|
|
||||||||
INFLAMMATION/IMMUNITY/MEDIATORS
Division of Gastroenterology, Tohoku University Graduate School of Medicine, Sendai, Miyagi, Japan
Submitted 15 June 2007 ; accepted in final form 24 October 2007
| ABSTRACT |
|---|
|
|
|---|
-smooth muscle actin and collagen. DPI inhibited transformation of freshly isolated cells to a myofibroblast-like phenotype. In addition, DPI inhibited the development of pancreatic fibrosis in Wistar Bonn/Kobori rats and in rats with DBTC-induced chronic pancreatitis. In conclusion, PSCs express NADPH oxidase to generate ROS, which mediates key cell functions and activation of PSCs. NADPH oxidase might be a potential target for the treatment of pancreatic fibrosis.
pancreatitis; pancreatic fibrosis; oxidative stress
-smooth muscle actin (
-SMA) and extracellular matrix components such as type I collagen, type III collagen, and fibronectin. Upon activation, PSCs actively proliferate, migrate, and produce proinflammatory cytokines and chemokines. Many of the morphological and metabolic changes associated with the activation of PSCs in animal models of fibrosis also occur when the cells are grown in serum-containing medium in culture on plastic (2, 5, 34). There is accumulating evidence that activated PSCs play a pivotal role in the development of pancreatic fibrosis (2, 5, 17, 26, 34). In addition, PSCs may participate in the pathogenesis of acute pancreatitis (26, 34). Obviously, control of the activation of PSCs and their cell functions is a potential target for the treatment of pancreatic fibrosis and inflammation. Oxidative stress has been implicated in the pathogenesis of acute and chronic pancreatitis (9, 13). Along this line, previous studies have suggested a role of intracellular oxidant in the activation and cell functions, especially collagen synthesis, of PSCs (3, 27). Antioxidants such as plant polyphenols inhibited the activation and cell functions of PSCs (29, 30). NADPH oxidase might be a source of oxidants in injured pancreas. NADPH oxidase is an enzyme primarily found in professional phagocytes such as neutrophils and macrophages (4, 7). NADPH oxidase is a multicomponent enzyme; the classical phagocytic NADPH oxidase is composed of the membrane-bound subunits p22phox and gp91phox (also termed as NOX2), as well as the cytosolic subunits including p67phox and p47phox (4, 7). Upon activation, the cytosolic subunits translocate to the membrane to form the active NADPH oxidase complex. The activated oxidase produces extracellular superoxide that plays a major role in host defense against microbial infection. In addition, NADPH oxidase has been found in a number of nonphagocytic cells including vascular smooth muscle cells (15), fibroblasts (31), and hepatic stellate cells (6). Nonphagocytic NADPH oxidase is structurally and functionally similar to phagocytic NADPH oxidase, but some features are different (8, 39). For example, unlike the phagocytic type, nonphagocytic NADPH oxidase is constitutively active, producing relatively low levels of reactive oxygen species (ROS) under basal conditions and generating higher levels of oxidants in response to cytokines and growth factors. Increased ROS production results in the stimulation of redox-sensitive intracellular signaling pathways (8, 39). Another difference is related to several homologues that replace classical components (7). Vascular smooth muscle cells express NOX1, NOX3, and NOX4 to replace gp91phox/NOX2.
The expression and regulation of cell functions by NADPH oxidase in PSCs have yet to be clarified. We show here that PSCs express key components of NADPH oxidase to generate ROS, which mediate key cell functions and activation of PSCs. In addition, diphenylene iodonium (DPI), an inhibitor of NADPH oxidase (7), inhibited the development of pancreatic fibrosis in vivo, suggesting that NADPH oxidase is a potential target for the treatment of pancreatic fibrosis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Rabbit anti-p22phox and mouse anti-p47phox antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Goat anti-type I collagen antibody was purchased from Southern Biotechnology (Birmingham, AL). Collagenase P, recombinant human IL-1β, and rat PDGF-BB were from Roche Diagnostics (Mannheim, Germany). All other reagents were from Sigma-Aldrich (St. Louis, MO) unless specifically described. Male Wistar, Wistar Bonn/Kobori (WBN/Kob), and Lewis rats were from Japan SLC (Hamamatsu, Japan). All animal procedures were performed in accordance with the National Institutes of Health Animal Care and Use Guidelines.
Cell Culture
Rat PSCs were prepared from the pancreas tissues of male Wistar rats weighing 200–250 g, with the use of the Nycodenz solution (Nycomed Pharma, Oslo, Norway) as previously described (25). Human PSCs were isolated from the resected normal pancreas of patients undergoing operation for pancreatic cancer as previously described (35), under the approval by the Ethics Committee of Tohoku University School of Medicine. Human colonic cancer Colo205 cells were obtained from American Type Culture Collection (Manassas, VA). Cells were maintained in Ham's F-12/DMEM supplemented with 10% heat-inactivated FBS (MP Biomedicals, Irvine, CA), penicillin sodium, and streptomycin sulfate. Experiments were performed using rat PSCs between passages 2 and 4 and human PSCs between passages 3 and 7 after isolation except for those using freshly isolated rat PSCs. Unless specifically described, we incubated PSCs in serum-free medium for 24 h before the addition of experimental reagents. For some experiments, DPI and apocynin were added 30 min before the addition of the stimuli.
Expression of NADPH Oxidase
Reverse transcription-PCR. Total RNA was prepared using RNeasy total RNA preparation kit (Qiagen, Valencia, CA). Total RNA (200 ng) was reverse transcribed, and the resultant cDNA was subjected to PCR. Primer sequences and expected size of the PCR products are shown in Table 1. Cycle condition was as follows: preheating at 94°C for 2 min, followed by 33 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 1 min, and then a final extension at 72°C for 10 min. Five of the 30 µl of the PCR products were separated by 1.5% agarose gel electrophoresis and visualized under ultraviolet light after staining with ethidium bromide.
|
Immunostaining.
The pancreas tissues were removed from 20-wk-old male WBN/Kob rats and fixed by immersion in 4% paraformaldehyde overnight at 4°C. The specimens were embedded in regular paraffin wax and cut into 4-µm sections. Immunostaining for p47phox was performed as previously described (29) using a streptavidin-biotin-peroxidase complex detection kit (Histofine Kit; Nichirei, Tokyo, Japan). Tissue sections were deparaffinized and rehydrated in PBS. Endogenous peroxidase activity was blocked by incubation with 0.3% hydrogen peroxide for 30 min. After immersion in 10% normal rabbit serum for 1 h, the sections were incubated with mouse anti-p47phox antibody (at 1:100 dilution) overnight at 4°C. The slides were incubated with biotinylated rabbit anti-mouse IgG antibody for 45 min, followed by peroxidase-conjugated streptavidin for 30 min. Finally, color was developed by incubating the slides for several minutes with diaminobenzidine (Dojindo, Kumamoto, Japan). Immunostaining for glial fibrillary acidic protein (GFAP) and
-SMA was performed in a similar manner.
Measurement of ROS Production
Intracellular ROS production was assessed as previously described (6). Human PSCs were loaded with the redox-sensitive dye 2',7'-dichlorofluorescin diacetate (DCF-DA; at 10 µM) for 20 min at 37°C. Cells were gently washed with serum-free medium and stimulated with the agonists. The fluorescent 2',7'-dichlorofluorescin was detected using a confocal laser scanning microscope. For some experiments, cells were treated with DPI (at 10 µM) or apocynin (at 100 µM) for 15 min prior to the stimulation with the agonists. Experiments were repeated three times, which gave similar results.
Cell Proliferation Assay
Serum-starved rat PSCs were left untreated or treated with PDGF in the absence or presence of DPI in a 96-well tissue culture plate (Becton Dickinson, Franklin Lakes, NJ). Cell proliferation was assessed using a commercial kit [Cell proliferation ELISA, 5-bromo-2'-deoxyuridine (BrdU); Roche Diagnostics] according to the manufacturer's instruction. This is a colorimetric immunoassay based on the measurement of BrdU incorporation during DNA synthesis. After 24-h incubation with experimental reagents, cells were labeled with BrdU for 3 h. Cells were fixed and incubated with peroxidase-conjugated anti-BrdU antibody. Then the peroxidase substrate 3,3',5,5'-tetramethylbenzidine was added, and BrdU incorporation was quantitated by differences in absorbance at wavelength 370 minus 492 nm.
Real-Time PCR
The levels of
1(I)procollagen,
1(III)procollagen, and
-SMA mRNAs were examined by real-time PCR as previously described (29). Total RNA (
100 ng) was reverse transcribed in a volume of 20 µl. The resultant cDNA (2 µl) was subjected to real-time PCR with the LightCycler-FastStart DNA Master SYBR Green I kit (Roche Diagnostics), using the LightCycler instrument (Roche Diagnostics). Specific primer sets were as follows (listed 5'-3'; forward and reverse, respectively):
1(I)procollagen, TCACCTACAGCACGCTTG and GGTCTGTTTCCAGGGTTG;
1(III)procollagen, ATATCAAACACGCAAGGC and GATTAAAGCAAGAGGAACAC;
-SMA, TGTGCTGGACTCTGGAGATG and GATCACCTGCCCATCAGG; GAPDH, ACATCATCCCTGCATCCACT and GGGAGTTGCTGTTGAAGTCA. Reactions were performed in a volume of 20 µl containing 0.5 µM primers and 2.5 mM MgCl2. The PCR protocol consisted of an initial denaturation step at 95°C for 10 min and 50 cycles of denaturation (95°C for 15 s), annealing (60°C for 10 s), and extension (72°C for 10 s). For each step, the temperature transition rate was 20°C/s. Melting curve analyses were performed to confirm the PCR product identity and to differentiate specific amplification from nonspecific products by denaturation (95°C for 10 s), annealing (65°C for 10 s), and a slow heating to 95°C (temperature transition rate, 0.1°C/s), combined with a continuous fluorescence measurement at 0.2°C increments. After completion of PCR, the copy number of the target molecules was calculated by plotting fluorescence vs. cycle number. As a standard curve, we used the linear regression line based on the data of standard crossing points (threshold cycle) vs. the logarithm of standard sample concentrations. The expression levels of target genes were evaluated by the ratio of the target mRNA to that of GAPDH.
Chemokine Assay
Serum-starved rat PSCs were left untreated or treated with IL-1β in the absence or presence of DPI or apocynin for 24 h. The levels of monocyte chemoattractant protein (MCP)-1 and cytokine-induced neutrophil chemoattractant (CINC)-1 in the culture supernatants were measured by ELISA (MCP-1 assay from Pierce Chemical, Rockford, IL, and CINC-1 assay from Amersham Biosciences UK, Little Chalfont, Buckinghamshire, UK) according to the manufacturers' instruction.
Luciferase Assay
Luciferase assay was performed as previously described (30) using the luciferase expression vectors containing two consensus NF-
B-binding sites (GGGACTTTCC) or activator protein-1 (AP-1)-binding sites (TGACTCA), which were kindly provided by Dr. Naofumi Mukaida (Kanazawa University, Japan). PSCs (
1 x 106) were transfected with 2 µg of the luciferase expression vector, along with 40 ng of pRL-TK vector (Promega, Madison, WI) as an internal control, using the FuGENE6 reagent (Roche Diagnostics). After 24 h, the transfected cells were treated with IL-1β in the absence or presence of DPI for an additional 24 h. At the end of the incubation, cell lysates were prepared using Pica Gene kit (Toyo Ink, Tokyo, Japan), and the light intensities were measured using a model Lumat LB9507 Luminescence Reader (EG&G Berthold, Bad Wildbad, Germany).
Western Blot Analysis
Activation of MAPKs was examined by Western blot analysis using anti-phosphospecific MAPK antibodies (Cell Signaling, Beverly, MA) as previously described (28). Cells were lysed, and total cell lysates (
100 µg) were fractionated on a 10% SDS-polyacrylamide gel. They were transferred to a nitrocellulose membrane (Bio-Rad, Hercules, CA), and the membrane was incubated overnight at 4°C with rabbit antibodies against phosphorylated MAPKs. After incubation with peroxidase-conjugated goat anti-rabbit IgG antibody, proteins were visualized with the use of an ECL kit (Amersham Biosciences UK). The levels of total MAPKs,
-SMA, type I collagen, I
B-
, and GAPDH were determined in a similar manner.
Effect of DPI on Spontaneous Activation of PSCs in Culture
Freshly isolated PSCs were incubated with or without DPI (at 5 µM) in serum-free medium for 1 h, and then FBS was added at the final concentration of 5%. After 5-day incubation, morphological changes characteristic of PSC activation were assessed after staining with GFAP.
Effect of DPI on the Development of Pancreatic Fibrosis In Vivo
WBN/Kob rats model.
After an adaptation period of 3 wk, DPI was administered orally in drinking water (1 mg·kg body wt–1·day–1) to 10-wk-old male WBN/Kob rats continuously until they were euthanized after 20 wk of age. This dose was shown to be well tolerated and effective in long-term studies in the rats (11, 22). Control rats received the drinking water containing vehicle (0.02% DMSO). Each group consisted of six animals. There were no significant differences in body weight development between the two groups. Pancreas specimens were routinely fixed in 4% paraformaldehyde in PBS and embedded in paraffin. Tissue sections were stained with hematoxylin and eosin (H & E) or Sirius red, which preferentially labels collagen fibrils with red color. Immunostaining for
-SMA was also performed.
Dibutyltin dichloride model. Chronic pancreatitis was induced in male Lewis rats by single administration of 7 mg/kg dibutyltin dichloride (DBTC) as previously reported (19). Starting 7 days before the administration of DBTC, DPI was administered orally in drinking water (1 mg·kg body wt–1·day–1) until 28 days after the administration when rats were euthanized. Tissue sections were stained with H & E or Sirius red.
Statistical Analysis
The results were expressed as means ± SD. Experiments were performed at least three times, and similar results were obtained. Differences between the groups were evaluated by ANOVA, followed by Fishers test for post hoc analysis. A P value <0.05 was considered statistically significant.
| RESULTS |
|---|
|
|
|---|
-SMA (data not shown). Reverse transcription-PCR showed that all of rat quiescent, rat culture-activated, and human activated PSCs expressed mRNAs for p22phox, p47phox, gp91phox/NOX2, NOX1, and NOX4 (Fig. 1A). In our experimental system, p67phox and NOX3 were not detected. With the use of the same primer sets, p67phox and NOX3 were detected in human monocytic THP-1 cells and hepatoma HepG2 cells, respectively (data not shown). Human PSCs expressed NOX activator 1 but not NOX organizer 1 (Fig. 1B). Expression of NOX organizer 1 was detected in human colon cancer Colo205 cells. Expression of p22phox and p47phox in human PSCs was confirmed by immunofluorescent staining (Fig. 1, C and D); p22phox and p47phox expression was observed mainly in the membrane and cytoplasm, respectively. In vivo, p47phox expression was observed in the fibrotic areas in the pancreas of WBN/Kob rats, a model of spontaneous chronic pancreatitis (Fig. 1E). Of note, pancreatic acinar cells were negative for p47phox expression.
|
|
-nitro-L-arginine methyl, at 1 mM) (data not shown).
|
DPI decreased the expression of
-SMA and collagen.
It has been shown that activated PSCs express
-SMA and produce extracellular matrix such as type I and type III collagens (2, 5). DPI decreased the levels of
-SMA,
1(I) procollagen, and
1(III) procollagen mRNAs (Fig. 4, A and B). DPI also decreased the expression of
-SMA and type I collagen at the protein level (Fig. 4C).
|
B.
DPI inhibited IL-1β-induced activation of AP-1 but not of NF-
B (Fig. 5A). DPI did not affect IL-1-induced degradation of I
B-
(data not shown), further supporting the notion that DPI did not inhibit NF-
B activation. It has been shown that activation of MAPKs plays a key role in the PDGF-induced proliferation and IL-1-induced chemokine production in PSCs (25, 29, 30). DPI inhibited IL-1β- and PDGF-induced activation of ERK, JNK, and p38 MAPK (Fig. 5, B and C).
|
|
-SMA-positive cells were localized in the periacinar fibrotic areas and vascular walls in the control group (Fig. 7G). In contrast,
-SMA-positive cells were observed only in the vascular walls in most of the specimens in the DPI-treated group (Fig. 7H).
|
|
| DISCUSSION |
|---|
|
|
|---|
-SMA and collagen genes. Apocynin, another inhibitor of NADPH oxidase (37), inhibited proliferation and chemokine production. DPI inhibited the spontaneous activation of freshly-isolated cells to a myofibroblast-like phenotype, supporting the idea that pro-oxidant production by PSCs might serve as an autocrine/paracrine stimulant during transformation (3). In addition, DPI inhibited the development of pancreatic fibrosis in WBN/Kob rats and in rats with DBTC-induced chronic pancreatitis. Collectively, these results suggest a role of NADPH oxidase in the activation and cell functions of PSCs, constituting a potential target for the treatment of pancreatic fibrosis. Our results agree with the previous studies showing the profibrogenic role of NADPH oxidase in the liver (1, 6) and heart (32). These inhibitory effects were not due to the cytotoxicity of DPI, but it should be noted that DPI might inhibit other flavin-containing enzymes including xanthine oxidase, mitochondrial complexes I and III, and nitric oxide synthase (7). We found that proliferation of PSCs was unaffected by inhibitors of these flavin-containing enzymes. Furthermore, apocynin, another inhibitor of NADPH oxidase, inhibited ROS production induced by cytokines and growth factors in PSCs. Apocynin also inhibited PDGF-induced proliferation and IL-1-induced chemokine production. Collectively, the results obtained herein using DPI were likely to reflect the inhibition of NADPH oxidase, although the role of other flavin-containing enzymes was not be completely excluded. Not all NADPH oxidase homologues were expressed in PSCs; all of rat quiescent, rat culture-activated, and human activated PSCs did not express p67phox and NOX3. Expression of NADPH oxidase is cell-type specific and might be even different dependent on the location (7, 23). Immunostaining in WBN/Kob rats herein showed that pancreatic acinar cells were negative for p47phox expression, supporting the previous study showing that p47phox and p67phox were absent in rat isolated pancreatic acini (16). In phagocyte-type NADPH oxidase, p67phox plays an important role in superoxide production by directly interacting with NOX2 (14). In contrast, p67phox is scarcely expressed in nonphagocytic cells including vascular smooth muscle cells (23), similar to the absence of p67phox in PSCs. On the other hand, there were some differences in NADPH oxidase expression between PSCs and hepatic stellate cells, a counterpart of PSCs in the liver. Culture-activated hepatic stellate cells expressed mRNAs for p47phox, gp91phox, and NOX1, whereas quiescent cells did not express p47phox and gp91phox (6). Another report showed that IL-90 human hepatic stellate cell line and mouse hepatic stellate cells expressed p22phox, p47phox, p67phox, and gp91phox (1). The functionally important components of the NADPH oxidase and their potential interactions in PSCs remain to be clarified. Because several homologues are expressed, further studies are needed to clarify which NOX is the dominant functional homologue important for oxidase performance in PSCs. Interestingly, it has been shown that NOX4 mediates transforming growth factor-β1-induced transformation of fibroblasts to myofibroblasts (12).
In contrast to the relatively high levels of ROS produced by the phagocytic NADPH oxidase for microbicidal activity, most nonphagocytic cells produce low amounts of ROS that stimulate intracellular signaling pathways (7, 8). A variety of signal transduction and gene expression systems might be influenced by NADPH oxidase, including AP-1, NF-
B, and MAPKs. We showed here that DPI inhibited the activation of MAPKs and AP-1 but not of NF-
B. These findings agree with the previous study showing that DPI inhibited angiotensin II-induced activation of ERK, JNK, p38 MAPK, and AP-1 in hepatic stellate cells (6). Although it is possible that NF-
B is regulated by ROS-generating system that is not inhibited by DPI in PSCs, the failure of NF-
B inhibition agrees with our previous findings in PSCs that antioxidant polyphenols failed to inhibit NF-
B activation (29, 30). It has been recognized that redox-dependent activation of NF-
B is cell and stimulus specific, as opposed to the concept that oxidative stress is a common mediator of diverse NF-
B activators (18, 24). In human aortic smooth muscle cells, hydrogen peroxide failed to activate NF-
B or induce degradation of I
B-
(18). IL-1β did not increase intracellular oxidative stress, and IL-1β-induced NF-
B activation was not inhibited by the antioxidant N-acetylcysteine, excluding a role of oxidative stress in IL-1β-induced activation of NF-
B, at least in human aortic smooth muscle cells (18). Li and Karin (24) reported that when a redox-regulated effect on NF-
B is observed, it appears to occur downstream from the I
B kinase at the level of ubiquitination and/or degradation of I
B.
The most accepted theory is that ROS derived from injured pancreatic acinar cells and infiltrating inflammatory cells stimulate PSCs in a paracrine manner (3, 20, 21). Exogenous ROS including ethanol, acetaldehyde, hydrogen peroxide, and 4-hydroxynonenal have been shown to activate redox-sensitive intracellular signaling pathways in PSCs to increase collagen synthesis (3, 20, 21, 27). Conversely, expression of NADPH oxidase in PSCs suggests that PSCs are also an important source of ROS in pancreatic fibrosis, as in the case in the liver (6). Therefore, PSCs should no longer be viewed as a passive cell responding to exogenous ROS by neighboring cells but, in addition, regarded as an active participant in the pancreatic injury through production of ROS. In addition to PDGF, IL-1, and angiotensin II, we have found that transforming growth factor-β1, TNF-
, and high glucose induced ROS production through NADPH oxidase (A. Masamune, K. Kikuta, T. Shimosegawa, unpublished observations). Therefore, a variety of fibrogenic stimuli induce signals through NADPH oxidase in PSCs leading to the development of pancreatic fibrosis. Very recently, it has been shown that phagocytosis of apoptotic bodies derived from damaged hepatocytes by hepatic stellate cells activated NADPH oxidase (41). It is of interest to see whether similar mechanisms might exist in PSCs, where the ability of phagocytosis has been recently shown (36).
The WBN/Kob rats spontaneously develop chronic inflammatory changes of the pancreas. The main characteristics of human chronic pancreatitis, including infiltration of inflammatory cells and fibrosis replacing the progressively destroyed exocrine parenchyma, are present in the WBN/Kob model (33). This model has been widely used to test potential therapeutic agents for chronic pancreatitis including candesartan, an angiotensin II receptor antagonist (40). We showed here that DPI inhibited the development of pancreatic fibrosis in WBN/Kob rats. The protective effects were accompanied by a decreased number of
-SMA-positive cells (i.e., PSCs). In addition, we showed here that DPI inhibited the development of pancreatic fibrosis in DBTC-induced chronic pancreatitis in rats. Although PSCs might be a target of the actions of DPI based on the results obtained by in vitro studies, it is also likely that DPI directly inhibited infiltrating inflammatory cells where NADPH oxidase is significantly expressed. Interestingly, it has been shown that angiotensin receptor antagonists reduced NADPH oxidase activity in animals (38). Therefore, the therapeutic benefits associated with the angiotensin receptor antagonists might include their ability to inhibit NADPH oxidase. Further studies employing NADPH oxidase knockout mice would contribute to establishing the role of NADPH oxidase in pancreatic fibrosis.
| GRANTS |
|---|
|
|
|---|
| FOOTNOTES |
|---|
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
* A. Masamune and T. Watanabe contributed equally to this work. ![]()
| REFERENCES |
|---|
|
|
|---|
B in human aortic smooth muscle cells. Am J Physiol Heart Circ Physiol 277: H1975–H1984, 1999.This article has been cited by other articles:
![]() |
Y. C. Chan and P. S. Leung Involvement of Redox-Sensitive Extracellular-Regulated Kinases in Angiotensin II-Induced Interleukin-6 Expression in Pancreatic Acinar Cells J. Pharmacol. Exp. Ther., May 1, 2009; 329(2): 450 - 458. [Abstract] [Full Text] [PDF] |
||||
![]() |
A Masamune, K Kikuta, T Watanabe, K Satoh, M Hirota, S Hamada, and T Shimosegawa Fibrinogen induces cytokine and collagen production in pancreatic stellate cells Gut, April 1, 2009; 58(4): 550 - 559. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Masamune, K. Kikuta, T. Watanabe, K. Satoh, M. Hirota, and T. Shimosegawa Hypoxia stimulates pancreatic stellate cells to induce fibrosis and angiogenesis in pancreatic cancer Am J Physiol Gastrointest Liver Physiol, October 1, 2008; 295(4): G709 - G717. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| Visit Other APS Journals Online |