed to the concept that oxidative stress is a common mediator of diverse NF-{kappa}B activators (18, 24). In human aortic smooth muscle cells, hydrogen peroxide failed to activate NF-{kappa}B or induce degradation of I{kappa}B-{alpha} (18). IL-1β did not increase intracellular oxidative stress, and IL-1β-induced NF-{kappa}B activation was not inhibited by the antioxidant N-acetylcysteine, excluding a role of oxidative stress in IL-1β-induced activation of NF-{kappa}B, at least in human aortic smooth muscle cells (18). Li and Karin (24) reported that when a redox-regulated effect on NF-{kappa}B is observed, it appears to occur downstream from the I{kappa}B kinase at the level of ubiquitination and/or degradation of I{kappa}B.

The most accepted theory is that ROS derived from injured pancreatic acinar cells and infiltrating inflammatory cells stimulate PSCs in a paracrine manner (3, 20, 21). Exogenous ROS including ethanol, acetaldehyde, hydrogen peroxide, and 4-hydroxynonenal have been shown to activate redox-sensitive intracellular signaling pathways in PSCs to increase collagen synthesis (3, 20, 21, 27). Conversely, expression of NADPH oxidase in PSCs suggests that PSCs are also an important source of ROS in pancreatic fibrosis, as in the case in the liver (6). Therefore, PSCs should no longer be viewed as a passive cell responding to exogenous ROS by neighboring cells but, in addition, regarded as an active participant in the pancreatic injury through production of ROS. In addition to PDGF, IL-1, and angiotensin II, we have found that transforming growth factor-β1, TNF-{alpha}, and high glucose induced ROS production through NADPH oxidase (A. Masamune, K. Kikuta, T. Shimosegawa, unpublished observations). Therefore, a variety of fibrogenic stimuli induce signals through NADPH oxidase in PSCs leading to the development of pancreatic fibrosis. Very recently, it has been shown that phagocytosis of apoptotic bodies derived from damaged hepatocytes by hepatic stellate cells activated NADPH oxidase (41). It is of interest to see whether similar mechanisms might exist in PSCs, where the ability of phagocytosis has been recently shown (36).

The WBN/Kob rats spontaneously develop chronic inflammatory changes of the pancreas. The main characteristics of human chronic pancreatitis, including infiltration of inflammatory cells and fibrosis replacing the progressively destroyed exocrine parenchyma, are present in the WBN/Kob model (33). This model has been widely used to test potential therapeutic agents for chronic pancreatitis including candesartan, an angiotensin II receptor antagonist (40). We showed here that DPI inhibited the development of pancreatic fibrosis in WBN/Kob rats. The protective effects were accompanied by a decreased number of {alpha}-SMA-positive cells (i.e., PSCs). In addition, we showed here that DPI inhibited the development of pancreatic fibrosis in DBTC-induced chronic pancreatitis in rats. Although PSCs might be a target of the actions of DPI based on the results obtained by in vitro studies, it is also likely that DPI directly inhibited infiltrating inflammatory cells where NADPH oxidase is significantly expressed. Interestingly, it has been shown that angiotensin receptor antagonists reduced NADPH oxidase activity in animals (38). Therefore, the therapeutic benefits associated with the angiotensin receptor antagonists might include their ability to inhibit NADPH oxidase. Further studies employing NADPH oxidase knockout mice would contribute to establishing the role of NADPH oxidase in pancreatic fibrosis.


    GRANTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
This study was supported in part by Grant-in-Aid from Japan Society for the Promotion of Science (to A. Masamune and to K. Kikuta), by the Pancreas Research Foundation of Japan (to A. Masamune and to K. Kikuta), by the Kanae Foundation for Life and Socio-Medical Science (to A. Masamune), and by the Uehara Memorial Foundation (to A. Masamune).


    FOOTNOTES
 

Address for reprint requests and other correspondence: Atsushi Masamune, Div. of Gastroenterology, Tohoku Univ. Graduate School of Medicine, 1-1 Seiryo-machi, Aoba-ku, Sendai 980-8574 Japan (e-mail: amasamune{at}int3.med.tohoku.ac.jp)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

* A. Masamune and T. Watanabe contributed equally to this work. Back


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Adachi T, Togashi H, Suzuki A, Kasai S, Ito J, Sugahara K, Kawata S. NAD(P)H oxidase plays a crucial role in PDGF-induced proliferation of hepatic stellate cells. Hepatology 41: 1272–1281, 2005.[CrossRef][Web of Science][Medline]
  2. Apte MV, Haber PS, Applegate TL, Norton ID, McCaughan GW, Korsten MA, Pirola RC, Wilson JS. Periacinar stellate shaped cells in rat pancreas: identification, isolation and culture. Gut 43: 128–133, 1998.[Abstract/Free Full Text]
  3. Apte MV, Phillips PA, Fahmy RG, Darby SJ, Rodgers SC, McCaughan GW, Korsten MA, Pirola RC, Naidoo D, Wilson JS. Does alcohol directly stimulate pancreatic fibrogenesis? Studies with rat pancreatic stellate cells. Gastroenterology 118: 780–794, 2000.[CrossRef][Web of Science][Medline]
  4. Babior BM. NADPH oxidase: an update. Blood 93: 1464–1476, 1999.[Free Full Text]
  5. Bachem MG, Schunemann M, Ramadani M, Siech M, Beger H, Buck A, Zhou S, Schmid-Kotsas A, Adler G. Pancreatic carcinoma cells induce fibrosis by stimulating proliferation and matrix synthesis of stellate cells. Gastroenterology 128: 907–921, 2005.[CrossRef][Web of Science][Medline]
  6. Bataller R, Schwabe RF, Choi YH, Yang L, Paik YH, Lindquist J, Qian T, Schoonhoven R, Hagedorn CH, Lemasters JJ, Brenner DA. NADPH oxidase signal transduces angiotensin II in hepatic stellate cells and is critical in hepatic fibrosis. J Clin Invest 112: 1383–1394, 2003.[CrossRef][Web of Science][Medline]
  7. Bedard K, Krause KH. The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiol Rev 87: 245–313, 2007.[Abstract/Free Full Text]
  8. Bokoch GM, Knaus UG. NADPH oxidases: not just for leukocytes any more! Trends Biochem Sci 28: 502–508, 2003.[CrossRef][Web of Science][Medline]
  9. Braganza JM. The pathogenesis of chronic pancreatitis. QJM 89: 243–250, 1996.[Free Full Text]
  10. Casini A, Galli A, Pignalosa P, Frulloni L, Grappone C, Milani S, Pederzoli P, Cavallini G, Surrenti C. Collagen type I synthesized by pancreatic periacinar stellate cells (PSC) co-localizes with lipid peroxidation-derived aldehydes in chronic alcoholic pancreatitis. J Pathol 192: 81–89, 2000.[CrossRef][Web of Science][Medline]
  11. Cooper JM, Petty RK, Hayes DJ, Challiss RA, Brosnan MJ, Shoubridge EA, Radda GK, Morgan-Hughes JA, Clark JB. An animal model of mitochondrial myopathy: a biochemical and physiological investigation of rats treated in vivo with the NADH-CoQ reductase inhibitor, diphenyleneiodonium. J Neurol Sci 83: 335–347, 1988.[CrossRef][Web of Science][Medline]
  12. Cucoranu I, Clempus R, Dikalova A, Phelan PJ, Ariyan S, Dikalov S, Sorescu D. NAD(P)H oxidase 4 mediates transforming growth factor-beta1-induced differentiation of cardiac fibroblasts into myofibroblasts. Circ Res 97: 900–907, 2005.[Abstract/Free Full Text]
  13. Etemad B, Whitcomb DC. Chronic pancreatitis: diagnosis, classification and new genetic developments. Gastroenterology 120: 682–707, 2001.[CrossRef][Web of Science][Medline]
  14. Gorzalczany Y, Alloul N, Sigal N, Weinbaum C, Pick E. A prenylated p67phox-Rac1 chimera elicits NADPH-dependent superoxide production by phagocyte membranes in the absence of an activator and of p47phox: conversion of a pagan NADPH oxidase to monotheism. J Biol Chem 277: 18605–18610, 2002.[Abstract/Free Full Text]
  15. Griendling KK, Sorescu D, Ushio-Fukai M. NAD(P)H oxidase: role in cardiovascular biology and disease. Circ Res 86: 494–501, 2000.[Abstract/Free Full Text]
  16. Gukovskaya AS, Vaquero E, Zaninovic V, Gorelick FS, Lusis AJ, Brennan ML, Holland S, Pandol SJ. Neutrophils and NADPH oxidase mediate intrapancreatic trypsin activation in murine experimental acute pancreatitis. Gastroenterology 122: 974–984, 2002.[CrossRef][Web of Science][Medline]
  17. Haber PS, Keogh GW, Apte MV, Moran CS, Stewart NL, Crawford DH, Pirola RC, McCaughan GW, Ramm GA, Wilson JS. Activation of pancreatic stellate cells in human and experimental pancreatic fibrosis. Am J Pathol 155: 1087–1095, 1999.[Abstract/Free Full Text]
  18. Hoare GS, Marczin N, Chester AH, Yacoub MH. Role of oxidant stress in cytokine-induced activation of NF-{kappa}B in human aortic smooth muscle cells. Am J Physiol Heart Circ Physiol 277: H1975–H1984, 1999.[Abstract/Free Full Text]
  19. Inoue M, Ino Y, Gibo J, Ito T, Hisano T, Arita Y, Nawata H. The role of monocyte chemoattractant protein-1 in experimental chronic pancreatitis model induced by dibutyltin dichloride in rats. Pancreas 25: e64–e70, 2002.[CrossRef][Medline]
  20. Kikuta K, Masamune A, Satoh M, Suzuki N, Satoh K, Shimosegawa T. Hydrogen peroxide activates activator protein-1 and mitogen-activated protein kinases in pancreatic stellate cells. Mol Cell Biochem 291: 11–20, 2006.[CrossRef][Web of Science][Medline]
  21. Kikuta K, Masamune A, Satoh M, Suzuki N, Shimosegawa T. 4-hydroxy-2, 3-nonenal activates activator protein-1 and mitogen-activated protein kinases in rat pancreatic stellate cells. World J Gastroenterol 10: 2344–2351, 2004.[Medline]
  22. Kono H, Rusyn I, Uesugi T, Yamashina S, Connor HD, Dikalova A, Mason RP, Thurman RG. Diphenyleneiodonium sulfate, an NADPH oxidase inhibitor, prevents early alcohol-induced liver injury in the rat. Am J Physiol Gastrointest Liver Physiol 280: G1005–G1012, 2001.[Abstract/Free Full Text]
  23. Lassegue B, Clempus RE. Vascular NAD(P)H oxidases: specific features, expression, and regulation. Am J Physiol Regul Integr Comp Physiol 285: R277–R297, 2003.[Abstract/Free Full Text]
  24. Li N, Karin M. Is NF-kappaB the sensor of oxidative stress? FASEB J 13: 1137–1143, 1999.[Abstract/Free Full Text]
  25. Masamune A, Kikuta K, Satoh M, Kume K, Shimosegawa T. Differential roles of signaling pathways for proliferation and migration of rat pancreatic stellate cells. Tohoku J Exp Med 199: 69–84, 2003.[CrossRef][Web of Science][Medline]
  26. Masamune A, Kikuta K, Satoh M, Sakai Y, Satoh A, Shimosegawa T. Ligands of peroxisome proliferator-activated receptor-gamma block activation of pancreatic stellate cells. J Biol Chem 277: 141–147, 2002.[Abstract/Free Full Text]
  27. Masamune A, Kikuta K, Satoh M, Satoh A, Shimosegawa T. Alcohol activates activator protein-1 and MAP kinases in rat pancreatic stellate cells. J Pharmacol Exp Ther 302: 36–42, 2002.[Abstract/Free Full Text]
  28. Masamune A, Satoh M, Hirabayashi J, Kasai K, Satoh K, Shimosegawa T. Galectin-1 induces chemokine production and proliferation in pancreatic stellate cells. Am J Physiol Gastrointest Liver Physiol 290: G729–G736, 2006.[Abstract/Free Full Text]
  29. Masamune A, Satoh M, Kikuta K, Suzuki N, Satoh K, Shimosegawa T. Ellagic acid blocks activation of pancreatic stellate cells. Biochem Pharmacol 70: 869–878, 2005.[CrossRef][Web of Science][Medline]
  30. Masamune A, Suzuki N, Kikuta K, Satoh M, Satoh K, Shimosegawa T. Curcumin blocks activation of pancreatic stellate cells. J Cell Biochem 97: 1080–1093, 2006.[CrossRef][Web of Science][Medline]
  31. Meier B, Cross AR, Hancock JT, Kaup FJ, Jones OT. Identification of a superoxide-generating NADPH oxidase system in human fibroblasts. Biochem J 275: 241–245, 1991.[Web of Science][Medline]
  32. Murdoch CE, Zhang M, Cave AC, Shah AM. NADPH oxidase-dependent redox signalling in cardiac hypertrophy, remodelling and failure. Cardiovasc Res 71: 208–215, 2006.[Abstract/Free Full Text]
  33. Ohashi K, Kim JH, Hara H, Aso R, Akimoto T, Nakama K. WBN/Kob rats. A new spontaneously occurring model of chronic pancreatitis. Int J Pancreatol 6: 231–247, 1990.[Web of Science][Medline]
  34. Omary MB, Lugea A, Lowe AW, Pandol SJ. The pancreatic stellate cell: a star on the rise in pancreatic diseases. J Clin Invest 117: 50–59, 2007.[CrossRef][Web of Science][Medline]
  35. Saotome T, Inoue H, Fujimiya M, Fujiyama Y, Bamba T. Morphological and immunocytochemical identification of periacinar fibroblast-like cells derived from human pancreatic acini. Pancreas 14: 373–382, 1997.[Web of Science][Medline]
  36. Shimizu K, Kobayashi M, Tahara J, Shiratori K. Cytokines and peroxisome proliferator-activated receptor gamma ligand regulate phagocytosis by pancreatic stellate cells. Gastroenterology 128: 2105–2118, 2005.[CrossRef][Medline]
  37. Stolk J, Hiltermann TJ, Dijkman JH, Verhoeven AJ. Characteristics of the inhibition of NADPH oxidase activation in neutrophils by apocynin, a methoxy-substituted catechol. Am J Respir Cell Mol Biol 11: 95–102, 1994.[Abstract]
  38. Warnholtz A, Nickenig G, Schulz E, Macharzina R, Brasen JH, Skatchkov M, Heitzer T, Stasch JP, Griendling KK, Harrison DG, Bohm M, Meinertz T, Munzel T. Increased NADH-oxidase-mediated superoxide production in the early stages of atherosclerosis: evidence for involvement of the renin-angiotensin system. Circulation 99: 2027–2033, 1999.[Abstract/Free Full Text]
  39. Weintraub NL. NOX response to injury. Arterioscler Thromb Vasc Biol 22: 4–5, 2002.[Free Full Text]
  40. Yamada T, Kuno A, Masuda K, Ogawa K, Sogawa M, Nakamura S, Ando T, Sano H, Nakazawa T, Ohara H, Nomura T, Joh T, Itoh M. Candesartan, an angiotensin II receptor antagonist, suppresses pancreatic inflammation and fibrosis in rats. J Pharmacol Exp Ther 307: 17–23, 2003.[Abstract/Free Full Text]
  41. Zhan SS, Jiang JX, Wu J, Halsted C, Friedman SL, Zern MA, Torok NJ. Phagocytosis of apoptotic bodies by hepatic stellate cells induces NADPH oxidase and is associated with liver fibrosis in vivo. Hepatology 43: 435–443, 2006.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
J. Pharmacol. Exp. Ther.Home page
Y. C. Chan and P. S. Leung
Involvement of Redox-Sensitive Extracellular-Regulated Kinases in Angiotensin II-Induced Interleukin-6 Expression in Pancreatic Acinar Cells
J. Pharmacol. Exp. Ther., May 1, 2009; 329(2): 450 - 458.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
A Masamune, K Kikuta, T Watanabe, K Satoh, M Hirota, S Hamada, and T Shimosegawa
Fibrinogen induces cytokine and collagen production in pancreatic stellate cells
Gut, April 1, 2009; 58(4): 550 - 559.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. Masamune, K. Kikuta, T. Watanabe, K. Satoh, M. Hirota, and T. Shimosegawa
Hypoxia stimulates pancreatic stellate cells to induce fibrosis and angiogenesis in pancreatic cancer
Am J Physiol Gastrointest Liver Physiol, October 1, 2008; 295(4): G709 - G717.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/1/G99    most recent
00272.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Masamune, A.
Right arrow Articles by Shimosegawa, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Masamune, A.
Right arrow Articles by Shimosegawa, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.