AJP - GI Watch the video to learn how APS reaches out to developing nations.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Gastrointest Liver Physiol 294: G576-G588, 2008. First published December 20, 2007; doi:10.1152/ajpgi.00159.2007
0193-1857/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow All Versions of this Article:
294/2/G576    most recent
00159.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Braiterman, L. T.
Right arrow Articles by Hubbard, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Braiterman, L. T.
Right arrow Articles by Hubbard, A. L.

REPORT

JAM-A is both essential and inhibitory to development of hepatic polarity in WIF-B cells

Lelita T. Braiterman,1 Sean Heffernan,1 Lydia Nyasae,1 David Johns,2 Alfred P. See,1 Rebeca Yutzy,1 Allison McNickle,1 Mira Herman,1 Arun Sharma,1 Ulhas P. Naik,3 and Ann L. Hubbard1

1Department of Cell Biology and 2Department of Neurosurgery, Johns Hopkins University School of Medicine, Baltimore, Maryland; and 3Department of Biological Sciences, University of Delaware, Newark, Delaware

Submitted 12 April 2007 ; accepted in final form 18 December 2007

ABSTRACT

Junctional adhesion molecule (JAM) is involved in tight junction (TJ) formation in epithelial cells. Three JAMs (A, B, and C) are expressed in rat hepatocytes, but only rat JAM-A is present in polarized WIF-B cells, a rat-human hepatic line. We used knockdown (KD) and overexpression in WIF-B cells to determine the role of JAM-A in the development of hepatic polarity. Expression of rat JAM-A short hairpin RNA resulted in ~50% KD of JAM-A and substantial loss of hepatic polarity, as measured by the absence of apical cysts formed by adjacent cells and sealed by TJ belts. When inhibitory RNA-resistant human JAM-A (huWT) was expressed in KD cells, hepatic polarity was restored. In contrast, expression of JAM-A that either lacked its PDZ-binding motif (hu{Delta}C-term) or harbored a point mutation (T273A) did not complement, indicating that multiple sites within JAM-A's cytoplasmic tail are required for the development of hepatic polarity. Overexpression of huWT in normal WIF-B cells unexpectedly blocked WIF-B maturation to the hepatic phenotype, as did expression of three huJAM-A constructs with single point mutations in putative phosphorylation sites. In contrast, hu{Delta}C-term was without effect, and the T273A mutant only partially blocked maturation. Our results show that JAM-A is essential for the development of polarity in cultured hepatic cells via its possible phosphorylation and recruitment of relevant PDZ proteins and that hepatic polarity is achieved within a narrow range of JAM-A expression levels. Importantly, formation/maintenance of TJs and the apical domain in hepatic cells are linked, unlike simple epithelia.

partitioning-defective polarity protein/atypical protein kinase C complex

EPITHELIAL CELLS LINE all body organs and serve as selective barriers between two different worlds (the internal and the external). Epithelia accomplish this essential function by cementing themselves together through intercellular junctions and restricting distinct activities to one plasma membrane (PM) surface or the other (the basal and apical domains) (72). Recent progress has led to the identification of many proteins involved in establishing polarity, and studies have highlighted three polarity complexes that play key roles (5, 55, 59). One such complex includes the membrane protein junctional adhesion molecule (JAM), which belongs to the cell differentiation antigen 2 (CD2) subgroup of the Ig superfamily of cell adhesion proteins (reviewed in Refs. 1, 18, 36). There are three closely related members, JAM-A, -B, and -C, (1), each having two tandem NH2-terminal, ectoplasmic Ig domains followed by single transmembrane spans and COOH-terminal cytoplasmic tails of variable lengths that end in postsynaptic density and ZO-1 (PDZ)-binding motifs.

JAM family members have been implicated in a number of cell processes, including platelet aggregation/association with the endothelium, diapedesis of white blood cells across endothelium, and tight junction (TJ) formation (18, 45). JAM-A was first identified on the surface of platelets (46, 47). It and other JAM isoforms were subsequently localized to TJs of many epithelia (38), but JAMs appear not to be components of the TJ strands themselves. Rather, the proteins are found between TJ strands in Madin-Darby canine kidney (MDCK) cells (26).

Although epithelial functions have been disrupted by JAM-A knockdown (KD) in cell culture models of simple epithelia and recently in cultured hepatic cells (35, 54), gene knockout studies of individual JAMs in mice have shown no major defects in development or function of epithelia, most likely a consequence of gene redundancy (8, 21, 56). Nonetheless, results from the in vitro studies suggest that JAM plays an essential and early role in TJ formation (17, 26, 38), since it was found at primordial cell-cell contact sites in a bronchial epithelial cell line (31).

Hepatocytes comprise the parenchyma of the liver and are organized differently than epithelial cells in other tissues. Most epithelial cells exhibit a simple polarity, consisting of single apical and basal surfaces that are opposite each other and lateral surfaces that participate in cell-cell associations. In contrast, hepatocytes are polygonal and multipolar, with at least two basal surfaces facing the circulation and a branched network of grooves that forms between adjacent cells and constitutes the apical, or bile canalicular (BC) surface. Thus the cells are organized into cords. During mouse development, a liver bud composed of nonpolarized hepatoblasts is detected at embryonic day 9.5 (74). From embryonic day 17 to embryonic day 21, the hepatoblasts form clusters resembling acini and develop a simple polar phenotype with their apical surfaces facing a central lumen (19, 34). The multipolar hepatic phenotype gradually manifests itself during the postnatal period, although cell clusters whose apical poles face a small lumen are still evident 12 days after birth (34). The molecular mechanisms directing conversion from the simple polarity of an acinus to the polygonal polarity and cord organization of the adult liver are unknown.

In this study, we asked whether JAM-A plays a role in the establishment and maintenance of hepatic polarity. We used the well-characterized WIF-B hepatic cell line (4, 25, 58), because these cells recapitulate a two-step polarization process reminiscent of that in vivo (13) and express only the rat JAM-A isoform. We found that expression of lentivirus encoding a short hairpin RNA (shRNA) to rat JAM-A knocked down 50% of the endogenous protein in WIF-B cells, with an accompanying loss of hepatic polarity and TJs. Expression of the human JAM-A (huWT, resistant to rat JAM-A shRNA) in KD cells rescued the hepatic phenotype. In contrast, expression of a human JAM-A lacking its COOH-terminal 4-amino acid PDZ-binding motif (hu{Delta}C-term) did not. Importantly, we determined that human JAM-A harboring a single point mutation in its COOH terminus at threonine 273 (T273A) also lacked that ability to complement the KD cells. Additionally, we found that overexpression of huWT blocked development of hepatic polarity in normal WIF-B cells, as did three proteins that harbored mutations of putative phosphorylation sites in the cytoplasmic tail. Again, hu{Delta}C-term had no effect, while overexpression of the T273A mutant protein gave a partial block. Together, these results indicate an essential role for JAM-A, its cytoplasmic tail, as well as PDZ proteins in the development of TJs and hepatic polarity.

MATERIALS AND METHODS

Animal protocols (described in Supplemental Fig. S1) were reviewed and approved by the Institutional Animal Care and Use Committee of Johns Hopkins University School of Medicine.1

Materials

Defective adenovirus DNA, Psi5{Delta}E1-E3, pAdLox, and CRE8 cells were provided by S. Hardy Somatrix Therapy, Alameda, CA (22) and the Par1b adenovirus by A. Muesch Weill Medical College of Cornell University, New York, NY (11). Reagents and suppliers were as follows: HEK293A cells (QBI293 cells, Qbiogene, Carlsbad, CA), pGEM T-Easy vector (Promega, Madison, WI), QIAprep Spin Miniprep Kit and Qiagen plasmid Maxi Kit (Qiagen, Valencia, CA), and Supersignal West Pico Reagent (Pierce Biotechnology, Rockford, IL). Other molecular biology reagents were from New England Biolabs (Beverly, MA), Invitrogen, or Promega. DNA sequencing was performed by the DNA Synthesis/Sequencing Facility, Johns Hopkins Medical Institutions (JHMI), primer synthesis by Integrated DNA Technologies (Coralville, IA), and fluorescence-based cell sorting by the Flow Cytometry Core Facility, JHMI.

Primary antibodies were from the following sources: rabbit anti-atypical protein kinase C (aPKC)-{zeta} (C-20, sc-216), goat anti-Scribble (C-20, sc-11049), and rabbit anti-lamin A/C (H-110, sc-20681) from Santa Cruz Biotechnology (Santa Cruz, CA); goat anti-JAM (AF1077) and rat β1-integrin (MAB2405) from R&D Systems (Minneapolis, MN); rabbit anti-ZO-1 (61-7300), mouse anti-occludin (33-1500), and rabbit anti-JAM (36-1700) from Zymed (San Francisco, CA); mouse anti-JAM (F11R, 552147), mouse anti-β-catenin (610153), and mouse anti-E-cadherin (610181) from BD Biosciences (San Jose, CA); and mouse anti-Myc-tag 9B11 (2276) from Cell Signaling (Beverly, MA). Rabbit antibody to aminopeptidase N (APN) was described previously (3, 24, 25). Rat monoclonal anti-ZO-1 hybridoma cells (R40.76) were provided by B. Stevenson (University of Alberta, Edmonton, AB, Canada). Antiserum to partitioning-defective polarity protein (PAR)3 (JH4936) was generated in rabbits immunized with a glutathione S-transferase fusion to rat PAR3 corresponding to amino acids 598–1027 of mouse PAR3 by Covance (Denver, PA). Secondary antibodies used were from the following sources: Alexa-labeled anti-mouse, anti-rabbit, or anti-goat from Molecular Probes (Eugene, OR); Cy3- or Cy5-labeled anti-mouse, anti-rabbit, or anti-rat from Jackson ImmunoResearch Laboratories (West Grove, PA); and horseradish peroxidase-conjugated secondary antibodies, donkey anti-rabbit, rabbit anti-goat, and goat anti-mouse (Amersham Biosciences, Little Chalfont, UK).

Molecular Biology Methods

To determine which JAM genes were expressed in hepatic cells, we identified rat JAM-A, -B and -C IMAGE clones (accession nos. AF276998, BQ210314, and BC066309, respectively) through database searches and designed gene-specific primer pairs (nAH271/nAH272, nAH273/nAH274, and nAH275/nAH276) to give three different size fragments on amplification. Total RNA was extracted with TRIzol reagent (Invitrogen) from freshly isolated hepatocytes, WIF-B, and Fao cells, and 0.5–1 mg total RNA was used to isolate mRNA with Oligotex according to the manufacturer's instructions (Qiagen). After cDNA preparations, PCR reactions were performed, the products were evaluated on an agarose gel, and the fragments were cloned into pGEM T-Easy vector. Plasmid DNA was isolated from selected colonies, and the sequences were confirmed. Primer sequences will be provided on request.

We produced third-generation self-inactivating lentiviral vectors (41, 75), using the backbone pCFUGW (33), which contains the ubiquitin C promoter driving a green fluorescent protein (GFP) reporter gene with a WPRE element to enhance long-term expression. This backbone gives efficient expression in liver and is useful for expression of shRNA (52). The vector was modified by placing the human H1 promoter with a tetracycline regulatory element upstream of the ubiquitin promoter in a promoter-to-promoter orientation to give pCFUGW-H1.2, which makes shRNA expression inducible. In the absence of the Tet operator, the H1 promoter is fully activated. Target sequences (KO1 = nt 108–136 and KO2 = nt 178–196) to rat JAM-A mRNA were identified (Dharmacon siDESIGN Center). KO1 and KO2 oligonucleotides (5'GCTAGCCATCATAGACGTGAAGAGAATTCAAGAGTTCTCTTCACGTCTATGATTTTTTGGAGTTAAC and GCTAGCCGAAGCGCAGTGGTGCTGCCTTCAAGAGAGGCAGCACCACTGCGCTTCTTTTTTGGCGTTAAC, respectively) and their complements were generated so that overhangs would clone into the NheI and HpaI sites of pCFUGW-H1; the antisense and sense sequences are underlined. The target sequences were inserted into the plasmid by GenScript (Piscataway, NJ) to give pCFUGW-H1.2-KO1 and pCFUGW-H1.2-KO2. The sequences have eight (KO1) and six (KO2) mismatches to human JAM-A (for more details see www.genscript.com).

Viral particles were packaged in 293T cells by cotransfection of plasmids containing the packaging genome, an envelope glycoprotein (VSVG), and either pCFUGW-H1.2-KO1 or pCFUGW-H1.2-KO2 essentially as described previously (57). After transfection, cells were placed in serum-free medium, which was collected 24, 48, and 72 h later. The pooled medium was concentrated by ultrafiltration (100,000 mol wt cutoff). Titering was performed by applying viruses to 293 cells in the presence of 8 µg/ml polybrene for 24 h, after which the virus was removed, fresh medium was applied, and 48 h later the cells expressing GFP were counted by microscopy.

Two plasmids, hemagglutinin antigen (HA)-tagged human JAM-A (epitope tag inserted after the signal sequence) and {Delta}-Cyto (lacking the HA epitope and the entire COOH terminus), were used to generate the JAM constructs for this study (47). HindIII/EcoRV fragments from HA-JAM-A and {Delta}-Cyto were cloned into HindIII/SmaI sites of the adenoviral vector pAdLox to give pYC54 and pYC52, respectively. The HA tag was removed from HA-JAM-A in pAdLox by cloning its BstEII/PstI fragment into the BstEII/PstI sites of pYC52, giving pSH31 (huWT). The {Delta}C-term mutant plasmid (deletion of the PDZ binding domain, -SFLV) was generated from pSH31 with primers nAH231/nAH229 (nt 451–1100 corresponding to aa 80–295) and cloned into pGEM-T-Easy to give pSH04. The pSH04 BstEII/PstI fragment was then cloned into the BstEII/PstI sites of pYC52 to give pSH16 (hu{Delta}C-term). Single amino acid substitutions in huJAM-A were generated with the Stratagene QuickChange II Site-Directed Mutagenesis Kit. Primer pairs nAH285/nAH286, nAH234/nAH235, and nAH382/nAH383 to give pSH51 (S296A), pSH47 (S281A), and pRY300 (T273A), respectively, were used to amplify pSH31. The COOH terminus of HA-tagged human JAM-A with a Y280F mutation (44) was cloned into pSH31, thereby removing the HA tag (pSH48). All plasmid sequences were verified. Primer sequences are available on request. Recombinant adenoviruses were prepared with JAM pAdlox shuttle vector plasmids (pSH31, pSH16, pSH47, pSH48, pSH51, and RY300) and the Cre-lox system (22). HEK293A cells were used to amplify the recombinant adenovirus.

Cell Culture, Infection, and Immunofluorescence

Cre8 and HEK293A cells were cultured as recommended by the supplier. WIF-B cells were grown as previously described (25, 58) except that the medium components glucose, ascorbic acid, and linoleic acid (542 ml/l, 15 mg/l, and 0.08 mg/l, respectively) were added to F-12 Kaign's modification (Invitrogen) to achieve a formulation nearly identical to that reported for F-12 Coon's modification. Cells (0.5 x 106) were plated either onto dishes (10 cm) directly or onto dishes containing six glass coverslips (22 x 22 mm) and fed every other day until use.

For lentivirus transduction, 100 µl of viral sup plus 8 µg/ml polybrene were applied to WIF-B cells grown on coverslips at day 3 or 4 and then twice more every other day thereafter. One day after the last application of virus (designated postinfection day 1), cells were trypsinized and plated onto dishes (10 cm) containing a coverslip, which was removed and used to evaluate polarity 12 days later. Postinfection day 7 or 8 cells from the same dish (10 cm) were trypsinized, and those with the brightest GFP expression (an indicator of stable virus integration) were isolated by FACS and cultured short-term. On day 7 or 8 after FACS, whole cell extracts from the short-term cultures were prepared to evaluate JAM-A levels (see below and Ref. 27). Frozen stocks of virus-infected cells were prepared after several rounds of propagation and then thawed, cultured, and FACS sorted on postinfection days 40 (KO1) and 29 (KO2). The sorted cells were plated by limiting dilution, and random clones were subsequently isolated, expanded, and evaluated ~3 mo after infection.

For JAM-A expression studies, we applied adenoviruses at multiplicity of infection of ~10 viral particles/cell to day 7 KD or day 8–9 WIF-B cells cultured on coverslips. After incubation (37°C, 60–90 min), fresh medium was added and the cells were cultured for 3–4 days before analysis.

For localization studies, cells on coverslips were rinsed briefly in PBS and then fixed, permeabilized, and rehydrated as described previously (40). Subsequent incubations were at room temperature. Samples were blocked in 1% BSA-PBS (30 min), incubated in primary antibody (1 h), rinsed in PBS (3 x 5 min), and then incubated with secondary antibody (1 h), rinsed in PBS (3 x 5 min), and mounted in 25% glycerol-2 mg/ml phenylenediamine in Tris-buffered saline, pH 9.5–10.5 (20 mM Tris, 149 mM NaCl). Primary and secondary antibodies were diluted in 1% BSA-PBS, and appropriate secondary antibodies were used at 2–3 µg/ml.

The labeled cells were examined by epifluorescence with a Zeiss Axioplan (Carl Zeiss), and digital images were collected with a Micromax charge-coupled device (CCD) camera (Princeton Instruments, Trenton, NJ) using IPLab 3.5 software (Scanalytics, Fairfax, VA). High-resolution, wide-field digital imaging was performed on an Axiovert 200 M (Carl Zeiss) equipped with a Lambda LS xenon lamp (Sutter Instrument, Novato, CA), filter sets 34, 38HE, and 43HE, Z-motor, motorized stage (Ludl Electronic Products, Hawthorne, NY), and Orca-ER CCD camera (Hamamatsu Photonics, Hamamatsu City, Japan). Volocity version 3 (Improvision, Lexington, MA) was used to capture images and Volocity version 4 to deconvolve them for colocalization analysis.

Polarity Index

To determine the extent of hepatic polarization in a given population of WIF-B cells, at least 100 cells were evaluated for the presence of an apical cyst plus a TJ belt. In the case of JAM-A KD cells, only those expressing GFP were evaluated to give a polar fraction (no. polar cells/total no. of GFP-expressing cells). In the huJAM-A overexpression studies, the polar fraction of huJAM-A-expressing cells was determined, and a polarity index was then calculated by normalizing to the polar fraction of either uninfected cells on the same coverslip or those expressing hu{Delta}C-term on a parallel coverslip.

Biochemical Analysis of Virus-Transduced/Infected WIF-B Cells

Whole cell extracts were prepared by scraping cells directly into SDS-PAGE sample buffer [10 mM Tris·HCl (pH 8.8), 2 mM EDTA, 2.5% SDS, 15% (wt/vol) sucrose] and boiled (3 min), and the DNA was sheared with a 28- or 27-gauge needle. Samples were then reduced with 2-mercaptoethanol (10% vol/vol), boiled again (3 min), separated by SDS-PAGE, and transferred to nitrocellulose as described above. Antibodies to JAM-A (36-1700) and other proteins were diluted in 1% BSA-PBS + 0.1% Tween, applied to the blots, and incubated as described above and previously (27). To quantify levels of JAM-A in the KD cells, extracts from uninfected WIF-B and JAM KD cells, four and two dilutions, respectively, were separated by SDS-PAGE and analyzed by immunoblotting. Immunoblots were probed with anti-lamin A/C as a loading control, based on the assumption that levels of a nuclear protein would be more representative of cell number than a cytosolic protein. For each WIF-B sample dilution, the chemiluminescence intensity of JAM-A (JAM intensityWIFB) was plotted versus that of lamin A/C (lamin intensityWIFB). A least-squares regression fit was generated to give the formula (JAM intensityWIFB) = (lamin intenstiyWIFB) x (M + B), where M is slope and B is intercept. This equation and the lamin A/C intensity of the KO extract (lamin intenstiyKO) were used to calculate the expected level of JAM if KD did not occur (= calculated JAM intensityWIFB). Relative JAM in the KO extract = (JAM intensityKO)/(calculated JAM intensityWIFB).

RESULTS

Hepatic Cells Express JAM and Its Binding Partners

We first determined the morphological and biochemical distributions of endogenous JAM and its many binding partners in mouse livers (Supplemental Fig. S1). JAM was predominantly expressed at TJs, as demonstrated by its colocalization with ZO-1, which appears as parallel tracks on the cytoplasmic side of the BC membranes of two adjacent cells. Of ZO-1's three PDZ domains, the second two have been shown to bind the COOH terminus of JAM (16). JAM did not colocalize with APN, which is in the apical membranes lining the BC of cells (Supplemental Fig. S1A). Two additional PDZ proteins, AF-6 and cingulin, bind to JAM and showed TJ patterns similar to that of JAM (Supplemental Fig. S1B). We also used biochemical analysis to demonstrate that JAM-A, cingulin, and members of the PAR/aPKC complex cofractionated on sucrose gradients with the TJ protein ZO-1 (Supplemental Fig. S1C). Together, our results are consistent with localization studies of these polarity proteins at the TJs of simple epithelial cells (49, 71).

We next determined the localizations of JAM and the PAR/aPKC complex proteins in WIF-B, a well-characterized polar hepatic cell line with TJ strands present in ZO-1-containing belts around an intercellular cyst that corresponds to the apical surface (13). The "tightness" of the TJ has been demonstrated by permeability of fluorescently labeled dextrans (25). We and others (D. Cassio, personal communication) have also determined that claudin 2 is the major claudin expressed in WIF-B cells and is found at the TJ belt (data not shown). An important feature of WIF-B cells is that they progress through two types of polarity as they mature in culture, a phenomenon that recapitulates liver development in vivo (19). After a proliferative phase, WIF-B cells exhibit a simple columnar epithelial morphology with TJ proteins forming a belt around the cell apex (Fig. 1A, left); later, groups of cells progressively (and somewhat synchronously) assume an hepatic phenotype in which TJ proteins form a circular belt around an apical cyst (Fig. 1A, right), which is equivalent to the BC of the liver. Localization studies at these two stages showed JAM and ZO-1 at the TJ in both the simple and hepatic phenotypes, with the circular TJ belt of mature WIF-B cells often appearing as a line in a single optical section (Fig. 1A). Analogous to endogenous JAM in rat liver PMs, JAM was found in the basolateral membrane of mature WIF-B cells. In contrast to in vivo findings, JAM was also in the apical membranes of WIF-B cells. We also determined that the polarity proteins known to use JAM as a membrane anchor, the partitioning-defective proteins PAR3 and PAR6 and aPKC-{zeta}, colocalized with ZO-1 in both early and mature WIF-B cells (Supplemental Fig. S2). Finally, of the three closely related JAM proteins, we detected mRNAs for JAM-A, -B, and -C in freshly isolated rat liver hepatocytes but only JAM-A in WIF-B cells (Fig. 1B). Thus our results indicated that WIF-B cells were a good surrogate for the study of JAM and its binding partners. Furthermore, our analysis was simplified, because only JAM-A was expressed in the cells.


Figure 1
View larger version (49K):
[in this window]
[in a new window]

  		Fig. 1. Junctional adhesion molecule (JAM)-A is expressed in cultured hepatic cells and localizes to the tight junction (TJ). A: WIF-B morphology and localization of JAM-A. WIF-B cells display simple polarity early in their development, then gradually acquire mature hepatic polarity. Early and mature WIF-B cells were fixed and stained with anti-ZO-1 (red) and anti-JAM (green) antibodies. The TJ (ZO-1) forms a belt at the cell apex in early cells and a circular belt around apical cysts in mature cells. JAM-A colocalized with ZO-1 at the TJ (arrows) at both stages and was also found in apical and basolateral membranes. Bar, 10 µm. B: JAM mRNA expression in hepatic cells. mRNA was isolated from freshly isolated rat hepatocytes (left) and mature WIF-B (center) and Fao (right) cells, and JAM family members were identified by RT-PCR using gene-specific primers.

 
Acute KD of JAM-A Leads to Dramatic Reduction of Hepatic Phenotype in WIF-B Cells

We chose an inhibitory RNA (RNAi) KD approach to test whether JAM-A is required for the development of hepatic polarity. WIF-B cells cannot be transfected with free short inhibitory RNA (siRNA) and lipophilic reagents (data not shown), so we generated lentiviruses encoding shRNAs that targeted two different sites on the rat JAM-A mRNA (KO1 and KO2; Fig. 2). Cells were infected with one of three viruses encoding GFP alone, KO1 + GFP, or KO2 + GFP. On postinfection day 13, when normal WIF-B cells typically exhibit the mature phenotype, cells expressing GFP alone showed normal levels of polarity (Fig. 2) and distribution of JAM-A (Supplemental Fig. S3B). In contrast, cells expressing the shRNAs + GFP showed reduced hepatic polarity (i.e., low numbers of cells with apical cysts; Fig. 2 and Supplemental Fig. S3A). Quantification confirmed this picture. That is, cells expressing shRNA KO1 or KO2 had relative polar fractions of ~0.25 and ~0.4, respectively (Fig. 2). To determine the JAM-A protein levels in the KD populations, we isolated the brightest GFP-expressing cells by FACS on postinfection day 8, replated them, and prepared extracts 7 days later (postinfection day 15). (We were unable to measure JAM-A proteins immediately after FACS sorting, because cells had been trypsinized and the ectodomain of JAM-A cleaved.) JAM-A levels were 0.5 (KO1) and 0.6 (KO2) compared with that in GFP-only cells. This result suggested that polarity development in WIF-B cells was sensitive to relatively modest downregulation of JAM-A (Fig. 2). Of the proteins examined, only the levels of β1-integrin showed a reduction by immunoblotting (Fig. 2). Localization of endogenous JAM-A in the KD cells (expressing GFP) revealed an overall reduction in intensity and a spectrum of expression/distributions from undetectable to variable patterns/intensities on the PM (Supplemental Fig. S3A). The apical membrane protein 5'-nucleotidase (5'NT) was distributed around the entire PM as well as in an intracellular site in the nonpolar JAM-A KD cells expressing GFP (Fig. 2 and Supplemental Fig. S3A). This pattern was similar to that described for nonpolar hepatic Fao cells (65).


Figure 2
View larger version (76K):
[in this window]
[in a new window]

  		Fig. 2. Acute knockdown (KD) of rat JAM-A in cultured hepatic cells. Top right: schematic of rat JAM-A transcript showing the 2 sites selected as short inhibitory RNA (siRNA) targets for KO1 and KO2. Left: merged images of postinfection day 13 cells that were grown on coverslips, fixed, and stained with anti-5'-nucleotidase (5'NT) antibody (red). Merged images show the distribution of the apical protein 5'NT in green fluorescent protein (GFP)-expressing cells. 5'NT is predominantly present at an intracellular location (open arrowhead) in KO1 cells, while it outlines apical cysts in GFP cells (filled arrowheads). See Supplemental Fig. S3 for separate green and red images. Bottom right: histogram of polar fraction (no. of cells polar/no. of expressing cells) in cell populations where GFP fluorescence intensity was >1,000 [no. of cells analyzed = 248 (GFP), 245 (KO1), and 401 (KO2)]. Immunoblots: at postinfection day 8, the brightest GFP cells (GFP = 9%, KO1 = 8%, and KO2 = 13%, respectively) were isolated by flow cytometry and cultured for 8 days, and cell extracts were analyzed by SDS-PAGE/immunoblot with the indicated antibodies (loading control = nuclear lamins A and C). Quantification of the JAM-A immunoblot is shown in the histogram.

 
Long-Term JAM-A KD Has Further Effects on WIF-B Cells

We next determined the long-term effects of JAM-A KD in KO1- and KO2-infected WIF-B cells. Random clones isolated from the brightest GFP-expressing cells were expanded and evaluated ~90 days after infection. The pooled KO1 clones had reduced JAM-A levels (33%) and polarity (40%), while the KO2 cells had near-normal levels of JAM and had regained polarity (data not shown). Upon further propagation of two KO1 clones, both polarity and JAM-A levels declined further (KO1#1 and KO1#3, Fig. 3). β1-Integrin levels also decreased significantly, but those of E-cadherin, an adherens junction (AJ) protein, did not (Fig. 3). Unfortunately, the low protein levels prevented quantification. Because the loss of hepatic polarity remained somewhat stable, we chose to use the KO1 population of KD cells for complementation studies.


Figure 3
View larger version (20K):
[in this window]
[in a new window]

  		Fig. 3. Long-term KD of JAM-A in cultured hepatic cells. Histogram shows polarity and relative JAM-A levels in pooled clones (N = 6) and polarity in clones 1 and 3 from KO1-infected cells. Polarity index = polar fraction of KO clone/polar fraction of uninfected WIF-B cells. Immunoblots of extracts prepared from WIF-B and the same KO1 clones were incubated with the indicated antibodies (loading control, nuclear lamins A and C).

 
Both JAM-A's PDZ-Binding Motif and T273 Are Required for Rescue of Hepatic Phenotype

It was important to determine whether expression of an RNAi-resistant JAM-A construct would restore hepatic polarity in WIF-B cells. To test for complementation, we generated recombinant adenoviruses expressing human wtJAM-A (huWT) and a mutant JAM-A lacking the last 4 amino acids (hu{Delta}C-term; Fig. 4A). Because the human JAM-A sequence differed in 8 of the 19 nucleotides in the rat KO1 target sequence, we were confident that the human protein would be expressed. KO1 clonal cells grown on coverslips for 7–8 days were infected, and their polarity was evaluated 3 days later with species-specific anti-JAM antibodies (Supplemental Fig. S4). The KO1 clonal cells expressing huWT showed a significantly higher hepatic polar fraction (i.e., a TJ around an intercellular apical surface, ~2-fold) than those expressing hu{Delta}C-term JAM-A (Fig. 4B). Importantly, hepatic polar cells showed positive staining of the TJ with human-specific anti-JAM-A (Fig. 4C). We also found that polar cells generally expressed lower levels of the exogenous huWT than nonpolar cells in the same population (see next section and Supplemental Fig. S5). These results suggest to us that the polar KD cells expressing human wtJAM-A at the TJ were able to form TJs as a consequence of direct participation by the exogenous human wt protein. Furthermore, these results provide strong evidence that endogenous rat JAM-A was our RNAi target, and that even the modest 50% KD of endogenous wtJAM-A significantly impaired the development of hepatic polarity in WIF-B cells.


Figure 4
View larger version (51K):
[in this window]
[in a new window]

  		Fig. 4. Complementation of JAM-A KD cells. A: schematic of human JAM-A (huWT) and alignment of its cytoplasmic tail. HuWT JAM-A has 2 extracellular Ig loops, a transmembrane domain, and a PDZ binding motif (PBM, SFLV). Amino acid alignment of JAM-A in 5 species is shown. Threonine 273 is conserved in JAM-A, -B, and -C (arrow; Ref. 37). Single amino acid substitutions in huWT were made: phenylalanine replaced tyrosine 280, and alanine replaced residues at 273, 281, and 296. B and C: KO1#1 and KO1#3 clonal cells grown on coverslips were infected with huWT-, hu{Delta}C-term-, and T273A-encoding adenoviruses on day 8 of culture and then fixed on day 11 and stained with antibodies to hu-JAM (F11R, green), ZO-1 (R20.76, red), and aminopeptidase N (APN; pseudocolored blue). Wide-field images (0.3-µm step) were captured and deconvolved with Volocity software. B: hepatic polarity was evaluated and the polar fractions in uninfected and infected cells determined. Histogram shows increased hepatic polarity with human huWT but not with either hu{Delta}C-term or T273A. Hepatic polarity = no. of hepatic polar cells/no. of JAM-A expressing cells normalized to the hepatic polar fraction in nonexpressing cells. C: extended focus image of 2 polarized cells (dotted outlines) expressing huWT-JAM-A (green). The cells share 1 circular TJ (arrows), as indicated by colocalization with ZO-1. The TJ encircles an apical cyst (blue).

 
Recently, the ability of JAM-C to restore polarity in a carcinoma cell line was shown to be dependent on serine 281 of the cytoplasmic tail (37). Phosphorylation of this residue was demonstrated in a previous study (15). To examine the role of phosphorylation as a mechanism for JAM-A function in the development of hepatic polarity, we aligned the cytoplasmic tails of JAM-A from multiple species and found several possible phosphorylation sites that were conserved (Fig. 4A). The analogous residue to S281, threonine 273 (T273), is conserved in all JAM-A species examined (Fig. 4A) and in JAM-B and -C (37). We substituted alanine for T273 in JAM-A and expressed the construct in the KD cells. As for JAM-C (37), the JAM-A mutation rendered the protein inactive, providing strong evidence that hepatic polarity is dependent on T273 (Fig. 4B).

Overexpression of Human wtJAM-A Inhibits WIF-B Cell Progression From Simple to Hepatic Phenotype: Role for Phosphorylation and PDZ-Binding Motif

Our complementation results prompted us to determine the consequences of overexpressing the exogenous JAM-A constructs in a normal WIF-B background. Recombinant adenovirus was applied to cells at day 8–9 after seeding, as the cells transitioned from the simple (before day 9) to hepatic phenotype (~days 12–14; Fig. 1). The cells were analyzed 3 days later. Unexpectedly, morphological analysis revealed that exogenous huWT JAM-A blocked the maturation of normal WIF-B cells. That is, a significant fraction of infected cells lacked TJ structures characteristic of the hepatic phenotype, as judged by localization of several TJ proteins (Fig. 5, A and B). It is important to note that polarity was evaluated relative to that found in uninfected cells on the same coverslip, providing a convincing control for our observation. In contrast, expression of either GFP or hu{Delta}C-term had no effect, since cells matured normally and exhibited robust hepatic phenotypes (Fig. 5A). Neither of the JAM-A constructs altered the expression levels of ZO-1 or E-cadherin (Supplemental Fig. S6A). By immunoblot analysis of JAM-A expression levels, we found approximately six- to eightfold more exogenous than endogenous protein (Supplemental Fig. S6B). Since ~20–30% of the cell populations were infected, this meant that individual cells expressed ~20-fold more exogenous than endogenous JAM-A. However, the hu{Delta}C-term had no deleterious effect, yet consistently gave higher expression levels than huWT (20- to 50-fold vs. 10- to 20-fold). Thus we are confident that the block in WIF-B maturation was related to JAM-A's activity (Supplemental Fig. S6B).


Figure 5
View larger version (26K):
[in this window]
[in a new window]

  		Fig. 5. Development of hepatic polarity is blocked by overexpression of huWT but not mutant JAM-A in normal WIF-B cells. On day 8 or 9 of culture, WIF-B cells grown on coverslips were infected with the indicated viruses. A: WIF-B cells fixed 3 or 4 days later and stained with anti-aPKC. Hepatic polarity was evaluated, and the polar fractions in uninfected and infected cells were determined. Uninfected cells on the same coverslip served as controls. Histogram shows that cells expressing huWT have a significantly reduced hepatic polarity index, while those expressing either GFP or hu{Delta}C-term do not. B: WIF-B cells treated as in A and stained with antibodies to the indicated TJ protein. Histogram shows that expression of huWT-JAM-A reduced polarity when evaluated with other TJ markers. aPKC, atypical protein kinase C. C: adenoviruses expressing human JAM-A with the indicated mutations were generated, used to infect WIF-B cells as in A, and then fixed and stained with anti-aPKC. Hepatic polarity was evaluated as above with uninfected cells on the same coverslip serving as controls. Histogram shows that each mutant protein behaves like huWT-JAM-A. D: adenovirus-expressing T273A human JAM-A was generated, used to infect WIF-B cells in parallel with huWT and hu{Delta}C-term, and then fixed as in A and stained with anti-ZO-1. Hepatic polarity was evaluated as above with uninfected cells on the same coverslip serving as controls. Histogram (average of 2 experiments) shows that expression of T273 inhibits hepatic polarity to a lesser extent than huWT. At least 100 infected cells were evaluated for each condition.

 
We again focused on the role of phosphorylation of JAM-A's cytoplasmic tail as a mechanism for normal WIF-B cell maturation. Three additional JAM-A mutant constructs were generated with changes to two serines (S281 and S296) and a tyrosine (Y280) (Fig. 4A). The sites were chosen based on different criteria. Tyrosine 280A was reported to affect JAM-A functions in another cell type (9, 10, 43). Because phosphorylation of the PDZ domains of stargazin (9) and AMPA receptor (10) were shown to regulate their interaction with PDZ proteins, we chose to mutate S296, whereas S281 was identified with a web-based search engine (NetPhos 1.0 at http://www.cbs.dtu.dk/services/NetPhosK/). Each of these mutants behaved like huWT, ruling out roles for their possible phosphorylation in TJ formation (Fig. 5C). In contrast, when T273A was expressed, the relative number of hepatic polar cells was intermediate to that of huWT and hu{Delta}C-term (Fig. 5D). Importantly, the level of the T273A protein was similar to that of the huWT protein in WIF-B cells (Supplemental Fig. S6C). Together, these results reveal a role for T273 in JAM-A's polarity function.

Next, we compared the distributions of exogenous huWT and hu{Delta}C-term JAM-A in infected WIF-B cells, since the two proteins had dramatically different effects on the development of hepatic polarity (see Fig. 5A). Approximately 24 h after infection, ≤10% of cells expressed detectable huWT, which was in intracellular vesicles and puncta at the cell-substrate interface (Supplemental Fig. S6). By ~48–72 h after infection, huWT was concentrated at cell-cell contacts (Fig. 6A, top row). The hu{Delta}C-term protein showed a similar distribution, suggesting that the PDZ-binding motif was not required for cell contact formation or retention (Fig. 6A, bottom row). This mutant protein was often found in the endoplasmic reticulum, as evidenced by its presence at the nuclear envelope, suggesting that it moved more slowly to the cell surface than huWT JAM-A. In contrast to the complementation studies described above, no exogenous JAM-A proteins were found at the TJs of polar overexpressing cells (Fig. 6A).


Figure 6
View larger version (69K):
[in this window]
[in a new window]

  		Fig. 6. Overexpressed wtJAM-A and {Delta}C-term are found at cell contact sites. A: WIF-B cells, infected as described in Fig. 5, were fixed and stained with antibodies to hu-JAM-A (F11R, green) and ZO-1 (red). Wide-field images were captured (0.3-µm step), and images were deconvolved with Volocity software. Image shows that ZO-1 and huWT overlap at contact sites (thick arrows). In cells overexpressing hu{Delta}C-term, ZO-1 is found in belts around apical cysts (asterisks). N, nucleus. Bar, 10 µm. B: histogram showing the extent of ZO-1 overlap in overexpressing cells (P = 0.001). Confocal images of cells expressing hu{Delta}C-term (n = 6) and huWT (n = 7) were captured from 2 experiments, and analysis was performed with Volocity version 3.0. C: WIF-B cells, infected as described in Fig. 5, were fixed and stained with species-specific antibodies for human and rodent JAM-A and mouse anti-F11R in green and goat anti-JAM (AF1077) in blue, respectively. Wide-field images captured as above show that endogenous rodent JAM-A is present with huWT and hu{Delta}C-term at contact sites (thick arrows) and in PM (double arrows). Bar, 10 µm.

 
The finding that both huWT and the hu{Delta}C-term mutant concentrated at cell contact sites but only huWT blocked maturation led us to examine the distributions of selected JAM-A binding partners in overexpressing cells. ZO-1 was found prominently with huWT at cell contacts, but to a much lesser extent in cells expressing the hu{Delta}C-term protein (Fig. 6A). Quantification showed that nearly fourfold more ZO-1 colocalized with huWT than with hu{Delta}C-term (Fig. 6B). Endogenous rat JAM-A was also present at some cell contact sites formed by each of the exogenous proteins, a finding that could account for the low levels of ZO-1 found with hu{Delta}C-term at the contacts (Fig. 6C). Since ZO-1 binds actin filaments directly, we expected enrichment of actin only with the full-length protein. Instead, we found actin at contact sites with both huWT and hu{Delta}C-term, indicating that its assembly there was likely independent of ZO-1 and JAM's PDZ-binding motif (Supplemental Fig. S7A). To further characterize the composition of JAM-A contact sites, we compared the distributions of other TJ and AJ proteins, and most were similar to that of ZO-1. That is, these proteins were found at contact sites in huWT-expressing but not hu{Delta}C-term-expressing cells (Table 1 and Supplemental Fig. S7). In contrast, aPKC was not found at contact sites with either JAM protein (Table 1 and Supplemental Fig. S7). Because recent studies indicated a role for the serine/threonine kinase PAR1b in the development of hepatic polarity (11), we coinfected WIF-B cells with either huWT or the hu{Delta}C-term and PAR1b adenoviruses. Surprisingly, exogenous PAR1b was found at contact sites in the hu{Delta}C-term- but not huWT JAM-A-expressing cells (Table 1 and Supplemental Fig. S7). Since a possible link between β1-integrin and JAM-A has been uncovered (35), we localized β1-integrin but did not find it at either the TJ or contact sites with any JAM protein (Supplemental Fig. S7), although exogenous JAM-A proteins were found with β1-integrin at cell-substrate sites (Supplemental Fig S6).


View this table:
[in this window]
[in a new window]

  		Table 1. Summary of protein localizations at contact sites in JAM-A-expressing cells

 
DISCUSSION

The results of this study demonstrate that full-length JAM-A is both essential and inhibitory to development of the fully polarized hepatic phenotype manifested by WIF-B cells. When endogenous rat JAM-A's expression was reduced below a critical level, cells did not form the characteristic apical cysts sealed by TJ belts containing JAM-A. Importantly, expression of the human full-length JAM-A rescued the hepatic phenotype in a significant number of KD cells, while mutation of a single residue (T273A) blocked JAM-A's ability to rescue hepatic polarity in the KD cells. This novel finding indicates that a single residue in the cytoplasmic tail of JAM-A is essential for hepatic polarity. In contrast, expression of huWT in normal WIF-B cells blocked their maturation from a simple to an hepatic phenotype and led to the accumulation of PDZ proteins at cell-cell contact sites containing huWT. Expression of hu{Delta}C-term JAM-A did not rescue the KD cells, inhibit the development of hepatic cell polarity, or lead to the accumulation of PDZ proteins at cell-cell contacts that contained the mutant protein. Our results imply that 1) JAM-A levels are tightly regulated, since either decreased or increased expression inhibited WIF-B maturation; 2) T273 is essential for JAM-A functions in polarity and may operate via phosphorylation; 3) the PDZ protein(s) that functionally interacts with JAM-A's COOH-terminal PDZ-binding motif also plays key role(s) in polarity; and 4) JAM-A is critical for the architectural remodeling that occurs as WIF-B cells mature from a simple to an hepatic phenotype. Finally, the combined results of several recent studies, including ours, demonstrate an important difference between the polarity of simple epithelia and that of hepatic cells: the former can exist in the absence of TJs, while hepatic polarity requires the coordinated establishment and maintenance of both TJs and the apical membrane domain.

Too Much or Too Little JAM-A Inhibits Establishment of Hepatic Polarity

KD studies. We observed a spectrum of JAM-A levels in the KD cells, from undetectable to amounts sufficient for regional (or clonal) apical cyst formation, suggesting that subtle changes in JAM expression dramatically alter the extent of hepatic polarity. Our KD results confirm and extend those of three recent reports on JAM-A. KD of JAM-A in filter-grown SK-CO15 cells resulted in its loss at TJs, decreased transepithelial resistance, and altered paracellular flux of fluorescent dextrans (35). Unfortunately, the status of the claudins and occludin was not examined in this study, so the possible contribution of JAM-A to TJ function could not be evaluated. Second, KD of JAM-A in MDCK cells seeded into a collagen gel resulted in disordered cysts (54), which lacked the apical lumens that are characteristic of this complex three-dimensional structure (50, 68). Third, KD of JAM-A in HepG2 cells caused a loss of hepatic polarity as indicated by a significant reduction of pseudocanaliculi (30). Interestingly, a new cell morphology was observed thatresembled simple epithelia and correlated with an increase in E-cadherin expression (see below and Ref. 30).

Complementation. We have shown that exogenous JAM-A can rescue hepatic polarity. When modest amounts of an RNAi-resistant wtJAM-A (huWT) were expressed in WIF-B KD cells, apical cysts with TJ belts formed and the latter had incorporated the exogenous protein. Furthermore, rescue was dependent on the presence of either T273 or JAM-A's PDZ-binding motif, since there was no increase in the number of polar cells when an RNAi-resistant JAM-A T273A or {Delta}C-term protein was expressed. This is the first demonstration that mutation of a putative phosphorylation site in JAM-A abolishes its function in epithelial polarity (see below).

Overexpression. We initially hypothesized that the maturation of WIF-B cells might be accelerated when JAM-A levels were increased in normal cells. Unexpectedly, huWT overexpression had a strong inhibitory effect on this conversion step, whereas overexpression of hu{Delta}C-term had none. Despite the high levels of exogenous protein, we assert that the PDZ-binding motif of wtJAM-A was directly responsible for this block, since expression of the hu{Delta}C-term protein, which was not inhibitory, was consistently greater than that of the full-length protein.

We also examined the behavior of four JAM-A constructs in which putative or known phosphorylation sites in the cytoplasmic tail were mutated. Our finding that expression of three mutants, one of which affected JAM-A function in another system (43), blocked WIF-B cell maturation to the same extent as huWT indicates that the mutated residues are not relevant to hepatic TJ formation. However, one construct, T273A, had an intermediate effect on normal TJ formation and hepatic polarity when expressed at comparable levels as huWT, pointing to the importance of a second region of JAM-A's cytoplasmic tail in the development of hepatic polarity.

JAM-A's Cytoplasmic PDZ-Binding Domain is Essential for Its Remodeling Function in WIF-B Cells

Our results clearly show that JAM-A's PDZ-binding motif is crucial for WIF-B cell maturation, since the hu{Delta}C-term protein is inactive in either promoting or inhibiting TJ and apical cyst formation. Multiple PDZ proteins have been shown to bind JAM-A, including ZO-1, PAR3, AF-6, MUPP1, and CASK (reviewed in Ref. 55). Several reasons lead us to suggest that ZO-1 and PAR3 are the most likely candidates to functionally interact with JAM-A in our system. First, ZO-1 is an early player for junction formation in epithelia (73), and JAM-A is not far behind (20). Second, PAR3 is a member of the PAR/aPKC complex (17, 26), which is required for establishing and maintaining TJs in epithelia, and JAM is the only known membrane anchor for it (reviewed in Refs. 49, 62). All members of this complex are expressed in hepatic cells, and they localize to the TJ in WIF-B cells. However, PAR3 was the only cytoplasmic member at the huWT-induced contact sites; aPKC was conspicuously absent. (Antibody limitations did not allow us to localize PAR6 in the overexpression studies.) Because PAR3 is an aPKC substrate (see below), its presence without aPKC at contact sites suggests that PAR3 was not phosphorylated and that recruitment of the remaining components of the PAR/aPKC complex was blocked. There is abundant evidence that aPKC is required for establishment of simple polarity (49, 51, and 62), and we have confirmed this by using pharmacological aPKC inhibitors, which blocked the maturation of WIF-B cells (unpublished results). Future studies overexpressing either wtPAR3 or a phospho-PAR3 mutant might reveal whether a balance between JAM and PAR3 levels is important for recruitment of the kinase and further development of hepatic polarity in WIF-B cells.

JAM-A Phosphorylation and Kinases Are Important for Epithelial Polarity

Our study of four possible phosphorylation sites in JAM-A demonstrate that only T273 is essential for the development of hepatic polarity. The corresponding site, S281, in JAM-C (37) has been shown to be phosphorylated when expressed in CHO cells (15) and important in the development of simple polarity in a murine lung carcinoma cell line (37). Identification of the relevant kinase is clearly an important goal for future studies.

The list of kinases linked to epithelial TJ assembly has grown in recent years. The use of specific inhibitors has implicated conventional PKC (cPKC) in regulating assembly of TJs (60). In fact, ZO-1 has been shown to be a cPKC substrate (60). Our own database search using the JAM-A cytoplasmic tail as a putative phosphorylation substrate revealed that cPKC may phosphorylate JAM-A at T273 (NetPhos 1.0) as well as other residues within KKGTSSKKV (aa270–278; see http://www.cbs.dtu.dk/services/Net/Phos/). Recently, a link has been uncovered between PKA signaling during TJ assembly and the small GTPase Rab13 (28, 29). Additionally, recent studies have revealed that two polarity proteins, PAR3 (42) and Lethal giant larva2 (51, 70), as well as the serine/threonine kinase PAR1b are substrates for aPKC (61). PAR1b clearly plays a role in the hepatic maturation process (11), since a kinase-deleted form was shown to inhibit WIF-B9 cell maturation, whereas overexpressed wtPAR1b drove formation of the hepatic phenotype in MDCK cells. Our database search using Predikin at http://predikin.biosci.uq.edu.au/pkr/ did not indicate that JAM-A was a substrate for PAR1b (N. Saunders, personal communication). Thus perhaps PAR1b acts indirectly through microtubules, which must be reorganized during the conversion from simple to hepatic polarity. Could their reorientation be driven by PAR1b, which was first shown to phosphorylate microtubule-associated proteins (reviewed in Ref. 14)?

What Does Simple -> Hepatic Maturation Require?

Two recent studies have documented that simple epithelia can exhibit polarity in the absence of a TJ (2, 66). First, activation of LKB1, designated a "master" kinase because it activated 13 kinases of the AMPK subfamily including PAR1 (32), results in complete polarization of individual intestinal cells (2). Second, knockout and KD of ZO-1 and ZO-2, respectively, in filter-grown epithelial cells resulted in the absence of TJs, but the cells were nonetheless polar (66). In contrast, we found that changes in JAM-A levels affected formation of both TJs and the apical domain in WIF-B cells, leading us to suggest that the two structures are coordinately regulated in hepatic cells.

What steps must occur during the transition from a simple to an hepatic polarized phenotype? They could include selection of a site for the new apical surface and TJ to form; regulated recruitment to that site of relevant players [e.g., structural (E-cadherin) and enzymatic (kinases/phosphatases)]; remodeling of AJ and the cytoskeleton; as well as dynamic membrane protein and lipid sorting, targeting, and recycling. Could the JAM-A-induced contacts seen in our study represent a selection site? The location of the contacts between adjacent cells is consistent with this hypothesis, as is the presence of endogenous occludin, ZO-1, and PAR3 proteins found with JAM in other cell types (16, 17, 47). However, others have proposed that E-cadherin may function as a targeting patch for development of the hepatic phenotype (12). Unfortunately, JAM was not examined in this study. Could JAM-A and E-cadherin work together?

Surprisingly, depletion of E-cadherin did not disrupt simple polarity in MDCK cells (7, 53). In agreement with this finding, clonal HepG2 cells lacking AJs nonetheless formed intercellular pseudocanaliculi with TJs (i.e., hepatic polarity) in the absence of E-cadherin and β-catenin at the cell surface. The abundance of pseudocanaliculi was reduced relative to cells expressing normal levels of E-cadherin, indicating that AJs are important but not essential for functional apical surface and TJ formation (64). E-cadherin depletion also led to a reduced number of intercellular lumina (i.e., hepatic polarity) formed in PAR1b-overexpressing MDCK cells. In contrast, a reciprocal link between E-cadherin levels and hepatic polarity was identified in response to JAM-A depletion (30). That is, high levels of E-cadherin transcripts and protein correlated with a loss of pseudocanaliculi (30). In our study, we found no change in E-cadherin levels when JAM-A was either knocked down or overexpressed. The two responses to loss of JAM-A may reflect inherent differences between the two cell lines.

In addition to playing an essential role in the maintenance of the apical domain in hepatocytes (6), the actin-based cytoskeleton must also be remodeled during the maturation process. Thus actin's presence at JAM-A-induced cell contacts is consistent with them being future sites of the new apical surface and TJ. However, we did not find apical membrane proteins at the contact sites (data not shown), leading us to suggest that the actin-based retention mechanisms proposed for apical membrane proteins in hepatic cells were not established (65).

Recent studies investigating the mechanisms of apical (BC) membrane biogenesis have identified additional components essential to the hepatic phenotype (67, 69). They also support our hypothesis that formation and maintenance of the apical domain and TJs are linked. First, KD of the small GTPase Rab11a in WIF-B9 cells resulted in loss of the hepatic apical surface and corresponding appearance of the simple phenotype as monitored by ZO-1 distribution (67). Second, KD of radixin, an ERM (ezrin, radixin, and moesin) family member expressed in liver and implicated in linking PM proteins to the actin cytoskeleton, also resulted in loss of the apical surface in primary hepatocytes cultured in collagen gels (69). The intracellular appearance of apical membrane proteins in Rab11-containing vesicles in the radixin KD cells was similar to that of our JAM-A KD phenotype, implying that TJs were lost, although TJ status was not investigated. Nevertheless, these results together with ours suggest that dynamic vesicle trafficking and cytoplasmic retention mechanisms are necessary to maintain a hepatic apical surface with encircling TJs.

Concluding Remarks

The results of our study confirm and extend the utility of WIF-B cells for studies of hepatocyte polarity. The insights gained by using an in vitro cell system that expresses only one JAM isoform can guide studies of liver development in vivo, where the lack of liver phenotypes in any of the three JAM knockout mice points to overlapping functions for the protein (8, 21, 56). Future studies using the KD cells to express different JAM isoforms and mutant constructs should also provide further understanding of this protein's role in the complex polarity of hepatic cells.

GRANTS

This research was supported by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-063096 (A. L. Hubbard), DK-076362, and DK-64388 (M. Donowitz).

ACKNOWLEDGMENTS

We thank S. Ohno and T. Yamanaka for PAR6 antibody, S. Citi for cingulin antibody, K. Ebnet for AF-6 antibody, A. Muesch for PAR1b adenovirus, N. Saunders (School of Molecular and Microbial Sciences, University of Queensland) for helpful discussions regarding phosphorylation predictions, and Ya-Hui Chen for technical assistance.

FOOTNOTES


Address for reprint requests and other correspondence: Lelita T. Braiterman, Dept. of Cell Biology, Johns Hopkins Univ. School of Medicine, 725 N. Wolfe St., Baltimore, MD 21205 (e-mail: lbraite1{at}jhmi.edu)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 The online version of this article contains supplemental material. Back

REFERENCES

  1. Aurrand-Lions M, Johnson-Leger C, Wong C, Du Pasquier L, Imhof BA. Heterogeneity of endothelial junctions is reflected by differential expression and specific subcellular localization of the three JAM family members. Blood 98: 3699–3707, 2001.[Abstract/Free Full Text]
  2. Baas AF, Kuipers J, van der Wel NN, Batlle E, Koerten HK, Peters PJ, Clevers HC. Complete polarization of single intestinal epithelial cells upon activation of LKB1 by STRAD. Cell 116: 457–466, 2004.[CrossRef][Web of Science][Medline]
  3. Bartles JR, Braiterman LT, Hubbard AL. Endogenous and exogenous domain markers of the rat hepatocyte plasma membrane. J Cell Biol 100: 1126–1138, 1985.[Abstract/Free Full Text]
  4. Bender V, Bravo P, Decaens C, Cassio D. The structural and functional polarity of the hepatic human/rat hybrid WIF-B is a stable and dominant trait. Hepatology 30: 1002–1010, 1999.[CrossRef][Medline]
  5. Bilder D, Li M, Perrimon N. Cooperative regulation of cell polarity and growth by Drosophila tumor suppressors. Science 289: 113–116, 2000.[Abstract/Free Full Text]
  6. Bretscher A, Edwards K, Fehon RG. ERM proteins and merlin: integrators at the cell cortex. Nat Rev Mol Cell Biol 3: 586–599, 2002.[CrossRef][Web of Science][Medline]
  7. Capaldo CT, Macara IG. Depletion of E-cadherin disrupts establishment but not maintenance of cell junctions in Madin-Darby canine kidney epithelial cells. Mol Biol Cell 18: 189–200, 2007.[Abstract/Free Full Text]
  8. Cera MR, Del Prete A, Vecchi A, Corada M, Martin-Padura I, Motoike T, Tonetti P, Bazzoni G, Vermi W, Gentili F, Bernasconi S, Sato TN, Mantovani A, Dejana E. Increased DC trafficking to lymph nodes and contact hypersensitivity in junctional adhesion molecule-A-deficient mice. J Clin Invest 114: 729–738, 2004.[CrossRef][Web of Science][Medline]
  9. Chetkovich DM, Chen L, Stocker TJ, Nicoll RA, Bredt DS. Phosphorylation of the postsynaptic density-95 (PSD-95)/discs large/zona occludens-1 binding site of stargazin regulates binding to PSD-95 and synaptic targeting of AMPA receptors. J Neurosci 22: 5791–5796, 2002.[Abstract/Free Full Text]
  10. Chung HJ, Xia J, Scannevin RH, Zhang X, Huganir RL. Phosphorylation of the AMPA receptor subunit GluR2 differentially regulates its interaction with PDZ domain-containing proteins. J Neurosci 20: 7258–7267, 2000.[Abstract/Free Full Text]
  11. Cohen D, Rodriguez-Boulan E, Musch A. Par-1 promotes a hepatic mode of apical protein trafficking in MDCK cells. Proc Natl Acad Sci USA 101: 13792–13797, 2004.[Abstract/Free Full Text]
  12. Cohen D, Tian Y, Musch A. Par1b promotes hepatic-type lumen polarity in Madin Darby canine kidney cells via myosin II- and E-cadherin-dependent signaling. Mol Biol Cell 18: 2203–2215, 2007.[Abstract/Free Full Text]
  13. Decaens C, Rodriguez P, Bouchaud C, Cassio D. Establishment of hepatic cell polarity in the rat hepatoma-human fibroblast hybrid WIF-B9. A biphasic phenomenon going from a simple epithelial polarized phenotype to an hepatic polarized one. J Cell Sci 109: 1623–1635, 1996.[Abstract]
  14. Drewes G. MARKing tau for tangles and toxicity. Trends Biochem Sci 29: 548–555, 2004.[CrossRef][Web of Science][Medline]
  15. Ebnet K, Aurrand-Lions M, Kuhn A, Kiefer F, Butz S, Zander K, Meyer zu Brickwedde MK, Suzuki A, Imhof BA, Vestweber D. The junctional adhesion molecule (JAM) family members JAM-2 and JAM-3 associate with the cell polarity protein PAR-3: a possible role for JAMs in endothelial cell polarity. J Cell Sci 116: 3879–3891, 2003.[Abstract/Free Full Text]
  16. Ebnet K, Schulz CU, Meyer Zu Brickwedde MK, Pendl GG, Vestweber D. Junctional adhesion molecule interacts with the PDZ domain-containing proteins AF-6 and ZO-1. J Biol Chem 275: 27979–27988, 2000.[Abstract/Free Full Text]
  17. Ebnet K, Suzuki A, Horikoshi Y, Hirose T, Meyer Zu Brickwedde MK, Ohno S, Vestweber D. The cell polarity protein ASIP/PAR-3 directly associates with junctional adhesion molecule (JAM). EMBO J 20: 3738–3748, 2001.[CrossRef][Web of Science][Medline]
  18. Ebnet K, Suzuki A, Ohno S, Vestweber D. Junctional adhesion molecules (JAMs): more molecules with dual functions? J Cell Sci 117: 19–29, 2004.[Abstract/Free Full Text]
  19. Feracci H, Connolly TP, Margolis RN, Hubbard AL. The establishment of hepatocyte cell surface polarity during fetal liver development. Dev Biol 123: 73–84, 1987.[CrossRef][Medline]
  20. Fukuhara A, Irie K, Nakanishi H, Takekuni K, Kawakatsu T, Ikeda W, Yamada A, Katata T, Honda T, Sato T, Shimizu K, Ozaki H, Horiuchi H, Kita T, Takai Y. Involvement of nectin in the localization of junctional adhesion molecule at tight junctions. Oncogene 21: 7642–7655, 2002.[CrossRef][Web of Science][Medline]
  21. Gliki G, Ebnet K, Aurrand-Lions M, Imhof BA, Adams RH. Spermatid differentiation requires the assembly of a cell polarity complex downstream of junctional adhesion molecule-C. Nature 431: 320–324, 2004.[CrossRef][Medline]
  22. Hardy S, Kitamura M, Harris-Stansil T, Dai Y, Phipps ML. Construction of adenovirus vectors through Cre-lox recombination. J Virol 71: 1842–1849, 1997.[Abstract]
  23. Hubbard AL, Ma A. Isolation of rat hepatocyte plasma membranes. II. Identification of membrane-associated cytoskeletal proteins. J Cell Biol 96: 230–239, 1983.[Abstract/Free Full Text]
  24. Ihrke G, Martin GV, Shanks MR, Schrader M, Schroer TA, Hubbard AL. Apical plasma membrane proteins and endolyn-78 travel through a subapical compartment in polarized WIF-B hepatocytes. J Cell Biol 141: 115–133, 1998.[Abstract/Free Full Text]
  25. Ihrke G, Neufeld EB, Meads T, Shanks MR, Cassio D, Laurent M, Schroer TA, Pagano RE, Hubbard AL. WIF-B cells: an in vitro model for studies of hepatocyte polarity. J Cell Biol 123: 1761–1775, 1993.[Abstract/Free Full Text]
  26. Itoh M, Sasaki H, Furuse M, Ozaki H, Kita T, Tsukita S. Junctional adhesion molecule (JAM) binds to PAR-3: a possible mechanism for the recruitment of PAR-3 to tight junctions. J Cell Biol 154: 491–497, 2001.[Abstract/Free Full Text]
  27. Kallay LM, McNickle A, Brennwald PJ, Hubbard AL, Braiterman LT. Scribble associates with two polarity proteins, Lgl2 and Vangl2, via distinct molecular domains. J Cell Biochem 99: 647–664, 2006.[CrossRef][Medline]
  28. Kohler K, Louvard D, Zahraoui A. Rab13 regulates PKA signaling during tight junction assembly. J Cell Biol 165: 175–180, 2004.[Abstract/Free Full Text]
  29. Kohler K, Zahraoui A. Tight junction: a co-ordinator of cell signalling and membrane trafficking. Biol Cell 97: 659–665, 2005.[CrossRef][Web of Science][Medline]
  30. Konopka G, Tekiela J, Iverson M, Wells C, Duncan SA. Junctional adhesion molecule-A is critical for the formation of pseudocanaliculi and modulates E-cadherin expression in hepatic cells. J Biol Chem 282: 28137–28148, 2007.[Abstract/Free Full Text]
  31. Liang TW, DeMarco RA, Mrsny RJ, Gurney A, Gray A, Hooley J, Aaron HL, Huang A, Klassen T, Tumas DB, Fong S. Characterization of huJAM: evidence for involvement in cell-cell contact and tight junction regulation. Am J Physiol Cell Physiol 279: C1733–C1743, 2000.[Abstract/Free Full Text]
  32. Lizcano JM, Goransson O, Toth R, Deak M, Morrice NA, Boudeau J, Hawley SA, Udd L, Makela TP, Hardie DG, Alessi DR. LKB1 is a master kinase that activates 13 kinases of the AMPK subfamily, including MARK/PAR-1. EMBO J 23: 833–843, 2004.[CrossRef][Web of Science][Medline]
  33. Lois C, Hong EJ, Pease S, Brown EJ, Baltimore D. Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors. Science 295: 868–872, 2002.[Abstract/Free Full Text]
  34. Luzzatto AC. Hepatocyte differentiation during early fetal development in the rat. Cell Tissue Res 215: 133–142, 1981.[Medline]
  35. Mandell KJ, Babbin BA, Nusrat A, Parkos CA. Junctional adhesion molecule 1 regulates epithelial cell morphology through effects on beta1 integrins and Rap1 activity. J Biol Chem 280: 11665–11674, 2005.[Abstract/Free Full Text]
  36. Mandell KJ, Parkos CA. The JAM family of proteins. Adv Drug Delivery Res 57: 857–867, 2005.[CrossRef][Web of Science][Medline]
  37. Mandicourt G, Iden S, Ebnet K, Aurrand-Lions M, Imhof BA. JAM-C regulates tight junctions and integrin-mediated cell adhesion and migration. J Biol Chem 282: 1830–1837, 2007.[Abstract/Free Full Text]
  38. Martin-Padura I, Lostaglio S, Schneemann M, Williams L, Romano M, Fruscella P, Panzeri C, Stoppacciaro A, Ruco L, Villa A, Simmons D, Dejana E. Junctional adhesion molecule, a novel member of the immunoglobulin superfamily that distributes at intercellular junctions and modulates monocyte transmigration. J Cell Biol 142: 117–127, 1998.[Abstract/Free Full Text]
  39. McLean IW, Nakane PK. Periodate-lysine-paraformaldehyde fixative. A new fixation for immunoelectron microscopy. J Histochem Cytochem 22: 1077–1083, 1974.[Abstract]
  40. Mevel-Ninio M, Weiss MC. Immunofluorescence analysis of the time-course of extinction, reexpression, and activation of albumin production in rat hepatoma-mouse fibroblast heterokaryons and hybrids. J Cell Biol 90: 339–350, 1981.[Abstract/Free Full Text]
  41. Miyoshi H, Blomer U, Takahashi M, Gage FH, Verma IM. Development of a self-inactivating lentivirus vector. J Virol 72: 8150–8157, 1998.[Abstract/Free Full Text]
  42. Nagai-Tamai Y, Mizuno K, Hirose T, Suzuki A, Ohno S. Regulated protein-protein interaction between aPKC and PAR-3 plays an essential role in the polarization of epithelial cells. Genes Cells 7: 1161–1171, 2002.[Abstract]
  43. Naik MU, Mousa SA, Parkos CA, Naik UP. Signaling through JAM-1 and alphavbeta3 is required for the angiogenic action of bFGF: dissociation of the JAM-1 and alphavbeta3 complex. Blood 102: 2108–2114, 2003.[Abstract/Free Full Text]
  44. Naik MU, Vuppalanchi D, Naik UP. Essential role of junctional adhesion molecule-1 in basic fibroblast growth factor-induced endothelial cell migration. Arterioscler Thromb Vasc Biol 23: 2165–2171, 2003.[Abstract/Free Full Text]
  45. Naik UP, Eckfeld K. Junctional adhesion molecule 1 (JAM-1). J Biol Regul Homeost Agents 17: 341–347, 2003.[Medline]
  46. Naik UP, Ehrlich YH, Kornecki E. Mechanisms of platelet activation by a stimulatory antibody: cross-linking of a novel platelet receptor for monoclonal antibody F11 with the Fc gamma RII receptor. Biochem J 310: 155–162, 1995.[Web of Science][Medline]
  47. Naik UP, Naik MU, Eckfeld K, Martin-DeLeon P, Spychala J. Characterization and chromosomal localization of JAM-1, a platelet receptor for a stimulatory monoclonal antibody. J Cell Sci 114: 539–547, 2001.[Abstract]
  48. Nyasae L, Bustos R, Braiterman L, Eipper B, Hubbard A. Dynamics of endogenous ATP7A (Menkes protein) in intestinal epithelial cells: copper-dependent redistribution between two intracellular sites. Am J Physiol Gastrointest Liver Physiol 292: G1181–G1194, 2007.[Abstract/Free Full Text]
  49. Ohno S. Intercellular junctions and cellular polarity: the PAR-aPKC complex, a conserved core cassette playing fundamental roles in cell polarity. Curr Opin Cell Biol 13: 641–648, 2001.[CrossRef][Web of Science][Medline]
  50. Ojakian GK, Schwimmer R. Regulation of epithelial cell surface polarity reversal by beta 1 integrins. J Cell Sci 107: 561–576, 1994.[Abstract]
  51. Plant PJ, Fawcett JP, Lin DC, Holdorf AD, Binns K, Kulkarni S, Pawson T. A polarity complex of mPar-6 and atypical PKC binds, phosphorylates and regulates mammalian Lgl. Nat Cell Biol 5: 301–308, 2003.[CrossRef][Web of Science][Medline]
  52. Qin XF, An DS, Chen IS, Baltimore D. Inhibiting HIV-1 infection in human T cells by lentiviral-mediated delivery of small interfering RNA against CCR5. Proc Natl Acad Sci USA 100: 183–188, 2003.[Abstract/Free Full Text]
  53. Qin Y, Capaldo C, Gumbiner BM, Macara IG. The mammalian Scribble polarity protein regulates epithelial cell adhesion and migration through E-cadherin. J Cell Biol 171: 1061–1071, 2005.[Abstract/Free Full Text]
  54. Rehder D, Iden S, Nasdala I, Wegener J, Brickwedde MK, Vestweber D, Ebnet K. Junctional adhesion molecule-A participates in the formation of apico-basal polarity through different domains. Exp Cell Res 312: 3389–3403, 2006.[CrossRef][Web of Science][Medline]
  55. Roh MH, Margolis B. Composition and function of PDZ protein complexes during cell polarization. Am J Physiol Renal Physiol 285: F377–F387, 2003.[Abstract/Free Full Text]
  56. Sakaguchi T, Nishimoto M, Miyagi S, Iwama A, Morita Y, Iwamori N, Nakauchi H, Kiyonari H, Muramatsu M, Okuda A. Putative "stemness" gene jam-B is not required for maintenance of stem cell state in embryonic, neural, or hematopoietic stem cells. Mol Cell Biol 26: 6557–6570, 2006.[Abstract/Free Full Text]
  57. Sena-Esteves M, Tebbets JC, Steffens S, Crombleholme T, Flake AW. Optimized large-scale production of high titer lentivirus vector pseudotypes. J Virol Methods 122: 131–139, 2004.[CrossRef][Web of Science][Medline]
  58. Shanks MR, Cassio D, Lecoq O, Hubbard AL. An improved polarized rat hepatoma hybrid cell line. Generation and comparison with its hepatoma relatives and hepatocytes in vivo. J Cell Sci 107: 813–825, 1994.[Abstract]
  59. Shin K, Fogg VC, Margolis B. Tight junctions and cell polarity. Annu Rev Cell Dev Biol 22: 207–235, 2006.[CrossRef][Web of Science][Medline]
  60. Stuart RO, Nigam SK. Regulated assembly of tight junctions by protein kinase C. Proc Natl Acad Sci USA 92: 6072–6076, 1995.[Abstract/Free Full Text]
  61. Suzuki A, Hirata M, Kamimura K, Maniwa R, Yamanaka T, Mizuno K, Kishikawa M, Hirose H, Amano Y, Izumi N, Miwa Y, Ohno S. aPKC acts upstream of PAR-1b in both the establishment and maintenance of mammalian epithelial polarity. Curr Biol 14: 1425–1435, 2004.[CrossRef][Web of Science][Medline]
  62. Suzuki A, Ohno S. The PAR-aPKC system: lessons in polarity. J Cell Sci 119: 979–987, 2006.[Abstract/Free Full Text]
  63. Suzuki A, Yamanaka T, Hirose T, Manabe N, Mizuno K, Shimizu M, Akimoto K, Izumi Y, Ohnishi T, Ohno S. Atypical protein kinase C is involved in the evolutionarily conserved par protein complex and plays a critical role in establishing epithelia-specific junctional structures. J Cell Biol 152: 1183–1196, 2001.[Abstract/Free Full Text]
  64. Theard D, Steiner M, Kalicharan D, Hoekstra D, van Ijzendoorn SC. Cell polarity development and protein trafficking in hepatocytes lacking E-cadherin/beta-catenin-based adherens junctions. Mol Biol Cell 18: 2313–2321, 2007.[Abstract/Free Full Text]
  65. Tuma PL, Nyasae LK, Hubbard AL. Nonpolarized cells selectively sort apical proteins from cell surface to a novel compartment, but lack apical retention mechanisms. Mol Biol Cell 13: 3400–3415, 2002.[Abstract/Free Full Text]
  66. Umeda K, Ikenouchi J, Katahira-Tayama S, Furuse K, Sasaki H, Nakayama M, Matsui T, Tsukita S, Furuse M, Tsukita S. ZO-1 and ZO-2 independently determine where claudins are polymerized in tight-junction strand formation. Cell 126: 741–754, 2006.[CrossRef][Web of Science][Medline]
  67. Wakabayashi Y, Dutt P, Lippincott-Schwartz J, Arias IM. Rab11a and myosin Vb are required for bile canalicular formation in WIF-B9 cells. Proc Natl Acad Sci USA 102: 15087–15092, 2005.[Abstract/Free Full Text]
  68. Wang AZ, Wang JC, Ojakian GK, Nelson WJ. Determinants of apical membrane formation and distribution in multicellular epithelial MDCK cysts. Am J Physiol Cell Physiol 267: C473–C481, 1994.[Abstract/Free Full Text]
  69. Wang W, Soroka CJ, Mennone A, Rahner C, Harry K, Pypaert M, Boyer JL. Radixin is required to maintain apical canalicular membrane structure and function in rat hepatocytes. Gastroenterology 131: 878–884, 2006.[Medline]
  70. Yamanaka T, Horikoshi Y, Sugiyama Y, Ishiyama C, Suzuki A, Hirose T, Iwamatsu A, Shinohara A, Ohno S. Mammalian Lgl forms a protein complex with PAR-6 and aPKC independently of PAR-3 to regulate epithelial cell polarity. Curr Biol 13: 734–743, 2003.[CrossRef][Web of Science][Medline]
  71. Yamanaka T, Horikoshi Y, Suzuki A, Sugiyama Y, Kitamura K, Maniwa R, Nagai Y, Yamashita A, Hirose T, Ishikawa H, Ohno S. PAR-6 regulates aPKC activity in a novel way and mediates cell-cell contact-induced formation of the epithelial junctional complex. Genes Cells 6: 721–731, 2001.[Abstract]
  72. Yeaman C, Grindstaff KK, Nelson WJ. New perspectives on mechanisms involved in generating epithelial cell polarity. Physiol Rev 79: 73–98, 1999.[Abstract/Free Full Text]
  73. Yokoyama S, Tachibana K, Nakanishi H, Yamamoto Y, Irie K, Mandai K, Nagafuchi A, Monden M, Takai Y. Alpha-catenin-independent recruitment of ZO-1 to nectin-based cell-cell adhesion sites through afadin. Mol Biol Cell 12: 1595–1609, 2001.[Abstract/Free Full Text]
  74. Zaret KS. Regulatory phases of early liver development: paradigms of organogenesis. Nat Rev Genet 3: 499–512, 2002.[CrossRef][Web of Science][Medline]
  75. Zufferey R, Dull T, Mandel RJ, Bukovsky A, Quiroz D, Naldini L, Trono D. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol 72: 9873–9880, 1998.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Virol.Home page
C. J. Mee, H. J. Harris, M. J. Farquhar, G. Wilson, G. Reynolds, C. Davis, S. C. D. van IJzendoorn, P. Balfe, and J. A. McKeating
Polarization Restricts Hepatitis C Virus Entry into HepG2 Hepatoma Cells
J. Virol., June 15, 2009; 83(12): 6211 - 6221.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figures
Right arrow All Versions of this Article:
294/2/G576    most recent
00159.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Braiterman, L. T.
Right arrow Articles by Hubbard, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Braiterman, L. T.
Right arrow Articles by Hubbard, A. L.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.