Am J Physiol Gastrointest Liver Physiol 295: G187-G196, 2008.
First published May 8, 2008; doi:10.1152/ajpgi.00047.2008
0193-1857/08 $8.00
NEUROREGULATION AND MOTILITY
Gene therapy of Cav1.2 channel with VIP and VIP receptor agonists and antagonists: a novel approach to designing promotility and antimotility agents
Xuan-Zheng Shi1 and
Sushil K. Sarna1,2
1Enteric Neuromuscular Disorders and Visceral Pain Center, Division of Gastroenterology, Department of Internal Medicine, and 2Department of Neuroscience and Cell Biology, The University of Texas Medical Branch at Galveston, Galveston, Texas
Submitted 30 January 2008
; accepted in final form 5 May 2008
 |
ABSTRACT
|
|---|
Recent findings show that the enteric neurotransmitter VIP enhances gene transcription of the
1C subunit of Cav1.2 (L-type) Ca2+ channels in the primary cultures of human colonic circular smooth muscle cells and circular smooth muscle strips. In this study, we investigated whether systemic infusion of VIP in intact animals enhances the gene transcription and protein expression of these channels to accelerate colonic transit. We also investigated whether similar systemic infusions of VPAC1/2 receptor antagonist retards colonic transit by repressing the constitutive gene expression of the
1C subunit. We found that the systemic infusion of VIP for 7 days by a surgically implanted osmotic pump enhances the gene and protein expression of the
1C subunit and circular muscle contractility in the proximal and the middle rat colons, but not in the distal colon. A similar systemic infusion of VPAC1/2 receptor antagonist represses the expression of the
1C subunit and circular smooth muscle contractility in the proximal and the middle colons. The VIP infusion accelerates colonic transit and pellet defecation by rats, whereas the infusion of VPAC1/2 receptor antagonist retards colonic transit and pellet defecation. VPAC1 receptors, but not VPAC2 receptors, mediate the above gene transcription-induced promotility effects of VIP. We conclude that VIP and VPAC1 receptor agonists may serve as potential promotility agents in constipation-like conditions, whereas VPAC receptor antagonists may serve as potential antimotility agents in diarrhea-like conditions produced by enhanced motility function.
diarrhea; constipation; 5-HT; 5-HT4 receptor agonists; prokinetic agents; irritable bowel syndrome
ION CHANNELS PLAY A CRITICAL role in regulating cellular functions in excitable cells. Defects in ion channel function (channelopathy) contribute to diseases, such as muscular dystrophy, multiple sclerosis, and motility dysfunction in gut inflammation (4, 25, 39, 42). Channelopathy may result from gene mutation or epigenetic dysfunction resulting in deregulation of gene transcription (46). The microenvironmental stimuli, such as hormones, inflammatory mediators, neurotransmitters, and growth factors regulate the constitutive transcription of several genes to maintain normal cellular function (15, 23, 26, 33, 38, 40). Consequently, alterations in cellular microenvironment may cause transcriptional channelopathy and cellular dysfunction. We considered this scenario from another viewpoint and asked the question "Could the exogenous administration of a microenvironmental factor that regulates the constitutive transcription of a gene serve as a therapeutic agent by enhancing or repressing the transcription of its target gene(s) in intact animals?"
We addressed this question by investigating whether the exogenous administration of vasoactive intestinal peptide (VIP) in intact animals induces expression of the pore-forming
1C subunit of Cav1.2 (L-type) channels in colonic circular smooth muscle cells to enhance their motility function. We reported previously that VIP enhances the transcription of the Cav1.2
1C subunit in colonic circular smooth muscle strips and primary cultures of human colonic circular smooth muscle cells (38). The enhanced expression of this subunit increases the number of Cav1.2 channels expressed on smooth muscle cells, which results in greater calcium influx in response to ACh or potassium chloride (KCl). The greater influx of calcium, in turn, enhances smooth muscle contractility. The amplitude of contractions is one of the key factors that regulate the propulsion of digesta in the gut (6, 14, 19). Therefore, we hypothesized that exogenous administration of VIP in intact awake animals would accelerate colonic transit by increasing the expression of the
1C subunit of Cav1.2 channels in colonic circular smooth muscle cells. We also hypothesized that VIP is released spontaneously by the enteric neurons in situ to contribute to the normal transcription of the
1C subunit of Cav1.2 channels. Consequently, the inhibition of VIP receptors on colonic circular smooth muscle cells would decrease the expression of the
1C subunit of Cav1.2 channels, cell contractility, and colonic transit. We tested these hypotheses in intact rats.
 |
EXPERIMENTAL METHODS
|
|---|
The Institutional Animal Care and Use Committee of the University of Texas Medical Branch at Galveston, Texas approved this study.
Infusion of VIP and VIP antagonist by an osmotic pump.
Adult male Sprague-Dawley rats, weighing 250 to 325 g (Harlan Sprague Dawley, Indianapolis, IN), were anesthetized with 2% isoflurane inhalation (E-Z anesthesia vaporizer, Palmer, PA). A 7-day microosmotic pump filled with 90 µl of VIP, VPAC1 receptor agonist (Ala11,22,28)-VIP, or VPAC1/2 receptor antagonist [(p-chloro-D-Phe6, Leu17)-VIP, Bachem, King of Prussia, PA] was implanted subcutaneously in the thigh (Fig. 1D). The pump drained into the subcutaneous tissue from where the peptides were absorbed to have systemic effects. The infusion rate was 0.5 µl/h. The rats infused with vehicle served as controls. The number of stool pellets per 24 h was monitored at 2 PM each day. The moisture content of the pellets was determined during the last 3 h of each 24-h period. The mean of pellet collections and their moisture content for 3 days prior to any intervention served as control.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 1. A: serum VIP concentrations in rats before (Ctr.) and 1–7 days after start of VIP infusions by an osmotic pump (n = 4 or 5). B: VIP contents in the muscularis externa tissue of proximal, middle, and distal colons in naive rats (n = 4). C: veratridine (0.1 mM)-evoked VIP release in the muscularis externa tissue of different parts of the colon in naive rats (n = 3). *P < 0.05 vs. control or basal values. D: location of the subcutaneous osmotic pump.
|
|
Tissue harvesting and protein and total RNA extraction.
The rats were euthanized 7 days after implantation of the osmotic pump by inhalation of CO2. Segments 3 to 4 cm long of the proximal colon (starting from
1 cm distal to the cecum), middle colon (starting from
7 cm distal to the cecum), and distal colon (starting from
1 cm oral to the pelvic flexure) were obtained, opened along the mesenteric border, cleaned, and pinned flat in a petri dish with Sylgard base. The longitudinal muscle-myenteric plexus layer, the lamina propria, and the submucosal plexus layer were microdissected and discarded. The remaining colonic circular muscle layer was quick frozen in liquid nitrogen and broken into small particles with a chilled pestle for protein and RNA extraction. The entire muscularis externa was used in some experiments, as specified in RESULTS. The tissue particles were homogenized on ice in lysis buffer and supplemented with protease inhibitors for protein extraction. The total RNA was extracted from tissues by using the Qiagen RNeasy kit (Qiagen, Valencia, CA). The cDNAs were made using the Superscript First-Strand Synthesis System (Invitrogen, Carlsbad, CA).
Western blot analysis.
We used Western blotting to determine protein expression in the rat colonic tissues. Twenty micrograms of protein samples were loaded and run on 8–16% Tris-glycine SDS-PAGE (Invitrogen). The membrane was incubated with 1:400 dilution of
1C antibody (Alomone, Jerusalem, Israel) in Li-Cor buffer at 4°C overnight and 1:10,000 goat anti-rabbit IgG horseradish peroxidase for 1 h at room temperature. The dilutions for VPAC1 and VPAC2 receptor protein antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) were 1:500 and 1:400, respectively. The membrane was scanned and band density was read with Li-Cor imaging unit (Li-Cor Bioscience, Lincoln, NE).
Real-time PCR.
Quantitative real-time polymerase chain reaction assay was used to determine the mRNA expression of
1C subunit, using TaqMan technology on Applied Biosystems 7000 sequence detection system (UTMB Real-Time PCR Core Facility). Applied Biosystems Assays-By-Design containing a 20 x assay mix of primers and TaqMan MGB probes (FAMTM dye-labeled) were used for the target gene. Rat 18s RNA served as the endogenous control. The primers spanned exon-exon junctions to avoid amplification of genomic DNA. All primer and probe sequences were searched against the Celera database to confirm specificity. The probe and primer sequences used were rat Cav1.2 channel
1C intermediate form (Cav1.2b) probe spanning exon 1b and exon 2, CACCAAGGTTCCAACTAT; forward primer, CCATGGTCAATGAGAATACGAGGAT; reverse primer, GCCGCATTGGCATTCATGTT.
Measurement of VIP content and VIP release in muscularis externa.
The proximal, middle, and distal colon segments were harvested, as described above. The muscularis externae were taken for the measurements of VIP content and VIP release using a competitive enzyme immunoassay (EIA) kit (VIP no. S1183) from Peninsula Laboratories (San Carlos, CA). For the measurements of VIP content in the tissues, the tissue was homogenized in PBS with protease inhibitors and the absorbance was read at 450 nm with an Emax precision microplate reader (Molecular Devices, Sunnyvale, CA). For the measurement of VIP release from the myenteric plexus, circular muscle strips including the longitudinal muscle and the myenteric plexus were maintained at 1 g of tension in Krebs buffer at 37°C for 1 h, and medium was collected before and after the addition of neuronal sodium channel activator veratridine (100 µM). The rat serum VIP was measured using a competitive EIA assay kit (VIP no. S1202) from Peninsula Laboratories.
Muscle bath experiments.
Freshly obtained full-thickness colon tissues were stored on ice for no longer than 1 h and then immersed in warm, carbogenated Krebs solution (in mmol/l: 118 NaCl, 4.7 KCl, 2.5 CaC2, 1 NaH2PO4, 1.2 MgCl2, 11 D-glucose, and 25 NaHCO3). The lamina propria was removed by microdissection under magnifying glass and discarded. Circular muscle strips (2 mm x 10 mm) were mounted in muscle baths (Radnoti Glass, Monrovia, CA) filled with 5 ml of carbogenated Krebs solution at 37°C. The contractile activity was recorded with Grass isometric force transducers and amplifiers connected to Biopac data-acquisition system (Goleta, CA). The effects of systemic infusions of VIP or its receptor antagonist were tested by obtaining contractile responses to increasing concentrations of ACh or a single concentration of KCl in the muscle bath. The bathing solution was replaced every 15 min and 4 min after each concentration of ACh. The strips were left to equilibrate for at least 15 min before addition of the next concentration of ACh. The contractile response of circular muscle strips was quantified as the increase in area under contractions during 3 min after addition of ACh or KCl to the bath, over the baseline area under contractions during 3 min prior to the addition of ACh.
Colonic transit.
The colonic transit was measured by the geometric center method (24). A Silastic catheter (1 mm inside diameter and 2.1 mm outside diameter) was implanted under general anesthesia (2% isoflurane inhalation) into the proximal colon, with its tip resting
2 cm distal to the cecum. The rats were allowed to recover from surgery for at least 5 days. A bolus of 1.5 ml of 1.5% methylcellulose (Fisher Scientific, Fair Lawn, NJ) containing 0.75 mg nonabsorbable phenol red was injected into the colon via the catheter, and the catheter was flushed with 0.5 ml saline. Ninety minutes later, the rats were killed by CO2 inhalation. The entire colon distal to the tip of the catheter was removed immediately and divided into six segments of equal length. The contents expelled from the anus during this period were collected and referred to as segment 7 for the measurement of center of gravity. Each segment, along with its contents, was placed in 100 ml of 0.1 N NaOH and homogenized. The homogenate was kept at room temperature for 1 h. Five milliliters of the supernatant were added to 0.5 ml of 20% trichloroacetic acid solution to precipitate the protein. After centrifugation at 10,000 g for 30 min, 4 ml of 0.5 N NaOH were added to the supernatant. Phenol red was determined by measuring the absorption at 560 nm by use of a spectrophotometer (Beckman Instruments, Palo Alto, CA). Colonic transit was calculated as the geometric center of distribution of phenol red described as follows: Geometric center =
(counts of phenol red per segment x segment number).
Statistical analysis.
All data are expressed as means ± SE. Statistical analysis was performed by analysis of variance with nonrepeated measures. Multiple comparisons were made with Student-Newman-Keuls test. The difference between two means was tested by t-test. A P value of < 0.05 was considered statistically significant.
 |
RESULTS
|
|---|
Effect of systemic long-term infusion of VIP or VIP antagonist on smooth muscle contractility and gene expression of
1C.
Published data suggest that the half-elimination time of VIP after a systemic bolus injection in rats is
1 min (16). Therefore, we investigated whether continuous infusion of VIP by a surgically implanted osmotic pump elevates the plasma concentration of VIP for prolonged periods by reaching equilibrium with the degrading peptidases (5, 11, 20). We found that 20 nmol/day infusion of VIP significantly elevates the plasma concentration of VIP from 1.5 ± 0.06 to 2.2 ± 0.02 ng/ml after 24 h (P < 0.05, n = 4) (Fig. 1A). The plasma concentration of VIP remains elevated at about this level throughout the 7-day period of infusion.
We initially tested the efficacy of 1 to 25 nmol/day infusions of VIP to enhance colonic circular smooth muscle contractility in a muscle bath (data not shown). These preliminary experiments suggested an optimal VIP concentration of 20 nmol/day; we used this concentration in all further experiments. The subcutaneous infusion of 20 nmol/day VIP for 7 days significantly enhanced expression of the pore-forming
1C subunit of the Cav1.2 channels in the circular muscle layer of the proximal and the middle colons (Figs. 2, A and B), but not in that of the distal colon (Fig. 2C). The rats infused with an identical volume of 0.9% saline over 7 days by an osmotic pump served as controls. Concurrently, the contractile responses of the colonic circular muscle strips of the VIP-infused rats to ACh (10–7 to 10–2 M) significantly increased in the proximal and the middle colons, compared with those in strips taken from saline-infused rats (Figs. 3, A and B). The 7-day infusion of VIP had no significant effect on the contractile response to ACh in the distal colon. The long-term infusion of VIP also enhanced the contractile response to 60 mM KCl in the proximal and the middle colons, but not in the distal colon (Fig. 3D). We confirmed by quantitative RT-PCR that VIP infusion also increased
1C mRNA in the circular muscle tissue of the proximal colon (0.8 ± 0.4 control vs. 1.35 ± 0.2
1C-to-GAPDH ratio after VIP infusion, n = 4 or 5, *P < 0.05), indicating that the increase in the expression of the
1C protein was due to enhanced transcription of the
1C gene.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 2. Effects of VIP infusion (20 nmol/day) for 7 days on Cav1.2 1C subunit expression in the proximal (A), middle (B), and distal (C) colons (n = 4 or 5, *P < 0.05 vs. VIP–). VIP–, control rats with vehicle infusion; VIP+, rats with VIP infusion.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 3. Effects of VIP infusion (20 nmol/day) on the contractility of the proximal (A), middle (B), and distal (C) colon circular muscle strips in response to 10–6 to 10–2 M ACh. D: effects of VIP infusion (20 nmol/day) on the contractility of the proximal (Prox.), middle (Mid.), and distal (Dist.) colon circular muscle strips in response to 60 mM KCl. AUC, area under contractions. *P < 0.05 vs. control; n = 4 or 5.
|
|
On the other hand, the 7-day infusion of 20 nmol/day VPAC1/2 receptor antagonist (p-chloro-D-Phe6, Leu17)-VIP significantly repressed the expression of the
1C subunit in the proximal and the distal colons, compared with those of the rats infused with saline (Fig. 4). The contractile responses to ACh and KCl were suppressed also in the proximal and the middle colons. VPAC1/2 receptor antagonist did not affect the expression of the
1C subunit in the distal colon (Fig. 4), but the contractile response to ACh at the highest dose and to KCl were suppressed (Fig. 5).

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 4. Effects of 7-day infusion of VIP antagonist (Antag.) (20 nmol/day) on Cav1.2 1C subunit expression in the proximal, middle, and distal colons. *P < 0.05 vs. control; n = 4 or 5.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 5. Effects of infusion of VIP antagonist (20 nmol/day) on contractility of the circular muscle strips from the proximal (A), middle (B), and distal (C) colons in response to 10–6 to 10–2 M ACh. D: effects of infusion of VIP antagonist (20 nmol/day) on contractility of the circular muscle strips from the proximal, middle, and distal colons in response to 65 mM KCl. *P < 0.05 vs. control; n = 4 or 5.
|
|
Expression of VPAC1 and VPAC2 receptors, VIP release, and tissue content of VIP in the rat colon.
We hypothesized that the differential responses of the circular muscle strips to VIP and its receptor antagonist in different parts of the colon may be due to the differential expressions of VPAC1 and VPAC2 receptors along the length of the colon. Immunoblotting with VPAC1 and VPAC2 receptor antibodies showed that the circular muscle layers of the proximal and the middle colons express the VPAC1 receptor protein in significantly greater amounts than that of the distal colon (Fig. 6). By contrast, the circular muscle layer of the distal colon expresses the VPAC2 receptor protein in significantly greater amounts, compared with those in the proximal and the middle colons (Fig. 6). The VIP content of the circular muscle tissue and VIP release by veratridine were not different among the proximal, middle, and distal colons (Figs. 1, B and C).

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 6. Western blot analysis of VPAC1 (A) and VPAC2 (B) receptors in the circular muscle tissue of the proximal, middle, and distal colons in naive rats. *P < 0.05 vs. proximal colon; n = 3.
|
|
Effect of long-term systemic infusion of VPAC1 receptor agonist on smooth muscle contractility and gene expression of
1C.
The greater expression of VPAC1 receptors in the proximal and the middle colons, along with the increase in contractility and the expression of
1C only in these parts of the colon, suggested that VPAC1 receptors might mediate the genomic effects of VIP infusion. We investigated this possibility by infusing (20 nmol/day) a specific VPAC1 receptor agonist [(Ala11,22,28)-VIP, 20 nmol/day], for 7 days by an osmotic pump. We found that the specific VPAC1 receptor agonist also enhances the contractile responses to ACh and KCl, as well as the expression of
1C, in the circular muscle layer of the proximal and middle colons, but not in that of the distal colon (Figs. 7 and 8) .

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 7. Effects of infusion of VPAC1 receptor agonist (20 nmol/day) for 7 days on Cav1.2 1C subunit expression in the proximal, middle, and distal colons. *P < 0.05 vs. control; n = 4. VPAC1–, control with infusion of vehicle; VPAC1+, rats with infusion of VPAC1 receptor agonist.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 8. Effects of infusion of VPAC1 receptor agonist (20 nmol/day) for 7 days on the contractility of the circular muscle strips from the proximal (A), middle (B), and distal (C) colons in response to 10–6 to 10–2 M ACh. D: effects of infusion of VPAC1 receptor agonist (20 nmol/day) for 7 days on the contractility of the circular muscle strips from the proximal, middle, and distal colons in response to 60 mM KCl. *P < 0.05 vs. control; n = 4.
|
|
Effects of long-term systemic infusion of VIP, VPAC1 receptor agonist, and VIP receptor antagonist on colonic transit.
The geometric center determined with the phenol red dye bolus in rats treated with 20 nmol/day VIP or VPAC1 receptor agonist for 7 days was significantly greater than that in rats treated with an identical volume of 0.9% saline (Fig. 9). On the other hand, the geometric center in rats administered with 20 nmol/day VPAC1/2 receptor antagonist was significantly smaller than that in the saline-infused rats.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 9. Effects of infusions of VIP, VPAC1 receptor agonist (Agon.), and VPAC1/2 receptor antagonist for 7 days in colonic transit. *P < 0.05 vs. control; n = 5 or 6.
|
|
Effects of infusion of VIP, VPAC1 receptor agonist, or VPAC1/2 receptor antagonist on the number of pellets and their moisture content.
A continuous systemic infusion of 20 nmol/day VIP or VPAC1 receptor agonist for 7 days by an osmotic pump significantly increased the number of pellets defecated per 24 h from the third day of infusion onward, compared with those in saline-infused rats (Fig. 10). The number of pellets defecated per 24 h also increased significantly when each rat served as its own control. The control data (day 0) represent the average values of 3 days prior to the start of infusion of VIP or VPAC1 receptor agonist. By contrast, the moisture content of the pellets increased by
25% only up to the third day of infusion; thereafter it returned to normal levels. On the contrary, the 7-day systemic infusion of 20 nmol/day VPAC1/2 receptor antagonist significantly reduced the number of pellets defecated per 24 h and their moisture content from day 5 onward, compared with the mean values for 3 days prior to the start of infusion or with saline-infused rats (Fig. 11).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 10. Effects of infusion of VIP (A) and VPAC1 receptor agonist (VPAC1R; B) on the number of fecal pellets defecated per 24 h and their moisture content on day 0 (basal) and days 1, 3, 5, and 7 of infusions. *P < 0.05 vs. day 0 basal control; n = 4 or 6.
|
|

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 11. Effect of infusion of VPAC1/2 receptor antagonist on the number of fecal pellets defecated per 24 h and moisture content on day 0 (basal) and days 1, 3, 5, and 7 after the start of infusion. *P < 0.05 vs. day 0 basal control; n = 4 or 6.
|
|
The infusions of VIP or VPAC1/2 receptor antagonist for 7 days had no significant effect on the food intake per 24 h and gain in body weight during this period. However, the total weight of pellets defecated per 24 h on the seventh day was significantly greater in VIP-infused rats, compared with the saline-infused rats. On the other hand, the total weight of pellets defecated per 24 h in rats infused with VPAC1/2 receptor antagonist was significantly less on the fifth and seventh days of infusion, compared with that of saline-infused rats. These differences may be due to the differences in the moisture content of the pellets in the three groups.
 |
DISCUSSION
|
|---|
We reported previously that the enteric neurotransmitter VIP enhances transcription of the human gene encoding the pore-forming
1C subunit of the Cav1.2 (L-type) calcium channels in the primary cultures of the colonic circular smooth muscle cells and in colonic circular muscle strips (38). This transcription is mediated by the cytosolic accumulation of cAMP, translocation of the catalytic subunit of PKA to the nucleus, and phosphorylation of the promoter-bound transcription factor cAMP response element binding (CREB) protein. The increase in the transcription rate of the
1C subunit results in an increase in the number of the Cav1.2 channels on circular smooth muscle membranes and the total Ca2+ influx through them in response to ACh and KCl (38). The calcium influx through the Cav1.2 channels is an early and essential step in contraction-excitation coupling and hence in smooth muscle contraction (30, 35, 36, 41). The increase in the magnitude of calcium influx enhances the contractility of circular smooth muscle cells (38).
Our findings in this study show that continuous subcutaneous infusion of VIP in intact awake rats for 7 days enhances the mRNA and protein expressions of the
1C subunit of Cav1.2 channels in colonic circular smooth muscle cells. By contrast, a similar infusion of the VPAC1/2 receptor antagonist suppresses the mRNA and protein expressions of the
1C subunit. The increase in the expression of the
1C subunit accelerates colonic transit, whereas its suppression retards it. The systemic infusion of VIP also significantly increases the number of pellets defecated per 24 h from the third day onward. On the contrary, a similar infusion of the VIP antagonist significantly decreases the number of pellets per 24 h from the fifth day onward.
One of the pharmacological effects of VIP is to induce chloride secretion in intestinal epithelial cells (1, 17). We found that the moisture content of the pellets increased significantly on days 1 and 3 of VIP infusion; thereafter it did not differ from that in rats infused with saline. However, the increase in secretion was not copious enough to cause secretary diarrhea, such as that seen in Verner-Morrison syndrome (44). The pellets retained their shape and texture; their moisture content increased only
25% on days 1 and 3 of infusion. The plasma levels of VIP in Verner-Morrison syndrome increase
25- to 300-fold (3). Note that even in normal human subjects the plasma levels of VIP vary within a wide range of 5 to 21 pmol/l (8, 27). The plasma levels of VIP increase about sixfold in patients with gastroesophageal disease, yet they do not present with secretary diarrhea. Our data show that
1.3-fold increase in plasma concentration of VIP is sufficient to enhance transcription of the
1C gene and colonic motility function.
The increase in the moisture content of the pellets in VIP-infused rats occurred only for the first 3 days of infusion. The increase in pellet output started on the third day and it continued up to day 7 of infusion, whereas the moisture content returned to normal values on day 5 onward. The increase in pellet defecation continued after the moisture content had normalized. Therefore, the increase in defecation is likely due to enhanced colonic motility function, rather than due to increase in secretion by the colonic epithelial cells.
The 7-day continuous systemic infusion of VIP receptor antagonist significantly reduced the number of pellets defecated per 24 h from day 5 onward. The moisture content of the pellets also reduced from the fifth day onward. These data suggest that the decrease in moisture content might be due to slower colonic transit, resulting in longer exposure of the pellets to the absorptive mucosal surface.
The decrease in the expression of the
1C subunit by the systemic infusion of VIP receptor antagonist also suggests that VIP is released spontaneously from the enteric neurons in intact animals. This spontaneous release of VIP contributes to the constitutive expression of
1C, which decreases when the VPAC1/2 receptors are blocked.
The rate of elimination of VIP from systemic circulation is fast; half-elimination occurs in
1 min (16, 27). This has led some investigators to conclude that the systemic administration of VIP may be ineffective as a therapeutic agent (32). However, we found that a continuous subcutaneous infusion of VIP by an osmotic pump increases the plasma level of VIP by
25%, which is sustained throughout the 7-day infusion period. Other investigators also found that a continuous infusion of systemic VIP infusion elevates the plasma levels of VIP within
15 min (27).
Our findings show that the systemic infusion of VIP enhances gene transcription and protein expression of the Cav1.2
1C subunit in the proximal and the middle colons, but not in the distal colon. Further investigations found that the protein expression of VPAC1 receptor is about fourfold greater than that of the VPAC2 receptor in the circular muscle layer of the rat proximal and middle colons. On the other hand, the protein expression of the VPAC2 is about fourfold greater than that of VPAC1 receptor in the circular muscle layer of the distal colon. The data from the organ bath experiments showed that the contractile responses to ACh and KCl increase significantly only in the proximal and the middle colons, and not in the distal colon. Together, these findings suggest that the VPAC1 receptors, rather than the VPAC2 receptors, might mediate transcription of the
1C gene. Further data with continuous systemic infusion of the specific VPAC1 receptor agonist confirmed that VPAC1 receptor mediates the
1C gene transcription by VIP. VPAC1 receptor agonist induced the gene expression of
1C subunit and it enhanced the contractile responses to ACh and KCl in the proximal and the distal colon, but not in the distal colon, which expresses predominantly the VPAC2 receptors. Other reports show that VPAC2 and PAC1, rather than the VPAC1, receptors, mediate the inhibitory motor effect of VIP in the rat jejunum (43).
VIP is also one of the putative inhibitory neurotransmitters in the gut. The exogenous administration of VIP or its release from the enteric inhibitory motor neurons by electrical field stimulation relaxes precontracted smooth muscle strips (2, 13, 22). However, the findings on the physiological role of the endogenously released VIP in mediating the ongoing inhibition of contractions or descending inhibition are inconclusive and they depend on the experimental model used (9, 12, 21, 29, 31, 34, 43). In our hands, 100-fold greater concentrations of VIP are required to induce the inhibition of spontaneous contractions than those required to induce the gene expression of the
1C subunit of the Cav1.2 calcium channels (38). It is likely that the basal release of VIP at low concentrations may induce gene expression, but when VIP is released in a burst in response to a stimulus, it also causes inhibition of contractions. It is likely that the infusion of VIP in our study accelerated colonic transit predominantly by enhancing the gene expression of the
1C subunit. A pharmacological effect of systemic infusion of VIP would suppress contractions and hence retard colonic transit, but this was not observed.
Gene therapy means delivery of a beneficial effect by targeting or employing a gene. This definition is consistent with those of the other forms of therapy, such as pharmacotherapy, radiation therapy, and physiotherapy. There are two major requirements for a gene to contribute to cell phenotype. The first is that it must have the correct sequence to transcribe the correct messenger RNA, which then translates into the correct protein the gene codes. However, a correct coding sequence alone is insufficient to determine phenotype. For example, monozygotic twins (10) have identical DNA sequences, but their phenotypes or susceptibilities to disease may differ because of differential expression of their genes. Therefore, the second requirement for a gene to contribute to phenotype is that the signaling pathways from the cell membrane to the gene promoter and the epigenetic mechanisms are functioning to induce the expression of that gene at an appropriate level in response to environmental stimuli (7). A deficiency in the signaling pathways or the epigenetic mechanisms would compromise organ function even when the coding sequence of the gene is correct. The initial approach in gene therapy was to insert a correct coding sequence of the gene whose mutation caused the disease, such as that in severe combined immunodeficiency, cystic fibrosis, and hemophilia. This approach has yielded partial success, and it also faces several challenges related to delivery systems, stability of the integrated gene, duration of its expression, and potential adverse side effects. Alternately, a beneficial effect of gene therapy can be achieved by modulating the expression of a correct gene coding sequence (7, 28). Our findings show that modulating the expression of a healthy gene has the potential to deliver beneficial therapeutic effects in colonic motor dysfunction.
The gene therapy with VIP, VPAC1 receptor agonists, and VPAC1/2 receptor antagonists is a novel approach to developing promotility and antimotility agents. These agents enhance or retard motility function by enhancing or repressing the transcription of an ion channel protein, the pore-forming
1C subunit of Cav1.2 channels, in smooth muscle cells (channelo-therapy). The advantages of this novel class of pro- and antimotility agents are as follows: 1) They act at the end of the chain of regulatory mechanisms [sensory neurons, interneurons, motor neurons, myogenic generation of slow waves, and circular smooth muscle excitation-contraction coupling (Fig. 12)] that regulate the spatiotemporal patterns postprandial contractions (35). Therefore, this approach would not upset the normal equilibrium between the excitatory and inhibitory neuronal inputs that contribute to the generation of effective spatiotemporal patterns of postprandial contractions. 2) If motility dysfunction is due to a defect at any location in the enteric neurons, it should not block the action of VIP, its analogs, or its receptor agonists and antagonists, because they act directly on smooth muscle cells. On the other hand, a defect in the interneurons or motor neurons may attenuate or block the therapeutic signal generated by 5-HT4 receptor agonists from reaching the neuromuscular junction. The 5-HT4 receptor agonists act near the beginning the regulatory chain (Fig. 12) (9). This might be one of the reasons that make the existing promotility agents marginally effective or not effective in all constipated patients (18). 3) The transcriptional modulation of Cav1.2 channels by VIP-related compounds would not interfere with the generation of slow waves in smooth muscle cells, which is independent of these channels (45). 4) The gene expression of constitutively expressed cellular proteins is regulated tightly. This would reduce the possibility of significant overcompensation of motility function in either direction. 5) The therapeutic effects resulting from the gene expression of proteins are steady and sustained over longer periods, compared with those obtained by nontranscriptional pharmacological agents. The therapeutic effect of a pharmacological agent waxes and wanes at the frequency of its administration. 6) The concentration of VIP that induces gene expression is
100-fold less than that which causes pharmacological inhibition of contractions (4, 38). Receptor internalization and refractoriness are less likely at lower concentrations. A limitation of using VIP as a therapeutic agent is that it its oral administration would be ineffective; the digestive enzymes will cleave it.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 12. Schematic diagram to show the organization of enteric neurons and circular smooth muscle cells to regulate the occurrence of gut contractions. The presence of digesta in the gut lumen is detected by the intrinsic sensory neurons (ISN) with their nerve endings in the mucosa. These neurons transmit coded signals to both the excitatory and inhibitory motor neurons via a chain of interneurons to release the excitatory (ACh) and inhibitory (NO, VIP) neurotransmitters at the neuromuscular junction. This neural input, along with the slow waves generated in circular smooth muscle cells and the excitation-contraction and excitation-inhibition couplings stimulated by ACh and NO, generates the spatiotemporal patterns of postprandial contractions, which are effective in net slow distal propulsion and mixing. The 5-HT4 receptor agonists act on receptors on the intrinsic sensory neurons to stimulate the release of ACh at the neuromuscular junction. However, VIP acts directly on its receptors on smooth muscle cells to enhance the gene expression of the Cav1.2 1C subunit, which in turn potentiates smooth muscle contractions without altering the spatiotemporal patterns of postprandial contractions. N, nicotinic receptor; M3, muscarnic receptor.
|
|
In this study, we have focused on gene expression of the
1C subunit of the Cav1.2 channels by VIP and its related compounds. As stated earlier, VIP induces transcription of this gene by activating the transcription factor CREB. We cannot rule out that the activation of CREB also modulates the transcription of other genes in smooth muscle cells or the enteric neurons to affect the motility function. However, the overall effect of VIP infusion is to enhance colonic transit and motility function. A potential contribution of other genes may be one reason that the infusion of VPAC1/2 receptor antagonist did not alter the expression of the
1C subunit in the distal colon, but it suppressed the contractile response to ACh at the highest concentration.
In conclusion, long-term continuous systemic administration of VIP and VPAC1 receptor agonist accelerates colonic transit by enhancing transcription of the gene encoding the pore-forming
1C subunit of the Cav1.2 channels in the proximal and the middle colons. On the contrary, a similar administration of VPAC1/2 receptor antagonist suppresses the expression of the
1C subunit and retards colonic transit. Therefore, VIP and VPAC1 receptor agonists may serve as effective promotility agents in constipation-like conditions, and VPAC1 receptor antagonists may serve as antidiarrheal agents, when diarrhea (frequent bowel movements) results from enhanced motility function. Our findings also show that endogenous VIP is released spontaneously from the enteric neurons and it contributes to the constitutive expression of Cav1.2 channels. The novel approach in the use of VIP as a gene therapeutic promotility agent is that it potentiates motility function by altering the gene expression of a key protein of the excitation-contraction coupling in circular smooth muscle cells, which does not interfere with the generation of normal spatiotemporal patterns of postprandial contractions.
 |
GRANTS
|
|---|
This research was supported in part by National Institute of Diabetes and Digestive and Kidney Diseases Grants DK-072414 and DK-32346.
 |
FOOTNOTES
|
|---|
Address for reprint requests and other correspondence: S. K. Sarna, Division of Gastroenterology, Dept. of Internal Medicine, The Univ. of Texas Medical Branch at Galveston, 9.138 Medical Research Bldg., Galveston, TX 77555-1064 (e-mail: sksarna{at}utmb.edu)
The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
 |
REFERENCES
|
|---|
- Barbezat GO, Grossman MI. Intestinal secretion: stimulation by peptides. Science 174: 422–424, 1971.[Abstract/Free Full Text]
- Biancani P, Walsh J, Behar J. Vasoactive intestinal peptide: a neurotransmitter for relaxation of the rabbit internal anal sphincter. Gastroenterology 89: 867–874, 1985.[Web of Science][Medline]
- Bloom SR, Polak JM, Pearse AG. Vasoactive intestinal peptide and watery-diarrhoea syndrome. Lancet 2: 14–16, 1973.[Web of Science][Medline]
- Cannon SC. Pathomechanisms in channelopathies of skeletal muscle and brain. Annu Rev Neurosci 29: 387–415, 2006.[CrossRef][Web of Science][Medline]
- Caughey GH, Leidig F, Viro NF, Nadel JA. Substance P and vasoactive intestinal peptide degradation by mast cell tryptase and chymase. J Pharmacol Exp Ther 244: 133–137, 1988.[Abstract/Free Full Text]
- Cowles VE, Sarna SK. Relation between small intestinal motor activity and transit in secretory diarrhea. Am J Physiol Gastrointest Liver Physiol 259: G420–G429, 1990.[Abstract/Free Full Text]
- Esteller M. Epigenetics in cancer. N Engl J Med 358: 1148–1159, 2008.[Free Full Text]
- Fahrenkrug J, Schaffalitzky de Muckadell OV. Radioimmunoassay of vasoactive intestinal polypeptide (VIP) in plasma. J Lab Clin Med 89: 1379–1388, 1977.[Web of Science][Medline]
- Foxx-Orenstein AE, Grider JR. Regulation of colonic propulsion by enteric excitatory and inhibitory neurotransmitters. Am J Physiol Gastrointest Liver Physiol 271: G433–G437, 1996.[Abstract/Free Full Text]
- Fraga MF, Ballestar E, Paz MF, Ropero S, Setien F, Ballestar ML, Heine-Suner D, Cigudosa JC, Urioste M, Benitez J, Boix-Chornet M, Sanchez-Aguilera A, Ling C, Carlsson E, Poulsen P, Vaag A, Stephan Z, Spector TD, Wu YZ, Plass C, Esteller M. Epigenetic differences arise during the lifetime of monozygotic twins. Proc Natl Acad Sci USA 102: 10604–10609, 2005.[Abstract/Free Full Text]
- Goetzl EJ, Sreedharan SP, Turck CW, Bridenbaugh R, Malfroy B. Preferential cleavage of amino- and carboxyl-terminal oligopeptides from vasoactive intestinal polypeptide by human recombinant enkephalinase (neutral endopeptidase, EC 3.42411). Biochem Biophys Res Commun 158: 850–854, 1989.[CrossRef][Web of Science][Medline]
- Gonzalez A, Sarna SK. Neural regulation of in vitro giant contractions in the rat colon. Am J Physiol Gastrointest Liver Physiol 281: G275–G282, 2001.[Abstract/Free Full Text]
- Grider JR, Makhlouf GM. Prejunctional inhibition of vasoactive intestinal peptide release. Am J Physiol Gastrointest Liver Physiol 253: G7–G12, 1987.[Abstract/Free Full Text]
- Haba T, Sarna SK. Regulation of gastroduodenal emptying of solids by gastropyloroduodenal contractions. Am J Physiol Gastrointest Liver Physiol 264: G261–G271, 1993.[Abstract/Free Full Text]
- Hai CM. Airway smooth muscle cell as therapeutic target of inflammation. Curr Med Chem 14: 67–76, 2007.[CrossRef][Web of Science][Medline]
- Hassan M, Refai E, Andersson M, Schnell PO, Jacobsson H. In vivo dynamical distribution of 131I-VIP in the rat studied by gamma-camera. Nucl Med Biol 21: 865–872, 1994.[CrossRef][Web of Science][Medline]
- Hubel KA. Intestinal nerves and ion transport: stimuli, reflexes, and responses. Am J Physiol Gastrointest Liver Physiol 248: G261–G271, 1985.[Abstract/Free Full Text]
- Johanson JF, Wald A, Tougas G, Chey WD, Novick JS, Lembo AJ, Fordham F, Guella M, Nault B. Effect of tegaserod in chronic constipation: a randomized, double-blind, controlled trial. Clin Gastroenterol Hepatol 2: 796–805, 2004.[CrossRef][Medline]
- Johnson CP, Sarna SK, Baytiyeh R, Zhu YR, Cowles VE, Telford GL, Roza AM, Adams MB. Postprandial motor activity and its relationship to transit in the canine ileum. Surgery 121: 182–189, 1997.[CrossRef][Web of Science][Medline]
- Kobayashi R, Chen Y, Lee TD, Davis MT, Ito O, Walsh JH. Degradation of vasoactive intestinal polypeptide by rabbit gastric smooth muscle membranes. Peptides 15: 323–332, 1994.[CrossRef][Web of Science][Medline]
- Kumano K, Fujimura M, Oshima S, Yamamoto H, Hayashi N, Nakamura T, Fujimiya M. Effects of VIP and NO on the motor activity of vascularly perfused rat proximal colon. Peptides 22: 91–98, 2001.[CrossRef][Web of Science][Medline]
- Lefebvre RA. Study on the possible neurotransmitter of the non-adrenergic non-cholinergic innervation of the rat gastric fundus. Arch Int Pharmacodyn Ther 280: 110–136, 1986.[Web of Science][Medline]
- Li H, Liu JP. Mechanisms of action of TGF-beta in cancer: evidence for Smad3 as a repressor of the hTERT gene. Ann NY Acad Sci 1114: 56–68, 2007.[CrossRef][Web of Science][Medline]
- Liu S, Chen JD. Colonic electrical stimulation regulates colonic transit via the nitrergic pathway in rats. Dig Dis Sci 51: 502–505, 2006.[CrossRef][Web of Science][Medline]
- Liu X, Rusch NJ, Striessnig J, Sarna SK. Down-regulation of L-type calcium channels in inflamed circular smooth muscle cells of the canine colon. Gastroenterology 120: 480–489, 2001.[CrossRef][Web of Science][Medline]
- McCarthy MM. Estradiol and the developing brain. Physiol Rev 88: 91–134, 2008.[Abstract/Free Full Text]
- Mitchell SJ, Bloom SR. Measurement of fasting and postprandial plasma VIP in man. Gut 19: 1043–1048, 1978.[Abstract/Free Full Text]
- Morishita R, Aoki M, Kaneda Y, Ogihara T. Gene therapy in vascular medicine: recent advances and future perspectives. Pharmacol Ther 91: 105–114, 2001.[CrossRef][Web of Science][Medline]
- Murr MM, Balsiger BM, Farrugia G, Sarr MG. Role of nitric oxide, vasoactive intestinal polypeptide, and ATP in inhibitory neurotransmission in human jejunum. J Surg Res 84: 8–12, 1999.[CrossRef][Web of Science][Medline]
- Murthy KS. Signaling for contraction and relaxation in smooth muscle of the gut. Annu Rev Physiol 68: 345–374, 2006.[CrossRef][Web of Science][Medline]
- Okishio Y, Niioka S, Yamaji M, Yamazaki Y, Nishio H, Takeuchi T, Hata F. Mediators of nonadrenergic, noncholinergic relaxation in Sprague Dawley rat intestine: comparison with the mediators of other strains. J Vet Med Sci 62: 821–828, 2000.[CrossRef][Web of Science][Medline]
- Onoue S, Yamada S, Yajima T. Bioactive analogues and drug delivery systems of vasoactive intestinal peptide (VIP) for the treatment of asthma/COPD. Peptides 28: 1640–1650, 2007.[CrossRef][Web of Science][Medline]
- Pazdrak K, Shi XZ, Sarna SK. TNFalpha suppresses human colonic circular smooth muscle cell contractility by SP1- and NF-kappaB-mediated induction of ICAM-1. Gastroenterology 127: 1096–1109, 2004.[CrossRef][Web of Science][Medline]
- Sarna SK. Enteric descending and afferent neural signaling stimulated by giant migrating contractions: essential contributing factors to visceral pain. Am J Physiol Gastrointest Liver Physiol 292: G572–G581, 2007.[Abstract/Free Full Text]
- Sarna SK. Molecular, functional and pharmacological targets for the development of gut promotility drugs. Am J Physiol Gastrointest Liver Physiol 291: G545–G555, 2006.[Abstract/Free Full Text]
- Sarna SK, Shi XZ. Function and regulation of colonic contractions in health and disease. In: Physiology of the Gastrointestinal Tract (4th ed.), edited by Johnson LR, Barrett KE, Ghishan FK, Merchant JL, Said H, and Wood JD. San Diego, CA: Elsevier, 2006, p. 965–993.
- Shi XZ, Choudhury BK, Pasricha PJ, Sarna SK. A novel role of VIP in colonic motility function: induction of excitation-transcription coupling in smooth muscle cells. Gastroenterology 132: 1388–1400, 2007.[Medline]
- Shi XZ, Lindholm PF, Sarna SK. NF-kappa B activation by oxidative stress and inflammation suppresses contractility in colonic circular smooth muscle cells. Gastroenterology 124: 1369–1380, 2003.[CrossRef][Web of Science][Medline]
- Shi XZ, Pazdrak K, Saada N, Dai B, Palade P, Sarna SK. Negative transcriptional regulation of human colonic smooth muscle Cav1.2 channels by p50 and p65 subunits of nuclear factor-kappaB. Gastroenterology 129: 1518–1532, 2005.[CrossRef][Web of Science][Medline]
- Shi XZ, Sarna SK. Impairment of Ca2+ mobilization in circular muscle cells of the inflamed colon. Am J Physiol Gastrointest Liver Physiol 278: G234–G242, 2000.[Abstract/Free Full Text]
- Smith KJ. Sodium channels and multiple sclerosis: roles in symptom production, damage and therapy. Brain Pathol 17: 230–242, 2007.[CrossRef][Web of Science][Medline]
- Vanneste G, Robberecht P, Lefebvre RA. Inhibitory pathways in the circular muscle of rat jejunum. Br J Pharmacol 143: 107–118, 2004.[CrossRef][Web of Science][Medline]
- Verner JV, Morrison AB. Islet cell tumor and a syndrome of refractory watery diarrhea and hypokalemia. Am J Med 25: 374–380, 1958.[CrossRef][Web of Science][Medline]
- Ward SM, Sanders KM. Upstroke component of electrical slow waves in canine colonic smooth muscle due to nifedipine-resistant calcium current. J Physiol 455: 321–337, 1992.[Abstract/Free Full Text]
- Waxman SG. Transcriptional channelopathies: an emerging class of disorders. Nat Rev Neurosci 2: 652–659, 2001.[Web of Science][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
X.-Z. Shi and S. K. Sarna
Homeostatic and therapeutic roles of VIP in smooth muscle function: myo-neuroimmune interactions
Am J Physiol Gastrointest Liver Physiol,
October 1, 2009;
297(4):
G716 - G725.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. K. Choudhury, X.-Z. Shi, and S. K. Sarna
Norepinephrine mediates the transcriptional effects of heterotypic chronic stress on colonic motor function
Am J Physiol Gastrointest Liver Physiol,
June 1, 2009;
296(6):
G1238 - G1247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. K. Choudhury, X.-Z. Shi, and S. K. Sarna
Gene plasticity in colonic circular smooth muscle cells underlies motility dysfunction in a model of postinfective IBS
Am J Physiol Gastrointest Liver Physiol,
March 1, 2009;
296(3):
G632 - G642.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2008 by the American Physiological Society.