AJP - GI Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Gastrointest Liver Physiol 294: G418-G428, 2008. First published November 21, 2007; doi:10.1152/ajpgi.00418.2007
0193-1857/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/2/G418    most recent
00418.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lussier, C. R.
Right arrow Articles by Boudreau, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lussier, C. R.
Right arrow Articles by Boudreau, F.

MUCOSAL BIOLOGY

Hepatocyte nuclear factor-4{alpha} promotes differentiation of intestinal epithelial cells in a coculture system

Carine R. Lussier, Jean-Philippe Babeu, Benoît A. Auclair, Nathalie Perreault, and François Boudreau

Canadian Institute of Health Research Team on Digestive Epithelium, Département d'Anatomie et Biologie Cellulaire, Faculté de Médecine et des Sciences de la Santé, Université de Sherbrooke, Sherbrooke, Québec, Canada

Submitted 15 September 2007 ; accepted in final form 17 November 2007


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Normal cellular models able to efficiently recapitulate intestinal epithelial cell differentiation in culture are not yet available. The aim of this work was to establish and genetically characterize a mesenchymal-epithelial coculture system to identify transcriptional regulators involved in this process. The deposition of rat intestinal epithelial cells on human intestinal mesenchymal cells led to the formation of clustered structures that expanded shortly after seeding. These structures were composed of polarized epithelial cells with brush borders and cell junction complexes. A rat GeneChip statistical analysis performed at different time points during this process identified hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}) and hepatocyte nuclear factor-1{alpha} (HNF-1{alpha}) as being induced coincidently with the apparition of polarized epithelial structures. Stable introduction of HNF-4{alpha} in undifferentiated epithelial cells alone led to the rapid induction of HNF-1{alpha} and several intestinal-specific markers and metabolism-related genes for which mRNA was identified to be upregulated during epithelial differentiation. HNF-4{alpha} was capable to transactivate the calbindin 3 gene promoter, a process that was synergistically increased in the presence of HNF-1{alpha}. When HNF-4{alpha}-expressing cells were plated on mesenchymal cells, an epithelial monolayer formed rapidly with the apparition of dome structures that are characteristics of vectorial ion transport. Forced expression of HNF-1{alpha} alone did not result in dome structures formation. In sum, this novel coculture system functionally identified for the first time HNF-4{alpha} as an important modulator of intestinal epithelial differentiation and offers an innovative opportunity to investigate molecular mechanisms involved in this process.

intestinal epithelial cells; mesenchymal cells; HNF-4{alpha}; HNF-1{alpha}; differentiation

THE INTESTINAL EPITHELIUM is organized in crypts mostly populated by proliferative cells as well as villi composed of differentiated cells [for a review, see Sancho et al. (47)]. Stem cells constantly produce precursor cells that migrate along the crypt-to-villus axis. These progenitor cells progressively undergo a succession of molecular changes that lead to an arrest of proliferation and a commitment into specific differentiation programs completed as the cells reach the crypt-villus junction (40). Two different lineages will result from this commitment: the columnar absorptive enterocytes (comprising 90% of all small intestinal epithelial cells) and the secretory cell lineages that include goblet, enteroendocrine, and Paneth cells.

Intestinal homeostasis is dependent on a cross talk between epithelial and underlying mesenchymal cells (18, 33). Several signaling pathways that involve mesenchymal secreted molecules orchestrate this cellular communication (10). One example is the Wnt/β-catenin pathway that controls proliferation as well as migration of enterocytes and Paneth cells (16). Moreover, extracellular matrix deposition between the epithelial and mesenchymal compartments influences specific cell signaling in a position-dependent manner along the crypt-to-villus axis (2, 51).

Interactions between intestinal epithelial cells and their environment affect intrinsic gene expression (41, 47). To date, numerous endodermal transcription factors were identified to participate in intestinal epithelial gene regulation (59). Cdx2, an intestinal epithelial specific transcription factor, regulates transcriptional activity of several intestinal epithelial-specific genes [for a review, see Guo et al. (17)]. Other transcriptional regulators such as GATA-4 or hepatocyte nuclear factor-1{alpha} (HNF-1{alpha}) cooperate with Cdx2 and regulate transcription of sucrase-isomaltase (SI) (6), lactase-phlorizin hydrolase (31, 56), calbindin 3 (60), liver fatty acid binding protein gene (52), and claudin 2 (13, 46). Restriction of apolipoprotein A-IV (ApoA-IV) expression to villus-differentiated enterocytes has been functionally linked to hepatocyte nuclear factor-4{alpha} (HNF-4{alpha}) (49). Computer-based analyses recently suggested that HNF-4{alpha} could act as a regulator of villus genes involved in lipid metabolism (53). However, no functional data have clearly demonstrated the role of HNF-4{alpha} in small intestinal epithelial functions.

Immortalized intestinal epithelial cell (IEC) lines derived from the ileum have been established from weaned rats (43). Morphological and immunological characterization classified these cells as undifferentiated small intestinal crypt cells (42, 43). The first demonstration that these cell lines could differentiate came from xenografts experiment that involved combination of IEC-17 with fetal rat gut mesoderm (24). This experimental approach confirmed that IEC-17 could generate a mature epithelium composed of the four major intestinal epithelial cell lineages (24). The potential of these cells to differentiate in culture was provided when IEC-6 cells were engineered to conditionally express Cdx2 (54). The induction of Cdx2 resulted in irregular cellular proliferation with the accumulation of multicellular layers covered with few differentiated cells (54). Since the natural contact between epithelium and mesenchyme supplies IEC with extracellular matrix and soluble molecules (33, 34), we hypothesized that intestinal epithelial crypt cells needed to interact with mesenchymal cells to efficiently reproduce villus epithelial differentiation in culture.

Here, we present evidence that immortalized IEC seeded on fetal intestinal mesenchymal cells can rapidly polarize and differentiate in culture. These cells display the morphological characteristics of an epithelium and support the expression of multiple intestinal functional markers. A GeneChip analysis identified HNF-4{alpha} and HNF-1{alpha} as being strongly induced during IEC differentiation. Forced expression of HNF-4{alpha} in undifferentiated IEC induced the expression of several intestinal-specific markers and metabolism-related genes identified to be upregulated during IEC differentiation in coculture, a consequence that was not observed with forced expression of HNF-1{alpha}. This places HNF-4{alpha} as a strong candidate to support IEC differentiation.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Establishment of mesenchymal primary culture. Human intestine from fetuses ranging from 17 to 20 wk of age (postfertilization) were obtained after legal abortion. The project protocol was approved by the Institutional Human Research Review Committee for the use of human material. The small intestine was divided in three equal parts and the most distal one was considered as the ileum where 5- to 8-cm fragments were used for mesenchymal cell isolation. Smooth muscle layers were pulled out with forceps and the intestinal tube was opened and cut into 0.5-cm2 pieces. Ileum fragments were then incubated for 2 h at room temperature in an EDTA solution (3 mM EDTA, 0.05 mM DTT, in PBS) to separate the epithelium from the mesenchymal compartment (62). After isolation, mesenchymal pieces were incubated 4 h at 37°C in Dulbecco's modified Eagle's medium (DMEM) containing 0.2 U/ml of collagenase H (Roche Diagnostics). Cells were recovered by a short centrifugation and seeded in 100-mm petri dishes. Cells were maintained under an atmosphere of 5% CO2 at 37°C in DMEM supplemented with 4.5 g/l D-glucose, 25 mM HEPES, and 10% fetal bovine serum. Mesenchymal primary cultures were used between passages 3 and 8.

Cell coculture. The IEC-6 cell line was obtained from ATCC (CRL-1592). The IEC-6/L1 cell line was a gift from Dr. P. G. Traber. The IEC-6/L1-HNF-4{alpha} cell line was generated by retroviral infection of a rat HNF-4{alpha}/Babepuro construct. The IEC-6/L1-HNF-1{alpha} cell line was generated by lentiviral infection of a rat HNF-1{alpha}/pLenti6/V5 construct. These cell lines were maintained in DMEM supplemented with 4.5 g/l D-glucose, 25 mM HEPES, 5% fetal bovine serum, and 0.1 U/ml of insulin as originally described (43, 54). Cells were maintained under an atmosphere of 5% CO2 at 37°C and subcultured for 5 to 10 passages preventing each time the reach of confluence. Human primary mesenchymal cells were seeded in their complete growth medium (DMEM 10%) in an appropriate number to result in 50% of confluence. After 24 h, fresh medium supplemented with 50 µg/ml ascorbic acid (coculture medium) was added and cells were grown for 14 days with fresh coculture medium replaced every 2 days. IEC-6, IEC-6/L1, IEC-6/L1-HNF-4{alpha}, and IEC-6/L1-HNF-1{alpha} cells were recovered in coculture medium and seeded on mesenchymal cell monolayer at a density of 1 x 105 cells/cm2. Cocultures were grown for a maximum of 12 days with the coculture medium being replaced every 2 days.

RNA interference targeting. Short hairpin RNA (shRNA) oligonucleotides were designed by using the small interfering RNA sequences GCTGCAGATCGATGATAATGA and TTCAAGAGA as the loop sequence as described previously (5). The oligonucleotide-annealed product was subcloned into the plenti6-U6 between BamH I and Xho I sites, giving rise to pLenti6-shHNF-4{alpha}. An irrelevant (control) pLenti-sheGFP negative control was used in parallel (5). Lentiviruses were produced and used for cell infection accordingly to Invitrogen recommendations (ViraPower Lentiviral Expression System, instructions manual).

Electron microscopy. Cell cultures were prepared exactly as reported before (5). Thin sections were prepared by using an ultramicrotome, contrasted with lead citrate and uranyl acetate, and observed on a Jeol 100 CX transmission electron microscope. All reagents were purchased from Electron Microscopy Sciences (Cedarlane).

RNA isolation and RT-PCR analysis. Total RNA was isolated from cultured cells and subjected to a DNase treatment according to the manufacturer's instructions (Totally RNA kit). Reverse transcriptions were carried out at 42°C for 1 h in the presence of 2 µg RNA, 40 mU of polyoligo(dT)12–18, and 40 U of Reverse Transcriptase (Roche Diagnostics). Semiquantitative PCR was performed in a total volume of 20 µl in the presence of 1 µl of RT reaction, 0.6 U of Taq DNA polymerase (New England Biolabs), 0.2 mM dNTPs, and 30 ng of each specific primer. Primer sequences are available upon request. Quantitative RT-PCR (qRT-PCR) was performed using a LightCycler apparatus (Roche Diagnostics). Experiments were run and analyzed with the LightCycler software 4.0 according to manufacturer's recommendations (Roche Diagnostics). Synthesis of double stranded DNA during the PCR cycles was monitored with SYBR Green I (QuantiTect SYBR Green PCR Kit; Qiagen) and PCR programs designed as detailed in the QuantiTect SYBR Green PCR Handbook (Qiagen). Target expression was quantified relatively to porphobilinogen deaminase or TATA binding protein expression. For this purpose, a standard calibration curve was prepared for each gene by using serial dilutions of the calibrator sample and crossing point values were plotted vs. the log of the relative concentration of each dilution. This standard curve was used to correct for differences in PCR efficiencies.

Microarray screening and data analysis. Probes for the microarray analysis were generated from isolated RNA obtained at days 1, 3, 5, and 8 of cocultures from three independent experiments. Affymetrix GeneChip Rat Genome 230 2.0 arrays were screened with the 12 generated probes via the microarray platform of McGill University and Génome Québec Innovation Center (http://genomequebec.mcgill) exactly as described previously (35). To test for statistically significant changes in signal intensity (P values of ≤0.05), compiled data (robust multichip averaging analysis) were screened by using the software available on the microarray platform website. Genes were then filtered for up- or downregulation of expression of a minimum of 2.5-fold and a minimum magnitude change of 200 fluorescence units between day 1 and 8. Graphical representations as well as gene ontology analyses were performed with the use of the GeneSifter software (VizX).

Western blot analysis. Cell total extracts preparation and Western blotting were performed exactly as described previously (5). The following antibodies from Zymed Laboratories (Invitrogen) were used: occludin affinity-purified rabbit polyclonal antibody (no. 71-1500) and claudin-4 affinity-purified rabbit polyclonal antibody (no. 38-4800). The following antibodies from Santa Cruz Biotechnology (Santa Cruz) were used: HNF-1{alpha} affinity-purified goat polyclonal antibody (no. SC-6547), HNF-4{alpha} affinity-purified goat polyclonal antibody (no. SC-6556), GATA-4 affinity-purified goat polyclonal antibody (no. SC-1237), and actin affinity-purified goat polyclonal antibody (no. SC-1615). A rabbit polyclonal antibody raised against CDX2/3 was kindly provided by Dr. Rivard (CDX2/3-NR) (8).

Indirect immunofluorescence. Cells were cocultured in Lab-Tek chamber slides (Nalge Nunc International) for 10 days, fixed in 2% paraformaldehyde for 30 min at 4°C, permeabilized in 0.1% Triton X-100 in PBS, and blocked for 20 min in 2% bovine serum albumin in PBS. Primary antibody was diluted in the blocking solution and incubated with the cells for 2 h at room temperature. The following antibodies were used: occludin mouse monoclonal antibody (no. 33-1500, Zymed Laboratories), β-catenin affinity-purified rabbit polyclonal antibody (no. 9587, Cell Signaling Technology). Claudin-4 antibody was the same as described above. For F-actin staining, fixed cells were incubated with 1 µg/ml phalloidin-fluorescein isothiocyanate conjugated in replacement of the primary antibody. Slides were then washed in PBS and incubated 1 h at room temperature with the appropriate secondary antibody (Vector Laboratories) diluted in the blocking buffer.

Transient transfections and luciferase assays. The rat calbindin 3 promoter was amplified by PCR from purified genomic DNA isolated from IEC-6 cells. The primers used for the amplification included positions –1004 and +43 relatively to the transcriptional initiation site. The PCR product was subcloned into the pGL3basic luciferase reporter vector (Promega). Integrity of the subcloned PCR product was confirmed by sequence analysis. HEK293T cells were transfected by using Lipofectamine 2000 (Invitrogen) according to the manufacturer's recommendations. Cells at 50% confluence were incubated with 0.2 µg of luciferase reporter, 0.025 ng of HNF-4{alpha} and/or HNF-1{alpha} expression vector, 0.6 ng of the pRL SV40 Renilla luciferase vector (Promega), and a constant total DNA amount of 0.8 µg per transfected well in the presence of 2 µl of Lipofectamine 2,000/600 µl of DMEM containing 10% fetal bovine serum. The medium was replaced by fresh DMEM after an incubation of 4 h. The luciferase and Renilla activities were determined 48 h after the transfection using the dual luciferase assay kit (Promega Biotech). Each experiment was repeated four times in triplicate.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
Coculture of IEC-6/L1 with intestinal mesenchymal cells results in morphological differentiation. IEC-6/L1 cells are derivative of IEC-6 cells modified to express Cdx2 (54). These cells proliferate in multicellular layers and differentiate poorly in vitro. To stimulate IEC-6/L1 cells to efficiently differentiate into a monolayer that mimics the normal intestinal epithelium, a coculture system was engineered. IEC-6/L1 cells were cultured on top of a monolayer of primary mesenchymal cells derived from human fetal ileum. The heterologous nature of this system was chosen to further distinguish the specific molecular changes that could occur in IEC cells vs. the mesenchymal counterpart. Primary mesenchymal cells were grown in the coculture medium for 14 days prior the deposition of IEC-6/L1. Cocultures were maintained for 12 days.

A scattered formation of clustered structures was observed among the IEC-6/L1 cell population five days after these cells were seeded on the human mesenchymal primary culture (Fig. 1A), a phenomenon that was not observed when IEC-6/L1 was cultured directly on plastic (54) or on commercial matrixes including Matrigel, laminin, collagen IV, or fibronectin (data not illustrated). Electron microscopy of cocultured cells revealed that IEC clusters consisted of polarized epithelial cells organized in a monolayer (Fig. 1B). These cells presented cell-to-cell junctions in addition to a well-established brush border on their apical side (Fig. 1C). The parental IEC-6 cell line (43), negative for Cdx2 expression (54), remained flat and undifferentiated when it was cocultured under the exact same experimental conditions (data not illustrated). In addition, the prevention of physical contact between IEC6/L1 and mesenchymal cells with the use of Transwell permeable supports was inefficient to promote formation of differentiated clusters. These observations indicated that expression of Cdx2 in IEC as well as direct mesenchymal contact was decisive to allow IEC to rapidly polarize in a monolayer and to differentiate under these conditions.


Figure 1
View larger version (161K):
[in this window]
[in a new window]

  		Fig. 1. Morphological features of IEC-6/L1 cocultured with human fetal mesenchymal cells from the ileum. A: light morphology of IEC-6/L1 monolayer at coculture day 8. Bar = 100 µm. B and C: electron microscopic analysis of IEC-6/L1 cocultured for 10 days with mesenchymal cells. Bar = 2 µm (B). Bar = 500 nm (C).

 
A gene profiling analysis confirmed the functional differentiation of IEC in coculture. To better characterize the nature of the molecular changes occurring during differentiation of IEC-6/L1 in the coculture system, a gene expression profiling was next performed. To provide a stringent characterization of the changes occurring during the rapid differentiation of IEC/L1 cells, the analysis was performed in triplicate with RNA isolated at days 1, 3, 5, and 8 after the seeding of IEC-6/L1 on mesenchymal cells. The GeneChip Rat Genome 230 2.0 Arrays (Affymetrix) that contains more than 30,000 transcripts from the rat genome was utilized to screen for mRNA expression variations that occurred specifically in the rat IEC-6/L1 cell line. Statistical analysis predicted more than 10,000 rat transcripts being significantly modulated between days 1 and 8 of the coculture (P value ≤0.05). When more stringent conditions were applied (differential ratio ≥2.5 and relative expression difference ≥200), the number of transcripts reached 1,220 (Supplementary Tables S1 and S2). A gene ontology analysis for biological processes among these modified genes revealed an important representation for cellular processes related to macromolecule metabolism, response to stress, lipid metabolism, nucleic acid metabolism, immune response, and cell adhesion. The expression pattern of well-known intestinal epithelial cell differentiation markers was assembled (Fig. 2A). In general, these genes were not expressed in IEC-6/L1 cell line at day 1 but were induced with the apparition and multiplication of polarized cells between days 3 and 8 (Fig. 2A). The expression of several intestinal apolipoproteins and molecules implicated in lipid uptake and transport was markedly induced between days 3 and 8 (Fig. 2A).


Figure 2
View larger version (34K):
[in this window]
[in a new window]

  		Fig. 2. Intestinal epithelial functional gene markers are expressed in cocultured IEC-6/L1. A: expression profiles of intestinal epithelial cell (IEC) differentiation markers and molecules implicated in lipid uptake and transport. B: semiquantitative RT-PCR analysis of sucrase-isomaltase (SI) expression was performed in IEC-6/L1 cells harvested at different time points after seeding on mesenchymal (mes.) cells (left) as well as in IEC-6/L1 or IEC-6 cultured in the coculture medium on plastic or on mesenchymal cells for 12 days (right). Total RNA from rat ileum was used as a positive control, and β2-microglobulin mRNA level was monitored as a housekeeping gene control. C: comparison of apolipoprotein (Apo) A-IV relative mRNA expression monitored by GeneChip and quantitative (Quant.) RT-PCR analysis.

 
To further validate some targets identified in the GeneChip analysis, expression of SI and ApoA-IV was monitored by RT-PCR. As expected, expression of SI was undetectable in the coculture system from days 1 to 6 but became assessable at day 8 with increasing expression throughout day 12 (Fig. 2B). In parallel, SI mRNA expression was undetectable in IEC-6/L1 cultured on plastic or IEC-6 cocultured on mesenchymal cells (Fig. 2B). ApoA-IV mRNA expression was undetectable at days 1 and 3, became expressed at day 5, and was upregulated between days 5 and 8 as quantified by qRT-PCR (Fig. 2C). ApoA-IV modulation of expression was quantitatively equivalent to the GeneChip profiling data obtained during IEC differentiation (Fig. 2C). A similar pattern was observed for ApoA-I, ApoB, ApoC-III, and Apobec, validating the data in Fig. 2A (data not illustrated). These results confirmed that IEC-6/L1 cells can be rapidly induced to express multiple markers of functional differentiated enterocytes when cocultured with mesenchymal cells.

Polarized IEC developed well-defined cell junction complexes in coculture. Physiological functions of the mature intestinal epithelium are largely dependent on the establishment and maintenance of functional cell junction complexes (30, 32). Cell junction complexes components were detectable in cocultured IEC cells with several of them showing an upregulated expression during the time course (Fig. 3A). Indeed, occludin mRNA and protein levels were upregulated during the course of the coculture (Fig. 3, A and B). Claudin-4 mRNA expression began to be detectable between days 5 and 8 (Fig. 3A), a pattern that was confirmed at the protein level (Fig. 3B). To further determine whether IEC developed well-defined cell to cell junctions in the coculture conditions, localization of cell junction proteins was next investigated by immunofluorescence. The tight junction proteins occludin and claudin-4 as well as adherens junction molecule β-catenin were localized at the apical membrane of polarized cells (Fig. 3C). The cytoskeleton component F-actin was also colocalized at the apical membrane with β-catenin (Fig. 3C). These results supported that cocultured IEC can develop well-established cell junction complexes linked to the cellular cytoskeleton.


Figure 3
View larger version (75K):
[in this window]
[in a new window]

  		Fig. 3. Polarized cocultured IEC-6/L1 express well localized cell junction complex molecules. A: expression profiles of cell junction complex molecules at specific time points of the coculture. Red numbers indicate values beyond the limit of detection. B: Western blot analysis performed on cocultured total cell lysates with specific antibodies for the detection of occludin and claudin-4 protein expression. Specific detection of actin was done to control for protein loading. C: IEC-6/L1 cells were cocultured with mesenchymal cells for 10 days. Immunolocalization of occludin, claudin-4, and β-catenin was performed using specific antibodies. Phalloidin-FITC conjugated was used for the specific detection of F-actin. Original magnification x200.

 
Specific transcription factors of endoderm-origin are sequentially modulated in the coculture system. A number of regulators crucial to sustain the transcriptional activity of intestinal specific gene promoters have been identified (6, 7, 11, 49, 58). Characterization of the expression profile of some of these transcriptional modulators during the progression of the cocultures was next undertaken. Data from the gene profiling analysis indicated a statistical increase in Cdx2, GATA-4, HNF-1{alpha}, and HNF-4{alpha} mRNA expression when day 8 was compared with day 1 (Fig. 4A). Total protein extracts were then sequentially isolated from several coculture kinetics and Western blot analyses performed. The protein expression profile of these factors correlated well with the variations in mRNA expression during the coculture kinetics. Cdx2 and GATA-4 expression was progressively increased during the kinetics (Fig. 4B). A prominent induction of both HNF-1{alpha} and HNF-4{alpha} was observed around day 6, a time when polarized IEC structures had just appeared (Fig. 4B). HNF-1{alpha} and HNF-4{alpha} protein was not detected in IEC-6/L1 cultured on plastic or in IEC-6 cocultured on primary mesenchymal cells (Fig. 4C). This indicated that both Cdx2 and mesenchymal cells were essential for the induction of these regulators within these conditions.


Figure 4
View larger version (47K):
[in this window]
[in a new window]

  		Fig. 4. Expression of transcription factors involved in the regulation of IEC differentiation-related genes. A: expression profiles of Cdx2, hepatocyte nuclear factor (HNF)-1{alpha}, GATA-4, and HNF-4{alpha} at different time point of the coculture. B: Western blot analysis performed on cocultured total cell lysates with specific antibodies for the detection of each transcription factors. C: Western blot analysis performed on total cell lysates from IEC-6 and IEC-6/L1 cultured on plastic or on mesenchymal cells. Cells were harvested at day 6 after IEC seeding. Specific detection of actin was used as loading control (B, C).

 
HNF-1{alpha} is a downstream target of HNF-4{alpha} in IEC and cooperates with HNF-4{alpha} in transcriptional modulation of intestinal specific genes. HNF-1{alpha} was shown to participate in the transcriptional regulation of several intestinal specific genes (6, 11, 31, 46, 57, 60). HNF-4{alpha} was recently suggested to act as a regulator of villus specific epithelial genes (53). However, the specific functional role of these regulators on IEC differentiation has never been directly assessed. We thus undertook to verify whether reintroduction of HNF-4{alpha} or HNF-1{alpha} was potent to induce expression of intestinal epithelial genes normally associated with IEC differentiation state. IEC-6/L1 cell populations that had stably integrated HNF-4{alpha} (IEC-6/L1-HNF-4{alpha}), HNF-1{alpha} (IEC-6/L1-HNF-1{alpha}), or an empty vector (control) were generated and maintained for several passages in culture. Control cells did not express HNF-4{alpha} or HNF-1{alpha} when cultured on plastic (Fig. 5A), accordingly with the observation made with the parental IEC-6/L1 cell line (Fig. 4C). Interestingly, HNF-1{alpha} protein was detectable among multiple IEC-6/L1-HNF-4{alpha} established cell populations as represented in Fig. 5A. On the contrary, HNF-1{alpha} overexpression did not impact on endogenous HNF-4{alpha} expression (Fig. 5A). A kinetics of time confirmed that HNF-1{alpha} gene transcript was detectable shortly after the retroviral introduction of HNF-4{alpha} in IEC as determined by RT-PCR analysis (Fig. 5B). This suggested that HNF-4{alpha} could directly activate HNF-1{alpha} gene transcription as reported in hepatocytes (26, 36). The expression of several genes linked to differentiation and metabolism and identified to be upregulated during the coculture kinetics (Fig. 2 and Supplementary Table S1) was next monitored at the gene transcript levels in these populations of cells. HNF-4{alpha} led to the induction of expression of several intestinal epithelial genes whereas HNF-1{alpha} alone did not impact on these genes (Fig. 5C). An experiment to downmodulate HNF-4{alpha} was next designed by a knockdown approach. A lentivirus construct that contained a shRNA sequence under the control of an U6 promoter and predicted to target the rat HNF-4{alpha} mRNA was generated and stably introduced into various IEC-6/L1-HNF-4{alpha} stable cell populations. Total RNA was isolated from these cell populations and the level of induced intestinal epithelial genes transcripts (Fig. 5C) was evaluated by real-time RT-PCR. The expression of these genes transcripts was systematically reduced (50 to 80% in average) in HNF-4{alpha} shRNA populations compared with infected controls (Fig. 6A). A Western blot confirmed that both HNF-4{alpha} and HNF-1{alpha} protein level was decreased in IEC-6/L1-HNF-4{alpha} cells infected with either of the HNF-4{alpha} shRNA lentivirus compared with cells infected with control shRNA lentivirus (Fig. 6B). These observations suggested that the continuous presence of HNF-4{alpha} and/or HNF-1{alpha} was crucial to maintain expression of differentiation-related genes. HNF-1{alpha} was reported to be crucial for the regulation of calbindin 3 gene transcription both in vitro and in vivo (60). Since this gene transcript was predicted to be upregulated in differentiating IEC-6/L1 cocultured cells (Fig. 2A), its expression was next monitored in stable IEC-6/L1-HNF-1{alpha} and IEC-6/L1-HNF-4{alpha} cell populations by qRT-PCR. IEC-6/L1-HNF-1{alpha} cells showed a significant 12-fold increase in calbindin 3 mRNA compared with control cells whereas IEC-6/L1-HNF-4{alpha} cells displayed a 36-fold increase over control cells (Fig. 7A). To further evaluate whether HNF-1{alpha} was important for HNF-4{alpha} to activate calbindin 3 gene transcript, a portion of the rat calbindin 3 promoter was subcloned into a luciferase reporter vector (Fig. 7B) and cotransfection assays were performed. HNF-1{alpha} alone increased calbindin 3 promoter activity by 17-fold whereas HNF-4{alpha} by 4-fold compared with empty vector (Fig. 7B). A synergistic 49-fold induction was observed when both HNF-1{alpha} and HNF-4{alpha} were combined in these assays (Fig. 7B). A Western blot was performed in parallel to confirm the production of both HNF-1{alpha} and HNF-4{alpha} proteins in these cotransfection experiments (Fig. 7C). Overall, these observations demonstrated that HNF-4{alpha} was potent for the activation of several IEC specific genes and that HNF-1{alpha} was able to synergies with HNF-4{alpha} for the activation of intestinal genes such as calbindin 3. Importantly, specific genes associated with terminal differentiation (for example, SI) were not induced under these conditions. This correlated with the poor potential of IEC-6/L1-HNF4{alpha} and IEC-6/L1-HNF-1{alpha} cells to polarize and differentiate in a short-term range on plastic (data not illustrated). This suggested that HNF-4{alpha} and/or HNF-1{alpha} presence was not sufficient to trigger IEC-6/L1 cell terminal differentiation and required signaling from mesenchymal cells during this process.


Figure 5
View larger version (57K):
[in this window]
[in a new window]

  		Fig. 5. HNF-4{alpha} induces expression of HNF-1{alpha} and intestinal functional gene markers in IEC-6/L1 cultured on plastic. A: IEC-6/L1 cells were infected with empty vector (control), HNF-1{alpha}, or HNF-4{alpha} expression vectors. After selection, stable IEC-6/L1 cell populations were harvested. Western blot analysis was performed on total cell lysates with specific antibodies for the detection of HNF-4{alpha} and HNF-1{alpha}. Specific detection of actin was done to control for protein integrity. B: IEC-6/L1 cells were infected with empty or HNF-4{alpha} expression vector, and total RNA was harvested at different hours following the infection. Semiquantitative RT-PCR detection of HNF-4{alpha} and HNF-1{alpha} was performed in parallel to β2-microglobulin (β2-mic). C: semiquantitative RT-PCR detection of mRNA for several intestinal functional gene markers. β2-microglobulin mRNA level was monitored as a housekeeping gene control.

 

Figure 6
View larger version (22K):
[in this window]
[in a new window]

  		Fig. 6. Downmodulation of HNF-4{alpha} with RNA interference reduces expression of intestinal functional markers in IEC-6/L1-HNF-4{alpha} cultured on plastic. A: real-time PCR was performed with total RNA isolated from IEC-6/L1-HNF-4{alpha} populations of cells that had stably integrated HNF-4{alpha} or irrelevant (control) short hairpin RNA (sh) lentiviruses. The expression of fatty acid binding protein 2, apolipoprotein A-IV, and guanylate cyclase 2c was quantified relative to TATA binding protein (TBP) (means ± SD, n = 3). B: Western blot analysis was performed with HNF-4{alpha}, HNF-1{alpha}, and actin polyclonal antibodies on total cell lysates obtained from populations of cells that had stably integrated HNF-4{alpha} or irrelevant (control) sh lentiviruses.

 

Figure 7
View larger version (25K):
[in this window]
[in a new window]

  		Fig. 7. HNF-4{alpha} and HNF-1{alpha} synergistically activate the calbindin 3 gene. A: quantitative RT-PCR detection of calbindin 3 mRNA in stable IEC-6/L1 cell populations infected with an empty vector (control), HNF-1{alpha}, and HNF-4{alpha}. TBP mRNA level was monitored as a housekeeping gene control. Results obtained in triplicate were reported as the fold difference (mean ± SD) from the control values. B: 293T cells were cotransfected by using Lipofectamine 2000 with Calbindin3-luciferase reporter vector, SV40-Renilla, and different combinations of HNF-1{alpha} and HNF-4{alpha} expression vectors. The pCDNA3.1 plasmid was used as an empty vector to calibrate the various amounts of expression vectors used in each condition. Results obtained in triplicate were reported as the fold difference (mean ± SD) from transfections with the reporter construct alone and are representative of 4 independent experiments. C: Western blot analysis was performed with the use of HNF-1{alpha}, HNF-4{alpha}, and actin antibodies on protein extracts from 293T cells cotransfected as described in B.

 
HNF-4{alpha} but not HNF-1{alpha} promotes the formation of a fully functional polarized epithelium in culture only in the presence of cdx2 and mesenchymal cells. One critical feature of the mature intestinal epithelium is to exert a selective barrier function in relation to apical-to-basal transport. To test whether HNF-4{alpha} or HNF-1{alpha} could be involved in such processes, IEC-6/L1-HNF-4{alpha}, IEC-6/L1-HNF-1{alpha}, and control cells were plated on mesenchymal cells accordingly to the protocol described above. IEC that overexpressed HNF-4{alpha} did not form scattered clusters as opposed to HNF-1{alpha} or control cells (compare Fig. 8, A and B). However, large dome structures appeared rapidly at the surface of HNF-4{alpha} cocultured cells (Fig. 8B). These large domes were individually filled with trapped liquid material as directly visualized by experimenter's eye and also illustrated in a low-magnification field (Fig. 8C). Electron microscopy confirmed the dome structure with the accumulation of substrate in between IEC and mesenchymal cells (Fig. 8D). In addition, IEC-6/L1-HNF-4{alpha} cells presented greater polarization features compared with control cells (compare Fig. 8, D and E) and IEC-6/L1-HNF-1{alpha} cells (data not illustrated). Indeed, the brush border was much more developed and the nucleus was localized at the basal side of enterocytes (Fig. 8D, arrows). Overall, these observations confirmed that HNF-4{alpha} was potent to induce differentiation-related genes in IEC. In addition, the formation of large dome structures that were dependent on the presence of HNF-4{alpha} suggested this factor was able to promote apical-basal transport in the presence of mesenchymal cells, a feature strictly restricted to a fully functional intestinal epithelium.


Figure 8
View larger version (103K):
[in this window]
[in a new window]

  		Fig. 8. HNF-4{alpha} promotes the formation of dome structures in IEC-6/L1 cocultured with mesenchymal cells. A: light morphology of IEC-6/L1 control monolayer of cells at coculture day 8. Arrow depicts polarized cluster of cells. Original magnification x40. Bar = 1 mm. B: light morphology of IEC-6/L1-HNF-4{alpha} monolayer of cells at coculture day 8. Arrows depict a portion of a dome structure. Original magnification x40. Bar = 1 mm. C: light morphology of IEC-6/L1-HNF-4{alpha} monolayer of cells at coculture day 8. Arrow depicts a dome filled with trapped liquid material. Original magnification x8. Bar = 1 mm. D and E: electron microscopic analysis of IEC-6/L1-HNF-4{alpha} stable cells (D) or IEC-6/L1-control cells (E) cocultured with mesenchymal cells for 10 days. Bar = 2 µm. The bracket indicates the accumulation of composite resulting probably from apical-basal transport. Arrows indicate brush borders.

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
Intestinal epithelial cell differentiation is tightly regulated to maintain intestinal homeostasis (27, 44). Coordination of gene transcription is recognized to be closely related to the regulatory processes that promote the maturation and maintenance of intestinal epithelial functions. Although molecular pathways involved in these processes were largely investigated (59), the precise and sequential characterization of IEC differentiation was hampered by the lack of adequate cellular systems that can recapitulate this process in vitro. Well-characterized culture models of normal cryptlike cells already exist (38, 43). However, these cellular models lack the capacity to differentiate in normal cell culture conditions. The overexpression of Cdx2 in the IEC-6 crypt cell line (IEC-6/L1) can lead to primitive cellular differentiation in vitro (54). Indeed, these cells grow in multicellular layers after reaching confluence, and few cells will present differentiation features after 30 days in culture. In addition, HNF-4{alpha} and HNF-1{alpha} protein expression remain beyond the limit of detection even after this extensive period of time (data not illustrated). The present study aimed to culture IEC-6/L1 cells on top of mesenchymal cells to reconstitute a microenvironment more representative of the normal small intestinal mucosa (33, 34, 41). The cocultured IEC-6/L1 monolayer rapidly developed clusters of cells that begun polarization and displayed morphological features that resembled differentiated enterocytes. The complete gene profiling analysis performed during the course of these morphological modifications supported that IEC were in the process of differentiation as illustrated with the complete and progressive panel of genes modulated during the course of this process. This analysis identified HNF-4{alpha} and HNF-1{alpha} as being strongly induced coincidently with the beginning of the differentiation process. Molecular analyses confirmed that HNF-4{alpha} was potent to activate intestinal gene transcript expression and that HNF-1{alpha} was able to synergize with HNF-4{alpha} for the transcriptional activation of the calbindin 3 gene normally restricted to differentiated IEC. Finally, reintroduction of HNF-4{alpha} into the coculture conditions demonstrated its crucial role into the promotion of intestinal epithelial barrier functions.

Multiple signaling pathways implicated in IEC differentiation emerge from the cross talk between mesenchymal and epithelial cells (47). Signaling between these compartments involves secreted soluble and insoluble factors from the epithelium or the mesenchyme that can transduce a signal to neighbor cells. Members of the bone morphogenetic proteins (19, 21) and hedgehog (29, 55) families are well-described modulators of such interactions. Indirect modulators of epithelial-mesenchymal interactions were also identified. For example, the specific mesenchymal transcription factor Foxl1 controls epithelial Wnt signaling via overproduction of epithelial proteoglycans (39). Since the presence of mesenchymal cells is crucial for IEC-6/L1 efficient differentiation in vitro, communication between the two cell compartments is obvious. This can implicate regulation at multiple levels including protein phosphorylation and molecule translocation from one compartment to another as well as mesenchymal specific modification of gene expression (16, 22, 63). Our findings demonstrate that mesenchymal cells are crucial to instruct IEC to endogenously express HNF-4{alpha}. It will be of interest to investigate the specific mesenchymal-to-epithelial signaling cascade responsible for the activation of epithelial HNF-4{alpha} gene expression.

The concept that immortalized IEC cells can retain progenitor properties has been provided in xenograft experiments in the past (24). Our results support the notion that Cdx2 expression is required for IEC to initiate differentiation into mature enterocytes in the mesenchymal context. Cdx2 expression increases with polarization and differentiation of IEC clusters. This observation is consistent with the increasing gradient of Cdx2 expression along the intestinal crypt (8, 23, 45). Other epithelial cell lineages (goblet and enteroendocrine cells) were rarely but detected throughout the coculture system (data not illustrated). This agrees with the normal composition of the intestinal mucosa in which secretory cells represent only 5 to 10% of total epithelial cells.

Some transcription factors were identified to modulate intestinal gene expression (59). Cdx2 modulates cellular functions and intestine-specific gene expression (6, 17, 50, 54). GATA-4 and HNF-1{alpha} are expressed in the intestinal epithelium and cooperate in transcriptional regulation of intestinal epithelial specific genes such as SI (6). Specific induction of these factors in differentiating IEC (Fig. 4) emphasizes the initiation of a differentiation program within the coculture system. Some suggestions from the literature have linked HNF-4{alpha} transcriptional action with the process of epithelial cell polarization (1, 9, 48). HNF-4{alpha} can induce the expression of cell junction molecules such as occludin and claudins and can modulate subcellular localization of proteins associated with cellular polarity (9, 48). Interestingly, HNF-4{alpha} expression was detectable at day 5 when occludin and claudin family members were upregulated in IEC polarized cells. HNF-4{alpha} is considered to be the master regulator of the human hepatocyte where it controls the expression of molecules implicated in lipid uptake and transport (20, 28, 36, 61). HNF-4{alpha} is expressed along both the vertical and horizontal axis of the gut epithelium and regulates intestinal epithelial expression of alkaline phosphatase, ApoA-IV, and meprin-1{alpha} genes (37, 49, 53). Conditional knockout of HNF-4{alpha} demonstrated its crucial role into the embryonic development of the mouse colonic epithelium, but its role in the small intestinal context still remains to be investigated (14). Metabolome, transcriptome, and bioinformatic analyses indicated that HNF-4{alpha} could be implicated in intestinal lipid metabolism with the regulation of apolipoprotein synthesis (53). Our findings demonstrate that HNF-4{alpha} is a potent activator of several intestinal genes normally associated with mature enterocyte functions. In addition, HNF-4{alpha} is able to rapidly induce HNF-1{alpha} gene transcript and protein levels within the IEC context. This molecular interaction is probably due to a direct transcriptional action of HNF-4{alpha} on the HNF-1{alpha} promoter since it was previously reported that HNF-4{alpha} can directly control the transcription of HNF-1{alpha} in hepatocytes (26, 36). HNF-1{alpha} was also shown to control HNF-4{alpha} transcription specifically in pancreatic cells ( 3), a relationship that was not observed in our culture model system. Our observations lead us to suggest that HNF-4{alpha} is required for the activation of HNF-1{alpha} expression in IEC. Since HNF-4{alpha} and HNF-1{alpha} can also physically interact to modulate gene transcription (12, 25), these transcription factors probably form a multicomponent transcriptional loop to regulate intestinal gene transcription. In support of this affirmation, our results show that HNF-4{alpha} can strongly collaborate with HNF-1{alpha} with the transcriptional activation of the calbindin 3 gene. Since the calbindin 3 gene 5'-flanking region contains predicted interacting sites for HNF-4{alpha} and since HNF-1{alpha} was already reported to influence calbindin 3 transcription via several interacting sites (60), the exact nature of the molecular interactions between these transcription factor and the calbindin gene must be complex.

In conclusion, this study led to the generation and detailed molecular characterization of a functional in vitro system for IEC polarization and differentiation and functionally identified for the first time HNF-4{alpha} as an important contributor for these actions. Combinatory mechanisms between multiple transcriptional regulators are likely to occur during IEC differentiation, and our findings contribute to a better definition of the molecular cascade that led to the establishment of the intestinal epithelial transcriptome. On the basis of our findings, we propose the following schematic (Fig. 9) : Cdx2 is crucial to initiate IEC to polarize and differentiate when cocultured on mesenchymal cells. These processes are coordinated with the rapid activation of HNF-4{alpha} and HNF-1{alpha} expression, which requires both mesenchymal signals and Cdx2 action (Fig. 9A). On the other hand, HNF-4{alpha} activates HNF-1{alpha} expression. HNF-4{alpha} is a potent activator of intestinal epithelial genes and collaborates with HNF-1{alpha} to regulate intestinal genes. Forced expression of HNF-1{alpha} in the coculture system does not improve differentiation, an observation that correlates well with the absence of morphological defect in the intestinal epithelium of HNF-1{alpha} knockout mice (4). However, forced expression of HNF-4{alpha} leads to complete polarization and features normally associated with apical-to-basal transport (15) (Fig. 9B). Genetic modifications of the cellular counterparts of this system will give novel opportunities to sequentially assess the function of any molecules of interest during intestinal differentiation and should allow a better definition of the crucial pathways that regulate maturation of intestinal epithelial cells.


Figure 9
View larger version (20K):
[in this window]
[in a new window]

  		Fig. 9. Schematic of the cascade of events that lead to IEC differentiation. A: Cdx2 is required to initiate IEC to polarize and differentiate when cocultured on mesenchymal cells. This coincides with the induction of HNF-4{alpha} and HNF-1{alpha} only in the presence of Cdx2 and mesenchymal cells. B: HNF-4{alpha} activates HNF-1{alpha} and several intestinal epithelial genes. Forced expression of HNF-4{alpha} promotes features associated with apical-to-basal transport, a feature limited to well-polarized and fully differentiated epithelial cells.

 

   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was supported by Canadian Institute of Health Research (to F. Boudreau) and the Natural Sciences and Engineering Research Council of Canada (NSERC; Grant no. 262094-03). C. R. Lussier and J. P. Babeu are supported from the NSERC. F. Boudreau and N. Perreault are scholars from the Fonds de la Recherche en Santé du Québec and members of the FRSQ-funded Centre de Recherche Clinique Étienne Lebel.


   ACKNOWLEDGMENTS
 
The authors thank Dr. Peter G. Traber (Baylor College of Medicine, Houston) for providing the IEC-6/L1 cell line, Denis Martel and Charles Bertrand for assistance in electron microscopy procedures, and the Microarray Platform Lab from McGill University and Génome Québec Innovation Centre for the generation of the cDNA arrays.


   FOOTNOTES
 

Address for reprint requests and other correspondence: F. Boudreau, Département d'Anatomie et de Biologie Cellulaire, Faculté de Médecine et des Sciences de la Santé, 3001 12e ave Nord, Sherbrooke, QC, Canada, J1H 5N4 (e-mail: francois.boudreau{at}usherbrooke.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Battle MA, Konopka G, Parviz F, Gaggl AL, Yang C, Sladek FM, Duncan SA. Hepatocyte nuclear factor 4alpha orchestrates expression of cell adhesion proteins during the epithelial transformation of the developing liver. Proc Natl Acad Sci USA 103: 8419–8424, 2006.[Abstract/Free Full Text]
  2. Beaulieu JF. Extracellular matrix components and integrins in relationship to human intestinal epithelial cell differentiation. Prog Histochem Cytochem 31: 1–78, 1997.[Web of Science][Medline]
  3. Boj SF, Parrizas M, Maestro MA, Ferrer J. A transcription factor regulatory circuit in differentiated pancreatic cells. Proc Natl Acad Sci USA 98: 14481–14486, 2001.[Abstract/Free Full Text]
  4. Bosse T, van Wering HM, Gielen M, Dowling LN, Fialkovich JJ, Piaseckyj CM, Gonzalez FJ, Akiyama TE, Montgomery RK, Grand RJ, Krasinski SD. Hepatocyte nuclear factor-1{alpha} is required for expression but dispensable for histone acetylation of the lactase-phlorizin hydrolase gene in vivo. Am J Physiol Gastrointest Liver Physiol 290: G1016–G1024, 2006.[Abstract/Free Full Text]
  5. Boudreau F, Lussier CR, Mongrain S, Darsigny M, Drouin JL, Doyon G, Ran Suh E, Beaulieu JF, Rivard N, Perreault N. Loss of cathepsin L activity promotes claudin-1 overexpression and intestinal neoplasia. FASEB J 21: 3853–3865, 2007.[Abstract/Free Full Text]
  6. Boudreau F, Rings EH, van Wering HM, Kim RK, Swain GP, Krasinski SD, Moffett J, Grand RJ, Suh ER, Traber PG. Hepatocyte nuclear factor-1 alpha, GATA-4, and caudal related homeodomain protein Cdx2 interact functionally to modulate intestinal gene transcription. Implication for the developmental regulation of the sucrase-isomaltase gene. J Biol Chem 277: 31909–31917, 2002.[Abstract/Free Full Text]
  7. Boudreau F, Zhu Y, Traber PG. Sucrase-isomaltase gene transcription requires the hepatocyte nuclear factor-1 (HNF-1) regulatory element and is regulated by the ratio of HNF-1 alpha to HNF-1 beta. J Biol Chem 276: 32122–32128, 2001.[Abstract/Free Full Text]
  8. Boulanger J, Vezina A, Mongrain S, Boudreau F, Perreault N, Auclair BA, Laine J, Asselin C, Rivard N. Cdk2-dependent phosphorylation of homeobox transcription factor CDX2 regulates its nuclear translocation and proteasome-mediated degradation in human intestinal epithelial cells. J Biol Chem 280: 18095–18107, 2005.[Abstract/Free Full Text]
  9. Chiba H, Gotoh T, Kojima T, Satohisa S, Kikuchi K, Osanai M, Sawada N. Hepatocyte nuclear factor (HNF)-4alpha triggers formation of functional tight junctions and establishment of polarized epithelial morphology in F9 embryonal carcinoma cells. Exp Cell Res 286: 288–297, 2003.[CrossRef][Web of Science][Medline]
  10. Crosnier C, Stamataki D, Lewis J. Organizing cell renewal in the intestine: stem cells, signals and combinatorial control. Nat Rev Genet 7: 349–359, 2006.[CrossRef][Web of Science][Medline]
  11. Divine JK, Staloch LJ, Haveri H, Jacobsen CM, Wilson DB, Heikinheimo M, Simon TC. GATA-4, GATA-5, and GATA-6 activate the rat liver fatty acid binding protein gene in concert with HNF-1{alpha}. Am J Physiol Gastrointest Liver Physiol 287: G1086–G1099, 2004.[Abstract/Free Full Text]
  12. Eeckhoute J, Formstecher P, Laine B. Hepatocyte nuclear factor 4alpha enhances the hepatocyte nuclear factor 1alpha-mediated activation of transcription. Nucleic Acids Res 32: 2586–2593, 2004.[Abstract/Free Full Text]
  13. Escaffit F, Boudreau F, Beaulieu JF. Differential expression of claudin-2 along the human intestine: Implication of GATA-4 in the maintenance of claudin-2 in differentiating cells. J Cell Physiol 203: 15–26, 2005.[CrossRef][Medline]
  14. Garrison WD, Battle MA, Yang C, Kaestner KH, Sladek FM, Duncan SA. Hepatocyte nuclear factor 4alpha is essential for embryonic development of the mouse colon. Gastroenterology 130: 1207–1220, 2006.[Web of Science][Medline]
  15. Grasset E, Pinto M, Dussaulx E, Zweibaum A, Desjeux JF. Epithelial properties of human colonic carcinoma cell line Caco-2: electrical parameters. Am J Physiol Cell Physiol 247: C260–C267, 1984.[Abstract/Free Full Text]
  16. Gregorieff A, Clevers H. Wnt signaling in the intestinal epithelium: from endoderm to cancer. Genes Dev 19: 877–890, 2005.[Abstract/Free Full Text]
  17. Guo RJ, Suh ER, Lynch JP. The role of Cdx proteins in intestinal development and cancer. Cancer Biol Ther 3: 593–601, 2004.[Web of Science][Medline]
  18. Haffen K, Kedinger M, Simon-Assmann P. Mesenchyme-dependent differentiation of epithelial progenitor cells in the gut. J Pediatr Gastroenterol Nutr 6: 14–23, 1987.[Web of Science][Medline]
  19. Haramis AP, Begthel H, van den Born M, van Es J, Jonkheer S, Offerhaus GJ, Clevers H. De novo crypt formation and juvenile polyposis on BMP inhibition in mouse intestine. Science 303: 1684–1686, 2004.[Abstract/Free Full Text]
  20. Hayhurst GP, Lee YH, Lambert G, Ward JM, Gonzalez FJ. Hepatocyte nuclear factor 4alpha (nuclear receptor 2A1) is essential for maintenance of hepatic gene expression and lipid homeostasis. Mol Cell Biol 21: 1393–1403, 2001.[Abstract/Free Full Text]
  21. He XC, Zhang J, Tong WG, Tawfik O, Ross J, Scoville DH, Tian Q, Zeng X, He X, Wiedemann LM, Mishina Y, Li L. BMP signaling inhibits intestinal stem cell self-renewal through suppression of Wnt-beta-catenin signaling. Nat Genet 36: 1117–1121, 2004.[CrossRef][Web of Science][Medline]
  22. Hooper JE, Scott MP. Communicating with Hedgehogs. Nat Rev Mol Cell Biol 6: 306–317, 2005.[CrossRef][Web of Science][Medline]
  23. James R, Erler T, Kazenwadel J. Structure of the murine homeobox gene cdx-2. Expression in embryonic and adult intestinal epithelium. J Biol Chem 269: 15229–15237, 1994.[Abstract/Free Full Text]
  24. Kedinger M, Simon-Assmann PM, Lacroix B, Marxer A, Hauri HP, Haffen K. Fetal gut mesenchyme induces differentiation of cultured intestinal endodermal and crypt cells. Dev Biol 113: 474–483, 1986.[CrossRef][Web of Science][Medline]
  25. Ktistaki E, Talianidis I. Modulation of hepatic gene expression by hepatocyte nuclear factor 1. Science 277: 109–112, 1997.[Abstract/Free Full Text]
  26. Kuo CJ, Conley PB, Chen L, Sladek FM, Darnell JE Jr, Crabtree GR. A transcriptional hierarchy involved in mammalian cell-type specification. Nature 355: 457–461, 1992.[CrossRef][Medline]
  27. Leedham SJ, Brittan M, McDonald SA, Wright NA. Intestinal stem cells. J Cell Mol Med 9: 11–24, 2005.[Web of Science][Medline]
  28. Li J, Ning G, Duncan SA. Mammalian hepatocyte differentiation requires the transcription factor HNF-4alpha. Genes Dev 14: 464–474, 2000.[Abstract/Free Full Text]
  29. Madison BB, Braunstein K, Kuizon E, Portman K, Qiao XT, Gumucio DL. Epithelial hedgehog signals pattern the intestinal crypt-villus axis. Development 132: 279–289, 2005.[Abstract/Free Full Text]
  30. Matter K, Aijaz S, Tsapara A, Balda MS. Mammalian tight junctions in the regulation of epithelial differentiation and proliferation. Curr Opin Cell Biol 17: 453–458, 2005.[CrossRef][Web of Science][Medline]
  31. Mitchelmore C, Troelsen JT, Spodsberg N, Sjostrom H, Noren O. Interaction between the homeodomain proteins Cdx2 and HNF1alpha mediates expression of the lactase-phlorizin hydrolase gene. Biochem J 346: 529–535, 2000.[CrossRef][Web of Science][Medline]
  32. Miyoshi J, Takai Y. Molecular perspective on tight-junction assembly and epithelial polarity. Adv Drug Delivery Res 57: 815–855, 2005.[CrossRef][Web of Science][Medline]
  33. Montgomery RK, Mulberg AE, Grand RJ. Development of the human gastrointestinal tract: twenty years of progress. Gastroenterology 116: 702–731, 1999.[CrossRef][Web of Science][Medline]
  34. Moore KA, Lemischka IR. Stem cells and their niches. Science 311: 1880–1885, 2006.[Abstract/Free Full Text]
  35. Novak JP, Sladek R, Hudson TJ. Characterization of variability in large-scale gene expression data: implications for study design. Genomics 79: 104–113, 2002.[CrossRef][Web of Science][Medline]
  36. Odom DT, Zizlsperger N, Gordon DB, Bell GW, Rinaldi NJ, Murray HL, Volkert TL, Schreiber J, Rolfe PA, Gifford DK, Fraenkel E, Bell GI, Young RA. Control of pancreas and liver gene expression by HNF transcription factors. Science 303: 1378–1381, 2004.[Abstract/Free Full Text]
  37. Olsen L, Bressendorff S, Troelsen JT, Olsen J. Differentiation-dependent activation of the human intestinal alkaline phosphatase promoter by HNF-4 in intestinal cells. Am J Physiol Gastrointest Liver Physiol 289: G220–G226, 2005.[Abstract/Free Full Text]
  38. Perreault N, Jean-Francois B. Use of the dissociating enzyme thermolysin to generate viable human normal intestinal epithelial cell cultures. Exp Cell Res 224: 354–364, 1996.[CrossRef][Web of Science][Medline]
  39. Perreault N, Katz JP, Sackett SD, Kaestner KH. Foxl1 controls the Wnt/beta-catenin pathway by modulating the expression of proteoglycans in the gut. J Biol Chem 276: 43328–43333, 2001.[Abstract/Free Full Text]
  40. Potten CS, Loeffler M. Stem cells: attributes, cycles, spirals, pitfalls and uncertainties. Lessons for and from the crypt. Development 110: 1001–1020, 1990.[Abstract/Free Full Text]
  41. Powell DW, Adegboyega PA, Di Mari JF, Mifflin RC. Epithelial cells and their neighbors I. Role of intestinal myofibroblasts in development, repair, and cancer. Am J Physiol Gastrointest Liver Physiol 289: G2–G7, 2005.[Abstract/Free Full Text]
  42. Quaroni A, Isselbacher KJ. Cytotoxic effects and metabolism of benzo[a]pyrene and 7,12-dimethylbenz[a]anthracene in duodenal and ileal epithelial cell cultures. J Natl Cancer Inst 67: 1353–1362, 1981.[Medline]
  43. Quaroni A, Wands J, Trelstad RL, Isselbacher KJ. Epithelioid cell cultures from rat small intestine. Characterization by morphologic and immunologic criteria. J Cell Biol 80: 248–265, 1979.[Abstract/Free Full Text]
  44. Radtke F, Clevers H. Self-renewal and cancer of the gut: two sides of a coin. Science 307: 1904–1909, 2005.[Abstract/Free Full Text]
  45. Rings EH, Boudreau F, Taylor JK, Moffett J, Suh ER, Traber PG. Phosphorylation of the serine 60 residue within the Cdx2 activation domain mediates its transactivation capacity. Gastroenterology 121: 1437–1450, 2001.[CrossRef][Web of Science][Medline]
  46. Sakaguchi T, Gu X, Golden HM, Suh E, Rhoads DB, Reinecker HC. Cloning of the human claudin-2 5'-flanking region revealed a TATA-less promoter with conserved binding sites in mouse and human for caudal-related homeodomain proteins and hepatocyte nuclear factor-1alpha. J Biol Chem 277: 21361–21370, 2002.[Abstract/Free Full Text]
  47. Sancho E, Batlle E, Clevers H. Signaling pathways in intestinal development and cancer. Annu Rev Cell Dev Biol 20: 695–723, 2004.[CrossRef][Web of Science][Medline]
  48. Satohisa S, Chiba H, Osanai M, Ohno S, Kojima T, Saito T, Sawada N. Behavior of tight-junction, adherens-junction and cell polarity proteins during HNF-4alpha-induced epithelial polarization. Exp Cell Res 310: 66–78, 2005.[CrossRef][Web of Science][Medline]
  49. Sauvaget D, Chauffeton V, Citadelle D, Chatelet FP, Cywiner-Golenzer C, Chambaz J, Pincon-Raymond M, Cardot P, Le Beyec J, Ribeiro A. Restriction of apolipoprotein A-IV gene expression to the intestine villus depends on a hormone-responsive element and parallels differential expression of the hepatic nuclear factor 4alpha and gamma isoforms. J Biol Chem 277: 34540–34548, 2002.[Abstract/Free Full Text]
  50. Silberg DG, Swain GP, Suh ER, Traber PG. Cdx1 and cdx2 expression during intestinal development. Gastroenterology 119: 961–971, 2000.[CrossRef][Web of Science][Medline]
  51. Simon-Assmann P, Kedinger M, Haffen K. Immunocytochemical localization of extracellular-matrix proteins in relation to rat intestinal morphogenesis. Differentiation 32: 59–66, 1986.[CrossRef][Medline]
  52. Staloch LJ, Divine JK, Witten JT, Simon TC. C/EBP and Cdx family factors regulate liver fatty acid binding protein transgene expression in the small intestinal epithelium. Biochim Biophys Acta 1731: 168–178, 2005.[Medline]
  53. Stegmann A, Hansen M, Wang Y, Larsen JB, Lund LR, Ritie L, Nicholson JK, Quistorff B, Simon-Assmann P, Troelsen JT, Olsen J. Metabolome, transcriptome and bioinformatic cis-element analyses point to HNF-4 as a central regulator of gene expression during enterocyte differentiation. Physiol Genomics 2006.
  54. Suh E, Traber PG. An intestine-specific homeobox gene regulates proliferation and differentiation. Mol Cell Biol 16: 619–625, 1996.[Abstract]
  55. Van den Brink GR, Bleuming SA, Hardwick JC, Schepman BL, Offerhaus GJ, Keller JJ, Nielsen C, Gaffield W, van Deventer SJ, Roberts DJ, Peppelenbosch MP. Indian Hedgehog is an antagonist of Wnt signaling in colonic epithelial cell differentiation. Nat Genet 36: 277–282, 2004.[CrossRef][Web of Science][Medline]
  56. Van Wering HM, Bosse T, Musters A, de Jong E, de Jong N, Hogen Esch CE, Boudreau F, Swain GP, Dowling LN, Montgomery RK, Grand RJ, Krasinski SD. Complex regulation of the lactase-phlorizin hydrolase promoter by GATA-4. Am J Physiol Gastrointest Liver Physiol 287: G899–G909, 2004.[Abstract/Free Full Text]
  57. Van Wering HM, Huibregtse IL, van der Zwan SM, de Bie MS, Dowling LN, Boudreau F, Rings EH, Grand RJ, Krasinski SD. Physical interaction between GATA-5 and hepatocyte nuclear factor-1alpha results in synergistic activation of the human lactase-phlorizin hydrolase promoter. J Biol Chem 277: 27659–27667, 2002.[Abstract/Free Full Text]
  58. Van Wering HM, Moyer L, Grand RJ, Krasinski SD. Novel interaction at the Cdx-2 binding sites of the lactase-phlorizin hydrolase promoter. Biochem Biophys Res Commun 299: 587–593, 2002.[CrossRef][Web of Science][Medline]
  59. Walters JR. Recent findings in the cell and molecular biology of the small intestine. Curr Opin Gastroenterol 21: 135–140, 2005.[CrossRef][Web of Science][Medline]
  60. Wang L, Klopot A, Freund JN, Dowling LN, Krasinski SD, Fleet JC. Control of differentiation-induced calbindin-D9k gene expression in Caco-2 cells by cdx-2 and HNF-1{alpha}. Am J Physiol Gastrointest Liver Physiol 287: G943–G953, 2004.[Abstract/Free Full Text]
  61. Watt AJ, Garrison WD, Duncan SA. HNF4: a central regulator of hepatocyte differentiation and function. Hepatology 37: 1249–1253, 2003.[CrossRef][Web of Science][Medline]
  62. Whitehead RH, Demmler K, Rockman SP, Watson NK. Clonogenic growth of epithelial cells from normal colonic mucosa from both mice and humans. Gastroenterology 117: 858–865, 1999.[CrossRef][Web of Science][Medline]
  63. Zhang J, Li L. BMP signaling and stem cell regulation. Dev Biol 284: 1–11, 2005.[CrossRef][Web of Science][Medline]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
J.-P. Babeu, M. Darsigny, C. R. Lussier, and F. Boudreau
Hepatocyte nuclear factor 4{alpha} contributes to an intestinal epithelial phenotype in vitro and plays a partial role in mouse intestinal epithelium differentiation
Am J Physiol Gastrointest Liver Physiol, July 1, 2009; 297(1): G124 - G134.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/2/G418    most recent
00418.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lussier, C. R.
Right arrow Articles by Boudreau, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lussier, C. R.
Right arrow Articles by Boudreau, F.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.