AJP - GI Journal of Applied Physiology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Am J Physiol Gastrointest Liver Physiol 294: G669-G678, 2008. First published January 10, 2008; doi:10.1152/ajpgi.00382.2007
0193-1857/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/3/G669    most recent
00382.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lewis, K.
Right arrow Articles by McKay, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lewis, K.
Right arrow Articles by McKay, D. M.

INFLAMMATION/IMMUNITY/MEDIATORS

Decreased epithelial barrier function evoked by exposure to metabolic stress and nonpathogenic E. coli is enhanced by TNF-{alpha}

Kimberley Lewis,2 Jackie Caldwell,1 Van Phan,1 David Prescott,1 Aisha Nazli,2 Arthur Wang,1 Johan D. Soderhölm,3 Mary H. Perdue,2 Philip M. Sherman,4 and Derek M. McKay1

1Gastrointestinal Research Group, Department of Physiology and Biophysics, University of Calgary, Calgary, Alberta, Canada; 2Intestinal Disease Research Programme, McMaster University, Hamilton, Ontario, Canada; 3Department of Surgery, University Hospital Linköping, Sweden; 4Division of Gastroenterology, Hepatology and Nutrition, Hospital for Sick Children, University of Toronto, Toronto, Ontario, Canada

Submitted 16 August 2007 ; accepted in final form 4 January 2008


   ABSTRACT
TOP
 ABSTRACT
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
A defect in mitochondrial activity contributes to many diseases. We have shown that monolayers of the human colonic T84 epithelial cell line exposed to dinitrophenol (DNP, uncouples oxidative phosphorylation) and nonpathogenic Escherichia coli (E. coli) (strain HB101) display decreased barrier function. Here the impact of DNP on macrophage activity and the effect of TNF-{alpha}, DNP, and E. coli on epithelial permeability were assessed. DNP treatment of the human THP-1 macrophage cell line resulted in reduced ATP synthesis, and, although hyporesponsive to LPS, the metabolically stressed macrophages produced IL-1β, IL-6, and TNF-{alpha}. Given the role of TNF-{alpha} in inflammatory bowel disease (IBD) and the association between increased permeability and IBD, recombinant TNF-{alpha} (10 ng/ml) was added to the DNP (0.1 mM) + E. coli (106 colony-forming units), and this resulted in a significantly greater loss of T84 epithelial barrier function than that elicited by DNP + E. coli. This increased epithelial permeability was not due to epithelial death, and the enhanced E. coli translocation was reduced by pharmacological inhibitors of NF-{kappa}β signaling (pyrrolidine dithiocarbamate, NF-{kappa}β essential modifier-binding peptide, BAY 11–7082, and the proteosome inhibitor, MG132). In contrast, the drop in transepithelial electrical resistance was unaffected by the inhibitors of NF-{kappa}β. Thus, as an integrative model system, our findings support the induction of a positive feedback loop that can severely impair epithelial barrier function and, as such, could contribute to existing inflammation or trigger relapses in IBD. Thus metabolically stressed epithelia display increased permeability in the presence of viable nonpathogenic E. coli that is exaggerated by TNF-{alpha} released by activated immune cells, such as macrophages, that retain this ability even if they themselves are experiencing a degree of metabolic stress.

permeability; bacterial translocation; NF{kappa}B; T84 cells; macrophages

A NUMBER OF PUTATIVE CAUSATIVE agents/mechanisms have been proposed for the inflammatory bowel diseases (IBDs): genetic predisposition, infection, dysregulated immune reactions, triggers from the commensal flora, and a defect in epithelial permeability (44). Abnormal mitochondria have been observed in epithelial cells in tissues resected from patients with Crohn's disease (28), indicating metabolic stress (i.e., ATP depletion) in these individuals. Similarly, reductions in mitochondria acetoacetyl CoA thiolase have been shown in the epithelium of patients with ulcerative colitis, which would result in reduced ATP synthesis from butyrate, and hence these cells would experience a degree of metabolic stress (36). Metabolic stress can arise as a consequence of infection, ischemia, and inflammation itself (8, 14). Thus we hypothesized that metabolic stress would impinge upon the normal interaction between enterocytes and the commensal flora, resulting in an increase in epithelial permeability that could predispose individuals to gut dysfunction and mucosal inflammation. Support for this hypothesis comes from analyses of kidney-derived epithelia showing that ATP depletion affects the arrangement of tight junction proteins with a consequent increase in paracellular permeability (2, 5). Our analyses revealed that uncoupling oxidative phosphorylation (i.e., inducing metabolic stress) in epithelial monolayers by treatment with dinitrophenol (DNP) in the presence of viable, noninvasive, nonpathogenic Escherichia coli (E. coli) (strain HB101) resulted in increased paracellular and transcellular permeability (27, 28).

With the emergence of the concept of immunophysiology, it is clear that the function of the intestinal epithelium is affected by many immune cell types (30). The macrophage produces a plethora of messengers, including tumor necrosis factor (TNF)-{alpha}. Resident intestinal macrophages have reduced expression of CD14 (the LPS coreceptor) (40) and tend to be less susceptible to activation by bacterial products (41). In contrast, monocytes are sensitive to bacterial products, and it has been postulated that it is monocytes recruited into tissues that are responsible for local pathology (36, 37). For instance, the permeability characteristics of T84 epithelial cell monolayers are unaffected by coculture with LPS-activated lamina propria mononuclear cells (LPMC) isolated from normal human intestine, whereas LPMC from patients with Crohn's disease and monocytes from healthy individuals and patients with Crohn's disease evoke significant increases in epithelial permeability (50). This loss of epithelial integrity was inhibited by neutralizing antibodies to TNF-{alpha}. Although TNF-{alpha} can directly increase paracellular permeability across selected renal and enteric epithelial cell lines (25, 38), by itself TNF-{alpha} has minimal direct effects on the barrier properties of T84 cell monolayers (4, 23), indicating that TNF-{alpha} was either activating LPMC and/or working in concert with other mediators released from the LPMC to increase the permeability to T84 cell monolayers (50).

On the basis of these findings, the present study addresses two questions: would macrophages under metabolic stress retain an ability to respond to LPS and produce cytokines; and, would the addition of TNF-{alpha} enhance the increase in epithelial barrier permeability caused by DNP + E. coli? The data support a positive feedback-loop hypothesis, in which metabolic stress allows the increased passage of bacteria across the epithelium to activate immune cells, including macrophages, which may also be metabolically stressed, but retains an ability to produce TNF-{alpha}. The TNF-{alpha} then exerts an additive effect with DNP + bacteria, further diminishing epithelial barrier function that can contribute to the initiation of inflammatory disease or exaggerate ongoing disease.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 
Cell Culture and Reagents

Monocytes. The human monocytic cell line, THP-1 (American Type Culture Collection, Manassas, VA), was maintained in suspension culture in RPMI-1640 medium supplemented with 2% (vol/vol) penicillin-streptomycin (Pen-Strep), 36 µM N-2-hydroxethyl-piperazine-N'-2-ethanesulfonic acid (HEPES) (Invitrogen Life Technologies, Burlington, ON, Canada), and 10% (wt/vol) fetal bovine serum (FBS) (CanSera, Toronto, ON, Canada). For differentiation into a macrophage-like phenotype, THP-1 cells were seeded onto six-well sterile plastic culture plates (VWR, Mississauga, ON, Canada) at 250,000 cells/well (unless stated otherwise) and treated with phorbol myristate acetate (PMA, 10 nM; Sigma, St. Louis, MO) (47). Seventy-two h later, medium was replaced with PMA-free medium (37°C) and the experimental conditions established after an additional 24 h of culture (see below).

Epithelial cells. The human colon-derived T84 crypt-like cell line was used as a model epithelium throughout this study. T84 cells (passages 39–63) were seeded at a density of 106 cells/ml onto semipermeable filters (3-µm pore size, 1.1 cm2 surface area; Costar, Cambridge, MA) and cultured at 37°C in a 1:1 mixture of Dulbecco's modified Eagle's medium and Ham's F-12 medium, supplemented with 2% Pen-Strep, 1.5% HEPES, and 10% FBS until transepithelial electrical resistance (TER) was ≥750 {Omega}/cm2 (typically 5–7 days, medium changed every 1–2 days) (23). Epithelial monolayers used here had starting TER of 753–4,400 {Omega}/cm2 (see figure legends).

Confluent T84 cell monolayers were either 1) cocultured with THP-1 cells (plated into the basal compartment of the culture well), which had been treated with PMA ± the metabolic inhibitor DNP (0.1 mM, Sigma) for 72 h, or 2) exposed to various combinations of DNP, TNF-{alpha} (10 ng/ml; R&D Systems, Minneapolis, MN), E. coli [strain HB101, 106 colony-forming units (cfu) from stationary phase of growth], and the inhibitors of NF-{kappa}β activation, pyrrolidine dithiocarbamate (PDTC; 50 µM), NF-{kappa}β essential modifier (NEMO)-binding domain binding peptide (1 µM), BAY 11–7082 (10 µM), and the proteosome inhibitor MG-132 (1 µM) (all Calbiochem, San Diego, CA). All reagents were added to the apical side of the epithelial monolayer, except for TNF-{alpha}, which was added into the basolateral compartment of the culture well.

Measurement to Assess Metabolic Stress

MTT assay. THP-1 cells (25,000) were seeded into 96-well plates and differentiated with PMA. Cells were treated with DNP (0.1 mM) for 6 h, rinsed, and culture medium replaced with 100 µl of 0.4 mg/ml 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium bromide salt (MTT) (Sigma). After 4 h at 37°C, the medium was aspirated and replaced with 100 µl acidic isopropanol (0.04N HCl in absolute isopropanol), and absorbance read at 570 nm (with background subtraction at 630 nm) (7). Higher optical density readings indicate greater MTT cleavage by the mitochondria and hence reflect greater mitochondrial activity.

ATP assay. THP-1 cells were seeded in six-well plates (50,000/well), differentiated with PMA for 72 h, rested for 24 h, and then subjected to the various experimental conditions. Subsequently, cells were washed twice with PBS and lysed with 0.5% (wt/vol) trichloroacetic acid (TCA, Sigma). Cells were scraped from the culture plates with a sterile disposable cell scraper (Corning, Cornell, NY), the pH adjusted to ~7.2 by the addition of 1 M Tris base buffer, and cell debris cleared from the extract by a 10-min centrifugation at 10,000 g. ATP levels were immediately measured by using a commercial ATP determination kit (Invitrogen). Briefly, 20 µl of cell lysate supernatants were added to a 96-well plate (Corning), 80 µl of reaction solution (reaction buffer, 1 mM DTT, 0.5 mM D-Luciferase, and 1.25 µg/ml firefly luciferase) was injected into each sample, and the resulting luminescence measured for 10 s with a Wallac 1420 Victor3 96-well luminometer (PerkinElmer, Waltham, MA). Background luminescence was subtracted (blank wells containing TCA-Tris buffer) and ATP levels read off a standard curve (1 nM to 1 µM). The ATP values for each sample were normalized against total protein [determined by the Bio-Rad/Bradford microplate assay (Bio-Rad, Hercules, CA)] in each sample.

Cytokine measurements. THP-1 cells (105/ml) ± DNP were exposed to LPS (1 µg/ml, Sigma) for 6 or 24 h, supernatants collected, and IL-1β, IL-6, and TNF-{alpha} levels measured by ELISA by using paired antibodies (DuoSet ELISA, R&D Systems) following the manufacturer's instructions. All samples were assessed in duplicate serial dilutions, and assays had detection limits of 9 pg/ml.

Assessment of mRNA expression. Total RNA was extracted from THP-1 or T84 cells with the Trizol method, and cDNA was reverse transcribed from 1 µg of RNA with the iScript cDNA Synthesis kit (Bio-Rad, Mississauga, ON, Canada). Each cDNA sample was incubated in a 25-µl reaction containing 2 mM MgCl2, 0.2 µl/PCR reaction Platinum Taq DNA polymerase (Invitrogen), and 0.4 µM of nucleotide primers [Toll-like receptor (TLR)4 (gene bank no., NM_138554 [GenBank] ) forward CAACAAAGGTGGGAATGCTT and TLR4 reverse TGCCATTGAAAGCAACTCTG, 317bp; TNF-{alpha}RI (gene bank no., NM_001065 [GenBank] ) forward ACCAAGTGCCACAAAGGAAC and reverse CTGCAATTGAAGCACTGGAA, 263bp; TNF-{alpha}RII (gene bank no., BC052977 [GenBank] ) forward CTCAGGAGCATGGGGATAAA and reverse AGCCAGCCAGTCTGACATCT, 192bp; mannose receptor (gene bank no., NM_002438 [GenBank] ) forward GGCGGTGACCTCACAAGTAT and reverse ACGAAGCCATTTGGTAAACG, 168bp; arginase-1 (gene bank no., AK128314 [GenBank] ) forward AAAACCAAGTGGGAGCATTG and reverse CCACTTGTGGTTGTCAGTGG, 196bp; and β-actin (gene bank no., NM_007393 [GenBank] ) forward CCAGAGCAAGAGAGGTATCC and reverse CTGTGGTGGTGAAGCTGTAG; 437bp]. All primers were designed using the primer3 program (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). All samples underwent PCR under the following conditions: an initial denaturation at 95°C for 3 min, then 35 cycles of 95°C for 30 s, 55°C for 8 s, and 72°C for 20 s, followed by a final extension for 3 min at 72°C. The PCR products were electrophoresed on a 2% agarose gel containing 0.5 µg/ml ethidium bromide and visualized under UV light. Densitometry was performed on digitized images with the ImageJ software package provided by the National Institutes of Health (Bethesda, MD), and specific gene bands were normalized against that of the housekeeping gene, β-actin.

Assessment of epithelial permeability. Three indices of epithelial barrier function were employed. First, TER, a measure of the predominantly paracellular flux of ions, was measured with a Millicell-ERS voltmeter and matched asymmetrical electrodes (Millipore, Bedford, MA) at the start, at specific intervals, and at the end of each experiment. Data are presented as the % change from starting TER values from each individual epithelial monolayer (47). Second, 100 µM of fluorescein-labeled dextran (3,000 Da, Invitrogen) was added to the apical side of T84 monolayers and 100 µl samples collected from the basolateral compartment of the culture well 4 and 24 h later. Fluorescence was detected in the Wallac 1420 Victor3 spectrophotometer by using excitation and emission wavelengths of 475 and 520 nM, respectively, and the amount of dextran that had crossed the epithelial layer was read off a standard curve. Third, transcytosis of the noninvasive E. coli was examined. Bacteria (106 cfu) were added to the apical aspect of the epithelial monolayers and samples retrieved from the basolateral culture compartment 24 h later and cultured on LB agar plates. Bacterial growth was enumerated on a semiquantitative, logarithmic five-point scale as described previously (24): 0 = no colonies; 1 = <10 colonies; 2 = 10–100 colonies; 3 = >100 countable colonies; 4 = >100 colonies, uncountable, but discernible colonies are evident; 5 = bacterial lawn.

Caspase immunoblotting. Whole-cell protein extracts of THP-1 or T84 cells were assessed for expression of cleaved caspase-3, as described elsewhere (33). Briefly, cells were lysed in 80–200 µl of ice-cold lysis buffer [20 mM Tris (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 2.5 mM sodium pyrophosphate, 1 mM NaVO3, and complete EDTA-free protease inhibitor complex (Roche Diagnostics, Indianapolis, IN)], the extracts vortexed (20 s), placed on ice for 10 min, vortexed again (20 s), centrifuged at 13,000 rpm for 5 min at 4°C, and then stored at –80°C. After protein concentrations were determined by using the Bio-Rad/Bradford assay, 40 µg of protein were mixed with loading buffer [(2% wt/vol) sodium dodecyl sulfate, 50 mM Tris·HCl, 100 mM DTT, 1% (wt/vol) normophenol blue, 5% (vol/vol) glycerol] and run in a 10% polyacrylamide gel (100 V for 1 h), and the separated proteins electroblotted to polyvinylidene difluoride membranes (VWR). Membranes were blocked with 5% nonfat Carnation milk for 1 h at room temperature, followed by a 4°C overnight incubation with rabbit IgG against anti-cleaved caspase-3 (1:1,000; Cell Signaling Technology, Beverly, MA). Membranes were washed extensively, incubated with goat anti-rabbit IgG (1:5,000, 1 h at room temperature; Santa Cruz Biotechnology, Santa Cruz, CA), and, after being washed, immunoreactive proteins were visualized by enhanced chemiluminescence (Amersham Pharmacia, Piscataway, NJ) and exposed to Kodak XB film (Eastman Kodak, Rochester, NY).

Trypan blue assessment of epithelial viability. T84 cells (3 x 105) were seeded into sterile six-well plates, grown to 70–80% (as gauged by phase-contrast microscopy), and then treated for 24 h with DNP + E. coli ± TNF-{alpha}. Cells were trypsinized from the culture wells stained with 0.01% Trypan blue, and the percentage of dead cells was calculated.

Luciferase assay. T84 cells (5 x 106) were suspended in 100 µl of Nucleofector II solution (AMAXA Nucleofector II kit, E-bioscience), into which was added 4 µg of plasmid-encoding pmaxGFP, or 1.07 µg of plasmid, continuing the luciferase gene, but no associated promoter (TAL) or 2.5 µg of a plasmid containing the luciferase gene under the control of an NF-{kappa}β promoter region (TAL and NF-{kappa}B plasmids were from Promega; the pmaxGFP was provided in the AMAXA Nucleofector II kit as a positive control to gauge transfection efficiency), and 1 ml of Nucleofector solution R1. The cell sample was transferred into an AMAXA-certified cuvette, which was then placed into the AMAXA Nucleofector II and nucleofected with program T-005. Subsequently the 1 x 106 transfected cells (70–80% efficiency based on GFP expression) were seeded into 24-well plates and cultured for 2 days until ~80% confluent. Following treatment with TNF-{alpha} (10 ng/ml for 4 h), luciferase activity was determined following the manufacturer's instructions for a commercial assay kit (Promega). Briefly, duplicate 20 µl of cell lysates were transferred to a 96-well Optiplate (PerkinElmer), reagents injected by an automated Wallac 1420 Victor3 flurospectro-luminometer system (PerkinElmer), and light emission read 10 s later.

Data presentation and analysis. Data are presented as the means ± SE, where n values indicate the number of individual epithelial monolayers from a specified number of experiments. Statistical analysis was performed by using ANOVA followed by post hoc pair-wise comparisons with Student's t-test. Data from bacterial translocation studies were assessed using the Chi-squared test. A statistically significant difference was accepted at P < 0.05.


   RESULTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 GRANTS
 REFERENCES
 
DNP causes metabolic stress in differentiated macrophages and reduces cytokine responses to LPS. THP-1 cells exposed to 0.1 mM DNP, a dose we have used to evoke metabolic stress in epithelia (28), for 6 h displayed a significant decrease in their ability to cleave the MTT substrate, indicative of reduced mitochondrial activity (Fig. 1A). Corroborating these data, DNP-treated THP-1 cells also showed a time-dependent reduction in ATP content (Fig. 1B). This degree of metabolic stress was not associated with decreased THP-1 cell viability as assessed by exclusion of the vital dye, Trypan blue (data not shown), cleavage of caspase-3 (Fig. 1C), and measurement of total THP-1 protein obtained from cells attached to the culture dish: control = 1.55 ± 0.18 vs. DNP-treated (6 h) = 1.48 ± 0.23 µg protein/µl extract (n = 3). The synthesis and release of the proinflammatory cytokines, IL-1β, IL-6, and TNF-{alpha}, by THP-1 cells in response to LPS was reduced by DNP treatment, although the metabolically stressed cells still produced substantial amounts of cytokines (Table 1). This diminished responsiveness to LPS was not accompanied by a reduction in TLR-4 mRNA expression (data not shown).


Figure 1
View larger version (14K):
[in this window]
[in a new window]

  		Fig. 1. THP-1 macrophages show reduced mitochondrial activity and ATP synthesis following treatment with the uncoupler of oxidative phosphorylation, dinitrophenol (DNP, 0.1 mM). A: depicts the ~40% reduction in mitochondrial activity observed 6 h after treatment with DNP as assessed by the 3-(4,5-dimethyl-thiazol-2-yl)-2,5-diphenyltetrazolium bromide salt (MTT) assay (n = 3). The effect of the pan-PKC activator and proapoptotic agent, staurosporine (Stauro, 10 µM) is shown for comparison (O.D., Optical Density). B: shows the time-dependent drop in ATP levels caused by DNP and, for comparison, the unrelated metabolic stressor, hydrogen peroxide (0.5 mM) (n = 6–9 epithelial THP-1 preparations from 2 separate experiments). Data are means ± SE; *P < 0.05 compared with control (Con); #P < 0.05 compared with control and other DNP treatment time-points. C: an image, representative of 3 experiments, showing negligible apoptosis in THP-1 cells exposed to DNP ± Escherichia coli (E. coli) as gauged by caspase-3 cleavage to the 19- and 17-kDa forms (extracts from staurosporine used as a positive control).

 

View this table:
[in this window]
[in a new window]

  		Table 1. Cytokine synthesis by PMA-differentiated THP-1 macrophages

 
Macrophages have been classified as classical (i.e., proinflammatory) or alternatively activated macrophages (AAMs), which are regarded as more anti-inflammatory, being involved in tissue resolution after damage (13). Considering the possibility that metabolically stressed macrophages become AAM-like, RT-PCR was performed for markers of these cells: specifically, arginase-1 and the mannose receptor (CD206). Arginase-1 or CD206 mRNA expression was not increased in DNP-treated THP-1 cells compared with control cells (n = 4, data not shown).

Coculture with E. coli-activated macrophages decreases epithelial barrier function. T84 cell monolayers cocultured with either untreated THP-1 cells or THP-1 cells exposed to DNP for 6 h displayed no significant drop in TER over a 24-h coculture period (Fig. 2). We have previously shown that 24-h exposure to E. coli HB101 alone has minimal effects on the permeability characteristics of T84 monolayers (28, 31). However, when THP-1 cells were treated with E. coli ± DNP for 6 h and confluent filter-grown epithelial monolayers subsequently added to the culture well, the result was a significant drop in TER 24 h later [reduced to 30–40% of pretreatment TER values (Fig. 2)]. These data are in accordance with our previous studies where coculture with monocytes or macrophages activated by bacteria or bacteria products evoked increases in the permeability of T84 cell monolayers (49, 50).


Figure 2
View larger version (7K):
[in this window]
[in a new window]

  		Fig. 2. Bar graph showing the effects of 5 x 104 THP-1 macrophages ± DNP (0.1 mM) ± E. coli (HB101) on T84 transepithelial resistance (TER). T84 cell monolayers cocultured with THP-1 cells or THP-1 cells pretreated for 6 h with DNP followed by multiple rinses showed only negligible changes in TER 24 h postcoculture. In contrast, when THP-1 cells were exposed to E. coli ± DNP for 6 h, rinsed, and then confluent T84 monolayers transferred into the culture plate, the outcome was a significant increase in epithelial permeability as measured by a drop in TER 24 h postcoculture (n = 3 monolayers); means ± SE; *P < 0.05 compared with THP-1 only; starting TER range = 753–1,468 {Omega}/cm2; exposure to E. coli alone for 24 h does not affect T84 TER (data not shown) (see Ref. 31).

 
Since macrophages, even metabolically stressed macrophages (Table 1), release a variety of mediators following activation, we opted to focus subsequent studies on TNF-{alpha}, a factor which has been implicated in IBD and has been shown to affect endothelial (11, 12), gut (38), and kidney (25, 26) epithelial permeability.

TNF-{alpha} enhances DNP + E. coli-induced increased permeability. TNF-{alpha} is a major player in inflammatory disease and in IBD, where it has been implicated in the perturbation of gut barrier function (42, 45, 51). We have previously shown that TNF-{alpha} released from LPS-activated macrophages can contribute to reductions in epithelial barrier function (50). In vitro analyses reveal that TNF-{alpha} directly disrupts the barrier function of monolayers of human colonic HT-29 and Caco-2 epithelial cell lines (19, 38) but has little direct impact on T84 cell monolayer permeability (23) in the absence of IFN-{gamma} (4, 46). RT-PCR analysis confirmed that T84 cells constitutively express mRNA for both TNF-RI and TNF-RII (Fig. 3, inset), the levels of which were unaltered after 6–24 h of exposure to DNP + E. coli ± TNF-{alpha} (data not shown). Given the increase in epithelial permeability caused by exposure to DNP + E. coli and TNF-{alpha} production by metabolically stressed macrophages, although at reduced amounts compared with nonstressed cells, we hypothesized that TNF-{alpha} would have additive effects with DNP + E. coli in reducing epithelial barrier function.


Figure 3
View larger version (39K):
[in this window]
[in a new window]

  		Fig. 3. TNF-{alpha} exposure enhances the loss of T84 epithelial monolayer barrier function evoked by DNP + E. coli HB101 treatment. A: shows the change in TER. Data are means ± SE; *P < 0.05 compared with control and E. coli only; #P < 0.05 compared with DNP + E. coli; additional differences are depicted above the salient bars; starting TER range 1,110–3,850 {Omega}/cm2. Treatment with TNF-{alpha} only did not affect T84 TER (data not shown) (see Ref. 23). nd, not determined. B: shows the percentage bacterial translocation; see MATERIALS AND METHODS for description of translocation units (n = 14, 28, 20, and 35 T84 monolayers for E. coli only, E. coli + TNF-{alpha}, E. coli + DNP, and E. coli + DNP + TNF-{alpha}, respectively, from 10 separate experiments; 0/14, no monolayers of 14 examined). We observed no clear association between TER values at the start of an experiment and the subsequent degree of bacterial translocation (also see Table 4). (*P < 0.05 compared with control and E. coli only; #P < 0.05 compared with DNP + E. coli.) Inset: representative RT-PCR gel showing that T84 cells constitutively express TNF-RI and TNF-RII mRNA; –ve, negative control; mm, molecular marker.

 
In response to E. coli + TNF-{alpha}, there was a small but statistically significant reduction in TER of ~25% after 24 h (n = 28, Fig. 3A) [As in previous investigations, treatment with TNF-{alpha} alone had negligible effects on TER (data not shown).]. However, the effects of E. coli + TNF-{alpha} on epithelial permeability were similar to those evoked by E. coli + DNP, with the exception that the drop in TER caused by DNP + E. coli was statistically significant 12 h after exposure (Fig. 3A). The addition of TNF-{alpha} to the E. coli + DNP treatment regimen significantly enhanced the drop in TER compared with that evoked by TNF-{alpha} + E. coli or DNP + E. coli, at both 12 and 24 h posttreatment (Fig. 3A).

When E. coli HB101 was added to the apical aspect of confluent T84 cell monolayers, translocation into the basal chamber of the culture well was only observed in 8% of the preparations (Fig. 3B). In contrast, epithelial monolayers treated with either E. coli + TNF-{alpha} or E. coli + DNP resulted in bacterial translocation across ~60% of the monolayers (and at 100% in some experiments). Although treatment with TNF-{alpha} + E. coli resulted in translocation scores of 1–3, a score of 5 was not recorded for any of the 12 treated monolayers. In contrast, translocation scores of 4 and 5 were commonplace in epithelial monolayers treated with DNP + E. coli. The increased permeability was exaggerated in monolayers exposed to the triple threat of E. coli + DNP + TNF-{alpha} (Fig. 3B).

Epithelial death does not account for the increased permeability. TNF-{alpha}-induced epithelial cytotoxicity could account for the increased epithelial permeability. However, using caspase-3 cleavage as an index of apoptosis, we found no evidence to support this supposition when cells were examined 3, 6, 12 (n = 3, data not shown), or 24 h posttreatment (Fig. 4). In addition, epithelial necrosis was assessed by the Trypan blue dye exclusion technique. The number of epithelial cells retrieved after the various experimental treatments was not different, and there were no significant differences in the percentage positivities, which were 2.8 ± 0.5, 2.7 ± 2.0, 1.5 ± 1.0, and 3.0 ± 0.6% for control, DNP + E. coli, TNF-{alpha} + E. coli, and DNP + E. coli + TNF-{alpha}, respectively (n = 6 replicates from 2 experiments; means ± SD; one-way ANOVA P = 0.26).


Figure 4
View larger version (19K):
[in this window]
[in a new window]

  		Fig. 4. Representative immunoblot (n = 3) of whole-cell extracts from T84 cells 24 h posttreatment showing whole caspase-3 (35 kDa) and a lack of activation (i.e., cleavage to the 19- and 17-kDa forms) of this enzyme that is indicative on apoptosis. C, control; T, TNF-{alpha} (10 ng/ml); D, DNP (0.1 mM); E, E. coli [106 colony-forming units(cfu)]; +ve, extracts of Balb/c mouse thymus; mm, molecular marker lane.

 
Pharmacological blockade of NF-{kappa}β signaling ameliorates the increased epithelial permeability induced by DNP + E. coli ± TNF-{alpha}. Since many effects of TNF-{alpha} are mediated via the transcription factor NF-{kappa}β, we postulated that NF-{kappa}β mobilization contributed to the enhanced reduction in epithelial barrier function. Initial studies confirmed NF-{kappa}β activation in T84 cells in response to TNF-{alpha} as revealed by an approximately twofold increase in arbitrary luminescence units 4 h after treatment: control = 2,501 ± 291 vs. TNF-{alpha} (10 ng/ml) treatment = 4,282 ± 540 (means ± SE, 6 T84 preparations from 2 experiments). This magnitude of NF-{kappa}β activation is similar to that described by Ye et al. (48). Three inhibitors of NF-{kappa}β activation were employed (i.e., PDTC, NEMO-binding peptide, and BAY 11–7082), as well as the proteosome inhibitor MG-132. None of these pharmacological agents had a direct effect on TER, and they were neither bacteriocidal nor bacteriostatic at the doses used in coculture studies over a 24-h experimental period (data not shown). The use of these inhibitors of NF-{kappa}β activation failed to ameliorate either the drop in TER evoked by DNP + E. coli + TNF-{alpha}, or that caused by exposure to DNP + E. coli (Table 2). In contrast, blockade of NF-{kappa}β signaling significantly ameliorated TNF-{alpha} + E. coli ± DNP-induced increases in E. coli transcytosis across the epithelium. As shown in Fig. 5, PDTC when added to E. coli + TNF-{alpha}, E. coli + DNP, or E. coli + TNF-{alpha} + DNP resulted in a significant decrease in the number of bacterial translocation scores of ≥3 assigned to the epithelial monolayers compared with the appropriate positive control group. It should also be noted that, in this series of experiments, exposure to DNP + E. coli resulted in a translocation score of 5 in 0 of 8 epithelial preparations, whereas 3 of 8 monolayers displayed a bacterial translocation score of 5 as a consequence of exposure to DNP + E. coli + TNF-{alpha}. Table 3 presents data related to the translocation score of 5 (i.e., the maximum value at which the retrieved and cultured bacteria grow as a lawn). Fifty percent of epithelial monolayers treated with DNP + E. coli + TNF-{alpha} showed maximum bacterial translocation, whereas this was reduced to 16% by inclusion of an inhibitor of NF-{kappa}β activity in the culture well. Bacterial translocation across DNP + E. coli-treated T84 monolayers was also significantly reduced by inhibitors of NF-{kappa}β: 70% compared with 11% (Table 3). In additional, PDTC added to the culture well 2 or 4 h, but not 6 h, after E. coli + DNP reduced bacterial translocation (Fig. 6).


View this table:
[in this window]
[in a new window]

  		Table 2. Pharmacological inhibitors of NF-{kappa}β activation fail to ameliorate the drop in TER across T84 cell monolayers

 

Figure 5
View larger version (15K):
[in this window]
[in a new window]

  		Fig. 5. The inhibitor of NF-{kappa}β signaling, pyrrolidine dithiocarbamate (PDTC), reduces E. coli translocation across T84 epithelial cell monolayers. Monolayers treated with E. coli + TNF-{alpha}, E. coli + DNP, or E. coli + DNP + TNF-{alpha} showed significant bacterial translocation (i.e., reduction in score = 0) compared with E. coli HB101 treatment alone. A: shows that E. coli did not traverse control or PDTC-only (50 µM)-treated monolayers. The degree of bacterial translocation observed in response to DNP + E. coli (0 of 8 graded as translocation score 5) was significantly reduced by the addition of PDTC (*P < 0.05 compared with E. coli only, and #P < 0.05 compared with E. coli + DNP). B: shows similarly that PDTC reduces bacterial translocation at grades 2 or ≥3 caused by E. coli + TNF-{alpha} and E. coli + TNF-{alpha} + DNP (3 of 8 graded as translocation score 5). {dagger}P < 0.05 compared with E. coli + TNF-{alpha} and §P < 0.05 compared with E. coli + DNP + TNF-{alpha}; n = 6–15 T84 cell monolayers from 3 or 4 separate experiments; TNF-{alpha} at 10 ng/ml; E. coli at 106 cfu; DNP at 0.1 mM; 0, no monolayers were scored as positive in this category.

 

View this table:
[in this window]
[in a new window]

  		Table 3. Pharmacological inhibitors of NF{kappa}β activity reduce bacterial transcytosis across filter-grown monolayers of T84 cells evoked by metabolic stress ± TNF-{alpha} treatment

 

Figure 6
View larger version (11K):
[in this window]
[in a new window]

  		Fig. 6. The NF-{kappa}β inhibitor PDTC (50 µM) can be added to T84 epithelial monolayers either along with (time 0) or 2 or 4 h, but not 6 h, after exposure to DNP (0.1 mM) and E. coli (106 cfu) and still block bacterial transcytosis. Data are shown as percentage of epithelial monolayers positive for bacterial translocation, and the numbers inside each bar give the number of T84 epithelial monolayers examined.

 
Finally, the effects of E. coli, DNP, and TNF-{alpha} ± PDTC on TER, the flux of dextran (mw 3,000 Da, considered a marker of paracellular permeability) and the transcytosis of E. coli were simultaneously compared. Consistent with data from other experiments in this study, exposure to E. coli, DNP, and TNF-{alpha} resulted in a significant drop in TER and increased E. coli transcytosis; the drop in TER was not affected by treating the cells with PDTC, whereas less bacterial transcytosis was observed (Table 4). Unexpectedly there was not a statistically significant increase in the transepithelial flux of the dextran across E. coli + DNP + TNF-{alpha}-treated monolayers, despite a considerable drop in TER. This suggests that, although paracellular permeability has increased, there is still a restriction to the size of molecule that can freely cross the epithelial layer via this pathway. This is an important finding with T84 cells that spontaneously establish monolayers with very high TER values, illustrating that a significant drop in TER (e.g., from 1,500 to 650 {Omega}/cm2, that is, a 60% drop) does not necessarily translate into a dramatic opening of the tight junction that would allow large inert molecules to pass freely. This maintenance of a paracellular barrier also argues against epithelial apoptosis as a major contributing factor to the reduction in TER.


View this table:
[in this window]
[in a new window]

  		Table 4. Comparison of transepithelial resistance, dextran fluxes, and E. coli translocation across T84 cell monolayers

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
GRANTS
 REFERENCES
 
A number of disorders are associated with loss of mitochondrial function (22). Abnormal mitochondrial structure indicative of reduced ATP synthesis has been noted in epithelial cells in tissues from patients with Crohn's disease, other enteropathies, and in animal models of gut disease (9, 17, 28, 39, 43). A variety of stimuli can interfere with mitochondrial activity resulting in metabolic stress: infection, exposure to bacterial toxins, ischemia, inflammation, psychological stress, certain medications (8, 10, 14, 20), and, potentially, the loss of commensal bacteria that provide short-chain fatty acids as an energy source for colonocytes (21). Postulating that metabolic stress in the enteric epithelium could be a contributing factor to IBD, we found that epithelial monolayers exposed to a classic uncoupler of oxidative stress, DNP, displayed reduced barrier function but only when viable commensal E. coli were present, a pertinent observation in light of studies implicating the commensal microflora in the pathogenesis of IBD (28, 44). However, depending on the source of the metabolic stressor, other cells in the gut, besides the enterocyte, could be affected. Thus, by using a cell-culture model, we assessed the effects of DNP on THP-1 macrophages and the impact of TNF-{alpha}, which could originate from macrophages or other cells (e.g., T cells), + DNP + E. coli (HB101) on epithelial barrier function.

Using a model system analogous to that used here, peripheral blood mononuclear cells differentiated into adherent macrophages were found to increase epithelial permeability, particularly when activated with LPS (49). DNP treatment of THP-1 macrophages resulted in significant reduction of ATP production [events mimicked by the unrelated metabolic stressor and inflammatory mediator H2O2 (3)]. Despite this, the metabolically stressed THP-1 cells remained responsive to E. coli and were as effective as non-DNP-treated THP-1 cells in reducing epithelial TER. Similar findings have been reported for monolayers of Caco-2 epithelial cells, but, in contrast to our findings, data were presented in favor of macrophage-derived TNF-{alpha}, causing apoptosis in the Caco-2 cells (37).

AAMs participate in tissue restitution and recovery from injury (16). We postulated that DNP-stressed THP-1 cells could take on an AAM-like phenotype and that this would explain the reduced responses to LPS; RT-PCR analysis of markers indicative of AAM failed to support this notion. Also, analysis of TLR-4 mRNA revealed no significant differences between control and DNP-treated THP-1 cells. Thus the reduced cytokine production by DNP-treated macrophages in response to LPS reflects a shift in metabolic activity in the stressed cells. However, in the context of our experimental hypothesis (Fig. 7), it was important to demonstrate that, despite the levels being reduced, the DNP-treated THP-1 cells still produced TNF-{alpha} and other proinflammatory molecules (i.e., IL-1β and IL-6).


Figure 7
View larger version (20K):
[in this window]
[in a new window]

  		Fig. 7. A hypothetical model illustrating a positive feedback loop that could enhance the disruption of epithelial barrier function. Epithelial (Ep) cells respond to metabolic stress in the context of a commensal flora with increased permeability (1) mediated in part by NF-{kappa}β. Bacteria gain access to the mucosa (2) and activate stressed macrophages (Mo) (3) to release TNF-{alpha} (4), which, in turn, affects the epithelial cells further reducing epithelial barrier function (5). Increased numbers of bacteria penetrate into the mucosa (6) and activate resident immune cells to elicit inflammation (7); tj, tight junction. (IL-1β and IL-6 release following LPS or bacterial stimulation could contribute to altered epithelial function and impact mucosal immunity.)

 
Since metabolically stressed epithelia are more permeable to bacteria and metabolically stressed THP-1 cells release proinflammatory cytokines, we hypothesized that this would create a positive feedback loop to exaggerate the loss of epithelial barrier function. Similar events in the human colon, where bacteria are omnipresent, could convert short-term, nondangerous increases in epithelial permeability into chronic, dramatic decreases in enteric barrier function that would be of pathophysiological significance.

Considering the immune components of such a feedback loop, we focused on TNF-{alpha} because neutralizing anti-TNF-{alpha} antibodies reduce the increased barrier function observed in patients with Crohn's disease (45, 51); neutralization of TNF-{alpha} in monocyte-epithelial cocultures ameliorates the epithelial barrier defect (49); and TNF-{alpha} can directly increase paracellular permeability in monolayers of pulmonary endothelial cells (i.e., CPAE), as well as renal (i.e., MDCK and LLC-PK1) and enteric (i.e., HT-29 and Caco2) epithelial cell lines. These increases in paracellular permeability have been presented as a normal physiological process that does not lead to significant gaps in the monolayer or, alternatively, as a consequence of TNF-{alpha}-induced apoptosis (11, 18, 26, 29, 38). Moreover, although TNF-{alpha} can directly stimulate T84 cells to produce cytokines (1, 32), we (23) and others (4) have not observed a direct effect of TNF-{alpha} on T84 monolayer permeability, unless administered with IFN-{gamma} (46).

Treatment of T84 monolayers with TNF-{alpha} + E. coli resulted in reductions in TER and increased bacterial transcytosis, although bacterial translocation scores of 5 were not recorded. This is a significant finding: TNF-{alpha} is now having an effect on epithelial barrier function in the presence of nonpathogenic bacteria. The inability of PDTC to block the TNF-{alpha} + E. coli-induced drop in TER, while reducing bacterial translocation, suggests that the bacteria may be passing transcellularly across the epithelial cells, a possibility that needs to be tested. In addition, these data complement studies in which biopsies from patients with Crohn's disease showed increases in epithelial endocytosis of the protein horseradish peroxidase after TNF-{alpha} exposure (42).

Moreover, we found that the considerable reduction in epithelial barrier function induced by exposure to DNP + E. coli is further enhanced by exposure to TNF-{alpha}. Vital dye exclusion and immunoblotting for caspase-3 revealed no evidence of increased necrosis or apoptosis in epithelial monolayers exposed to DNP + E. coli + TNF-{alpha}, and, although subtle changes in epithelial viability could contribute to the barrier defect, our data suggest that epithelial cell death is not a major factor in these studies. Next, NF-{kappa}β, a major intracellular signaling pathway mobilized by TNF-{alpha}, was assessed as a mediator of the epithelial barrier defect. Use of three pharmacological inhibitors of NF-{kappa}β signaling (which function by different mechanisms) revealed that the increased bacterial translocation, but not the drop in TER, evoked by DNP + E. coli ± TNF-{alpha} was due, at least in part, to NF-{kappa}β activity (a possible antioxidant effect of PDTC cannot be unequivocally ruled out). This is not unexpected given the relationship between TNF-{alpha} and NF-{kappa}β and the ability of other inhibitors of NF-{kappa}β (e.g., curcumin and NF-{kappa}β anti-sense oligonucleotides) to block TNF-{alpha}-induced increases in epithelial permeability (19, 48). What was initially more surprising was the fact that the inhibitors of NF-{kappa}β activity reduced the increased E. coli transcytosis that occurred in response to DNP + E. coli treatment, although we had reported that IL-8 released from T84 cells cultured with E. coli + DNP was blocked by PDTC (28). In addition, many bacterial products, including LPS, mobilize NF-{kappa}β in epithelia (15), and the loss of epithelial barrier function caused by exposure to the oxidant and metabolic stressor, hydrogen peroxide, is lessened by inhibition of NF-{kappa}β activity (3). Moreover, the present study also shows that PDTC added to the culture 4 h after DNP + E. coli still blocks the bacterial transcytosis; this lag phase may represent the time required for the metabolic stress to impact the enterocyte.

Dissecting the mechanism of control of epithelial barrier function, the present study adds to a body of data illustrating that paracellular and transcellular permeability are differentially regulated. Indeed, in our earlier investigations we showed that epithelia under metabolic stress have increased internalization of noninvasive E. coli (28) and that inhibitors of endocytosis and microtubule activity significantly reduced bacterial translocation across T84 cell monolayers (27). We did not specifically address the route of bacterial transcytosis in the present study. Although we cannot unequivocally rule out that some bacteria could move paracellularly, the differential regulation of TER and bacterial transcytosis by inhibitors of NF-{kappa}β is compatible with the bacteria being endocytosed by the stressed ± TNF-{alpha}-treated epithelial cells and crossing the monolayer via a transcellular route. Numerous investigations have assessed the regulation of paracellular permeability in health and disease, but significantly less information is available on the control of transcellular permeability, in general, and the ability of components of the commensal flora to cross the epithelium, in particular (6, 24). We suggest that a transcellular route of bacterial entry into the mucosa is likely to represent a major portal of entry that must be given equal, if not greater, consideration when evaluating epithelial barrier function and its contribution to local injury or systemic disease (e.g., sepsis).

In conclusion, we highlight three points. First, metabolic stress in the epithelium should be considered when assessing enteric disease pathogenesis or relapses in disease activity. Second, activation of NF-{kappa}β may represent a common signal mediating increased transcytosis of bacteria across epithelial monolayers by proinflammatory cytokines, bacterial products (either directly or indirectly), and metabolic stress. Thus NF-{kappa}β inhibitors are not only immunosuppressive, but part of their anti-inflammatory property could be the maintenance of epithelial barrier function. Third, in juxtaposing epithelium, bacteria, and immune cells (i.e., macrophages) as three of the prominent players in IBD, we have established an in vitro immunophysiological model system (Fig. 7) that allows testing of specific hypotheses related to the control and regulation of epithelial barrier function under physiological and putative pathophysiological conditions.


   GRANTS
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
REFERENCES
 
This work was funded by an operating grant from the Canadian Institutes of Health Research (MT-13421) to D. McKay, who is an Alberta Heritage Foundation for Medical Research Scientist. D. McKay and P. Sherman are recipients of Canada Research Chairs (Tier 1).


   ACKNOWLEDGMENTS
 
Suzanne Cho is thanked for her help with cytokine ELISA.


   FOOTNOTES
 

Address for reprint requests and other correspondence: D. M. McKay, Gastrointestinal Research Group, 1877 HSC, Dept. Physiology and Biophysics, Univ. of Calgary, 3330 Hospital Dr. NW, Calgary, Alberta, Canada T2N 4N1 (e-mail: dmckay{at}ucalgary.ca)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


   REFERENCES
TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 GRANTS
 REFERENCES
 

  1. Akhtar M, Watson JL, Nazli A, McKay DM. Bacterial DNA evokes epithelial IL-8 production by a MAPK-dependent, NF-{kappa}β-independent pathway. FASEB J 17: 1319–1321, 2003.[Abstract/Free Full Text]
  2. Bacallao R, Garfinkel A, Monke S, Zampighi G, Mandel LJ. ATP depletion: a novel method to study junctional properties in epithelial tissues. I. Rearrangement of the actin cytoskeleton. J Cell Sci 107: 3301–3313, 1994.[Abstract]
  3. Banan A, Zhang LJ, Shaikh M, Fields JZ, Farhadi A, Keshavarzian A. Novel effect of NF-{kappa}β activation: carbonylation and nitration injury to cytoskeleton and disruption of monolayer barrier in intestinal epithelium. Am J Physiol Cell Physiol 287: C1139–C1151, 2004.[Abstract/Free Full Text]
  4. Bruewer M, Luegering A, Kucharzik T, Parkos CA, Madara JL, Hopkins AM, Nusrat A. Proinflammatory cytokines disrupt epithelial barrier function by apoptosis-independent mechanisms. J Immunol 171: 6164–6172, 2003.[Abstract/Free Full Text]
  5. Canfield PE, Geerdes AM, Molitoris BA. Effect of reversible ATP depletion on tight-junction integrity in LLC-PK1 cells. Am J Physiol Renal Fluid Electrolyte Physiol 261: F1038–F1045, 1991.[Abstract/Free Full Text]
  6. Clark E, Hoare C, Tanianis-Hughes J, Carlson GL, Warhurst G. Interferon-{gamma} induces translocation of commensal Escherichia coli across gut epithelial cells via a lipid raft-mediated process. Gastroenterology 128: 1258–1267, 2005.[CrossRef][Web of Science][Medline]
  7. Diaz-Granados N, Howe K, Lu J, McKay DM. Dextran sulphate sodium-induced colonic histopathology, but not altered epithelial ion transport, is reduced by inhibition of phosphodiesterase activity. Am J Pathol 156: 2169–2177, 2000.[Abstract/Free Full Text]
  8. Dickman KG, Hempson SJ, Anderson J, Lippe S, Zhao L, Burakoff R, Shaw RD. Rotavirus alters paracellular permeability and energy metabolism in caco-2 cells. Am J Physiol Gastrointest Liver Physiol 279: G757–G766, 2000.[Abstract/Free Full Text]
  9. Farhadi A, Keshavarzian A, Van de Kar LD, Jakate S, Domm A, Zhang L, Shaikh M, Banan A, Fields JZ. Heightened responses to stressors in patients with inflammatory bowel disease. Am J Gastroenterol 100: 1796–1804, 2005.[CrossRef][Web of Science][Medline]
  10. Gabe SM, Bjarnason I, Tolou-Ghamari Z, Tredger JM, Johnson PG, Barclay GR, Williams R, Silk DB. The effect of tacrolimus (FK506) on intestinal barrier function and cellular energy production in humans. Gastroenterology 115: 67–74, 1998.[CrossRef][Web of Science][Medline]
  11. Goldblum SE, Ding X, Campbell-Washington J. TNF-{alpha} induces endothelial cell F-actin depolymerization, new actin synthesis, and barrier dysfunction. Am J Physiol Cell Physiol 264: C894–C905, 1993.[Abstract/Free Full Text]
  12. Goldblum SE, Sun WL. Tumor necrosis factor-{alpha} augments pulmonary arterial transendothelial albumin flux in vitro. Am J Physiol Lung Cell Mol Physiol 258: L57–L67, 1990.[Abstract/Free Full Text]
  13. Gordon S. Alternative activation of macrophages. Nat Rev Immunol 3: 23–35, 2003.[CrossRef][Web of Science][Medline]
  14. He D, Hagen SJ, Pothoulakis C, Chen M, Medina ND, Warny M, LaMont JT. Clostridium difficile toxin A causes early damage to mitochondria in cultured cells. Gastroenterology 119: 139–150, 2000.[CrossRef][Web of Science][Medline]
  15. Lahde M, Korhonen R, Moilanen E. Regulation of nitric oxide production in cultured human T84 intestinal epithelial cells by nuclear factor-{kappa}β-dependent induction of inducible nitric oxide synthase after exposure to bacterial endotoxin. Aliment Pharmacol Ther 14: 945–954, 2000.[CrossRef][Web of Science][Medline]
  16. Loke P, Nair MG, Parkinson J, Guiliano D, Blaxter M, Allen JE. IL-4 dependent alternatively-activated macrophages have a distinctive in vivo gene expression phenotype. BMC Immunol 3: 7, 2002.[CrossRef][Medline]
  17. Ma C, Wickham ME, Guttman JA, Deng W, Walker J, Madsen KL, Jacobson K, Vogl WA, Finlay BB, Vallance BA. Citrobacter rodentium infection causes both mitochondrial dysfunction and intestinal epithelial barrier disruption in vivo: role of mitochondrial associated protein (Map). Cell Microbiol 8: 1669–1686, 2006.[CrossRef][Web of Science][Medline]
  18. Ma TY, Boivin MA, Ye D, Pedram A, Said HM. Mechanism of TNF{alpha} modulation of Caco-2 intestinal epithelial tight junction barrier: role of myosin light-chain kinase protein expression. Am J Physiol Gastrointest Liver Physiol 288: G422–G430, 2005.[Abstract/Free Full Text]
  19. Ma TY, Iwamoto GK, Hoa NT, Akotia V, Pedram A, Boivin MA, Said HM. TNF{alpha}-induced increase in intestinal epithelial tight junction permeability requires NF-{kappa}β activation. Am J Physiol Gastrointest Liver Physiol 286: G367–G376, 2004.[Abstract/Free Full Text]
  20. Madsen K, Yanchar N, Sigalet D, Reigel T, Fedorak R. FK506 increases permeability in rat intestine by inhibiting mitochondrial function. Gastroenterology 109: 107–114, 1995.[CrossRef][Web of Science][Medline]
  21. Manichanh C, Rigottier-Gois L, Bonnaud E, Gloux K, Pelletier E, Frangeul L, Nalin R, Jarrin C, Chardon P, Marteau P, Roca J, Dore J. Reduced diversity of faecal microbiota in Crohn's disease revealed by a metagenomic approach. Gut 55: 205–211, 2006.[Abstract/Free Full Text]
  22. McFarland R, Taylor RW, Turnbull DM. Mitochondrial disease-its impact, etiology, pathology. Curr Top Dev Biol 77: 113–155, 2007.[Web of Science][Medline]
  23. McKay DM, Croitoru K, Perdue MH. T cell monocyte interactions regulate epithelial physiology in a coculture model of inflammation. Am J Physiol Cell Physiol 270: C418–C428, 1996.[Abstract/Free Full Text]
  24. McKay DM, Watson JL, Wang A, Caldwell J, Prescott D, Ceponis PM, Di L, V, Lu J. Phosphatidylinositol 3'-kinase is a critical mediator of interferon-{gamma}-induced increases in enteric epithelial permeability. J Pharmacol Exp Ther 320: 1013–1022, 2007.[Abstract/Free Full Text]
  25. Mullin JM, Laughlin KV, Marano CW, Russo LM, Soler AP. Modulation of tumour necrosis factor-induced increase in renal (LLC-PK1) transepithelial permeability. Am J Physiol Renal Fluid Electrolyte Physiol 263: F915–F924, 1992.[Abstract/Free Full Text]
  26. Mullin JM, Snock KV. Effect of tumour necrosis factor on epithelial tight junctions and transepithelial permeability. Cancer Res 50: 2172–2176, 1990.[Abstract/Free Full Text]
  27. Nazli A, Wang A, Steen O, Prescott D, Lu J, Perdue MH, Soderholm JD, Sherman PM, McKay DM. Enterocyte cytoskeleton changes are crucial for enhanced translocation of commensal bacteria across metabolically stressed gut epithelia. Infect Immun 74: 192–201, 2006.[Abstract/Free Full Text]
  28. Nazli A, Yang PC, Jury J, Howe K, Watson JL, Soderholm JD, Sherman PM, Perdue MH, McKay DM. Epithelia under metabolic stress perceive commensal bacteria as a threat. Am J Pathol 164: 947–957, 2004.[Abstract/Free Full Text]
  29. Peralta SA, Mullin JM, Knudsen KA, Marano CW. Tissue remodeling during tumor necrosis factor-induced apoptosis in LLC-PK1 renal epithelial cells. Am J Physiol Renal Fluid Electrolyte Physiol 270: F869–F879, 1996.[Abstract/Free Full Text]
  30. Perdue MH, McKay DM. Integrative immunophysiology in the intestinal mucosa. Am J Physiol Gastrointest Liver Physiol 267: G151–G165, 1994.[Abstract/Free Full Text]
  31. Philpott DJ, McKay DM, Sherman PM, Perdue MH. Infection of T84 cells with enteropathogenic Escherichia coli alters barrier and transport functions. Am J Physiol Gastrointest Liver Physiol 270: G634–G645, 1996.[Abstract/Free Full Text]
  32. Porath D, Riegger C, Drewe J, Schwager J. Epigallocatechin-3-gallate impairs chemokine production in human colon epithelial cell lines. J Pharmacol Exp Ther 315: 1172–1180, 2005.[Abstract/Free Full Text]
  33. Reardon C, McKay DM. TGF-β suppresses IFN-{gamma}-STAT1-dependent gene transcription by enhancing STAT1-PIAS1 interactions in epithelia but not monocytes/macrophages. J Immunol 178: 4284–4295, 2007.[Abstract/Free Full Text]
  34. Rogler G, Andus T, Aschenbrenner E, Vogl D, Falk W, Scholmerich J, Gross V. Alterations of the phenotype of colonic macrophages in inflammatory bowel disease. Eur J Gastroenterol Hepatol 9: 893–899, 1997.[Web of Science][Medline]
  35. Rugtveit J, Nilsen EM, Bakka A, Carlsen H, Brandtzaeg P, Scott H. Cytokine profiles differ in newly recruited and resident subsets of mucosal macrophages from inflammatory bowel disease. Gastroenterology 112: 1493–1505, 1997.[CrossRef][Web of Science][Medline]
  36. Santhanam S, Venkatraman A, Ramakrishna BS. Impairment of mitochondrial acetoacetyl CoA thiolase activity in the colonic mucosa of patients with ulcerative colitis. Gut 56: 1543–1549, 2007.[Abstract/Free Full Text]
  37. Satsu H, Ishimoto Y, Nakano T, Mochizuki T, Iwanaga T, Shimizu M. Induction by activated macrophage-like THP-1 cells of apoptotic and necrotic cell death in intestinal epithelial Caco-2 monolayers via tumor necrosis factor-{alpha}. Exp Cell Res 312: 3909–3919, 2006.[CrossRef][Web of Science][Medline]
  38. Schmitz H, Fromm M, Bentzel CJ, Scholz P, Detjen K, Mankertz J, Bode H, Epple HJ, Riecken EO, Schulzke JD. Tumor necrosis factor-alpha (TNF{alpha}) regulates epithelial barrier in the human intestinal cell line HT-29/B6. J Cell Sci 112: 137–146, 1999.[Abstract]
  39. Schurmann G, Bruwer M, Klotz A, Schmid KW, Senninger N, Zimmer KP. Transepithelial transport processes at the intestinal mucosa in inflammatory bowel disease. Int J Colorectal Dis 14: 41–46, 1999.[CrossRef][Web of Science][Medline]
  40. Smith PD, Smythies LE, Mosteller-Barnum M, Sibley DA, Russell MW, Merger M, Sellers MT, Orenstein JM, Shimada T, Graham FM, Kubagawa H. Intestinal macrophages lack CD14 and CD89 and consequently are down-regulated for LPS- and IgA-mediated activities. J Immunol 167: 2651–2656, 2001.[Abstract/Free Full Text]
  41. Smythies LE, Sellers M, Clements RH, Mosteller-Barnum M, Meng G, Benjamin WH, Orenstein JM, Smith PD. Human intestinal macrophages display profound inflammatory anergy despite avid phagocytic and bacteriocidal activity. J Clin Invest 115: 66–75, 2005.[CrossRef][Web of Science][Medline]
  42. Soderholm JD, Streuker C, Yang PC, Paterson C, Singh PK, McKay DM, Sherman PM, Croitoru K, Perdue MH. Increased epithelial uptake of protein antigens in the ileum of Crohn's disease mediated by TNF{alpha}. Gut 53: 1813–1820, 2004.[Abstract/Free Full Text]
  43. Somasundaram S, Sigthorsson G, Simpson RJ, Watts J, Jacob M, Tavares IA, Rafi S, Roseth A, Foster R, Price AB, Wrigglesworth JM, Bjarnason I. Uncoupling of intestinal mitochondrial oxidative phosphorylation and inhibition of cyclooxygenase are required for the development of NSAID-enteropathy in the rat. Aliment Pharmacol Ther 14: 639–650, 2000.[CrossRef][Web of Science][Medline]
  44. Strober W, Fuss I, Mannon P. The fundamental basis of inflammatory bowel disease. J Clin Invest 117: 514–521, 2007.[CrossRef][Web of Science][Medline]
  45. Suenaert P, Bulteel V, Lemmens L, Noman M, Geypens B, Van Assche G, Geboes K, Ceuppens JL, Rutgeerts P. Anti-tumor necrosis factor treatment restores the gut barrier in Crohn's disease. Am J Gastroenterol 97: 2000–2004, 2002.[CrossRef][Web of Science][Medline]
  46. Wang F, Schwarz BT, Graham WV, Wang Y, Su L, Clayburgh DR, Abraham C, Turner JR. IFN-{gamma}-induced TNFR2 expression is required for TNF-dependent intestinal epithelial barrier dysfunction. Gastroenterology 131: 1153–1163, 2006.[CrossRef][Web of Science][Medline]
  47. Watson JL, Ansari S, Cameron H, Wang A, Akhtar M, McKay DM. Green tea polyphenol (-)-epigallocatechin gallate blocks epithelial barrier dysfunction provoked by IFN-{gamma} but not by IL-4. Am J Physiol Gastrointest Liver Physiol 287: G954–G961, 2004.[Abstract/Free Full Text]
  48. Ye D, Ma I, Ma TY. Molecular mechanism of tumor necrosis factor-{alpha} modulation of intestinal epithelial tight junction barrier. Am J Physiol Gastrointest Liver Physiol 290: G496–G504, 2006.[Abstract/Free Full Text]
  49. Zareie M, McKay DM, Kovarik G, Perdue MH. Monocyte/macrophages evoke epithelial dysfunction: indirect role of a tumor necrosis factor {alpha}. Am J Physiol Cell Physiol 275: C932–C939, 1998.[Abstract/Free Full Text]
  50. Zareie M, Singh PK, Irvine J, Sherman PM, McKay DM, Perdue MH. Monocyte/macrophage activation by normal bacteria and bacterial products: implications for epithelial pathophysiology in Crohn's disease. Am J Pathol 158: 1101–1109, 2001.[Abstract/Free Full Text]
  51. Zeissig S, Bojarski C, Buergel N, Mankertz J, Zeitz M, Fromm M, Schulzke JD. Downregulation of epithelial apoptosis and barrier repair in active Crohn's disease by tumour necrosis factor-{alpha} antibody treatment. Gut 53: 1295–1302, 2004.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. Chichlowski and L. P. Hale
Bacterial-mucosal interactions in inflammatory bowel disease--an alliance gone bad
Am J Physiol Gastrointest Liver Physiol, December 1, 2008; 295(6): G1139 - G1149.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
294/3/G669    most recent
00382.2007v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lewis, K.
Right arrow Articles by McKay, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lewis, K.
Right arrow Articles by McKay, D. M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.