AJP - GI Ad Instruments
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 295: G305-G312, 2008. First published June 12, 2008; doi:10.1152/ajpgi.90229.2008
0193-1857/08 $8.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figure
Right arrow All Versions of this Article:
295/2/G305    most recent
ajpgi.90229.2008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by He, Y.
Right arrow Articles by Klein, A. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by He, Y.
Right arrow Articles by Klein, A. S.

LIVER AND BILIARY TRACT

Interaction of CD44 and hyaluronic acid enhances biliary epithelial proliferation in cholestatic livers

Yao He,1 Gordon D. Wu,1 Tomohito Sadahiro,1 Sang-Ik Noh,1 Hong Wang,1 Dodanim Talavera,1 Haimei Wang,1 John M. Vierling,2 and Andrew S. Klein1

1Comprehensive Transplant Center, Department of Surgery, Cedars-Sinai Medical Center, Los Angeles, California; 2Department of Hepatology, Baylor College of Medicine, Houston, Texas

Submitted 10 March 2008 ; accepted in final form 8 June 2008


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Biliary epithelia express high levels of CD44 in hepatobiliary diseases. The role of CD44-hyaluronic acid interaction in biliary pathology, however, is unclear. A rat model of hepatic cholestasis induced by bile duct ligation was employed for characterization of hepatic CD44 expression and extracellular hyaluronan distribution. Cell culture experiments were employed to determine whether hyaluronan can regulate cholangiocyte growth through interacting with adhesion molecule CD44. Biliary epithelial cells were found to express the highest level of CD44 mRNA among four major types of nonparenchymal liver cells, including Kupffer, hepatic stellate, and liver sinusoidal endothelial cells isolated from cholestatic livers. CD44-positive biliary epithelia lining the intrahepatic bile ducts were geographically associated with extracellular hyaluronan accumulated in the portal tracts of the livers, suggesting a role for CD44 and hyaluronan in the development of biliary proliferation. Cellular proliferation assays demonstrated that cholangiocyte propagation was accelerated by hyaluronan treatment and antagonized by small interfering RNA CD44 or anti-CD44 antibody. The study provides compelling evidence to suggest that proliferative biliary epithelia lining the intrahepatic bile ducts are a prime source of hepatic CD44. CD44-hyaluronan interaction, by enhancing biliary proliferation, may play a pathogenic role in the development of cholestatic liver diseases.

bile duct ligation; biliary epithelial cell; small interfering RNA


CD44 IS A MULTIFUNCTIONAL cell adhesion molecule that takes part in essential cell-cell and cell-matrix interactions (2, 3). CD44 is constitutively expressed by the majority of hematopoietic, mesenchymal, epithelial, endothelial, and neural cells (2, 3, 11). Cell surface CD44 can be present as either the standard isoform or as variant isoforms in a cell-specific manner (2, 32). The structural diversity of CD44 isoforms correlates with a diverse array of overlapping yet distinct functions in cell adhesion, migration, and proliferation (10, 18, 23). Alternations in CD44 expression have been documented in tissue inflammation, wound healing, and tumor metastasis (16) (5, 8, 37, 39).

Hyaluronic acid (HA), the main component of extracellular matrices (ECM), is the prime ligand of CD44. HA serves both as a structural element of ECM and as a signaling molecule (17, 24, 35). CD44-HA interaction can activate signaling cascades that contribute to biological processes such as cell adhesion, migration, and proliferation (9, 17, 24, 26, 35). High titers of serum HA are reported in patients with inflammation, malignancies, and liver diseases (14, 19, 25, 27).

In normal livers, parenchymal cells (hepatocytes) do not express CD44, whereas nonparenchymal liver cells (NPLC) express CD44 constitutively (5, 16, 30, 31). In injured livers, all major NPLC including hepatic stellar cells (HSC), liver sinusoidal endothelial cells (LSEC), Kupffer cells (KC), and biliary epithelial cells (BEC) increase their expression of CD44 (5, 16, 30, 31). High levels of hepatic CD44 expression have been observed in patients with cholangiopathies such as primary sclerosing cholangitis and hepatobiliary malignancy such as cholangiocarcinoma (5, 20, 39, 40). The observations suggest that biliary epithelia in cholestatic microenvironment are primed to increase CD44 expression. However, the pathological significance of CD44 expression by BEC is poorly understood.

The aim of this study was to explore the role that CD44-HA interaction plays in the development of cholestatic liver disease. For this purpose, a rat model of common bile duct ligation (BDL) was used. Experiments were designed to characterize hepatic CD44 expression by different NPLC, with focus on BEC and HA expression in the cholestatic livers. Cell proliferation experiments were conducted to qualify the role of CD44-HA interaction involved in biliary proliferation. The results of the study clearly demonstrated that 1) BEC are the major source of CD44 expressed in the cholestatic livers and that 2) HA treatment promotes BEC proliferation through CD44-HA interaction.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Animals and BDL

Male Fischer 344 rats weighing 200–250 g were purchased from Harland Sprague Dawley (Indianapolis, IN). The rats were housed in a rodent facility at Cedars-Sinai Medical Center and received humane care in compliance with the Principles of Laboratory Animal Care (National Society for Medical Research) and the Guide for the Care and Use of Laboratory Animals (NIH Publication No. 86-23, revised 1985). The study was approved by the Institutional Animal Care and Use Committee of Cedars-Sinai Medical Center.

BDL was carried out under anesthesia by double ligation of the common bile duct with 4-0 cotton suture followed by resection of the intervening segment (1). Sham-operated control consisted of manipulation of the common bile duct without ligation.

Isolation of NPLC

A two-step perfusion and gradient centrifugation method was used to obtain total liver cells (28, 33). The collagenase-dispersed total liver cells were washed in PBS and then centrifuged at 50 g to remove hepatocytes. The resulting supernatant was centrifuged at 350 g for 5 min to obtain enriched NPLC.

BEC. BEC were obtained using a method described previously (28, 33). Briefly, the NPLC pellet was resuspended in 32% Percoll (Sigma-Aldrich, St. Louis, MO) in Leibovitz L-15 culture medium (Invitrogen, Carlsbad, CA). A sample (4 ml) of this cell suspension was layered on top of Percoll gradient layers (4 ml of 50% Percoll and 4 ml of 90% Percoll) and centrifuged at 2,000 g for 12 min at 4°C. The cell fraction banded between 1.065 g/cm3 and 1.075 g/cm3 was recovered as enriched BEC. The purity of the recovered cells as biliary epithelia was verified by flow cytometric detection of the cells stained with a mouse monoclonal (RCK 105) to CK-7 (Abcam, Cambridge, MA).

HSC. HSC were isolated using a standard procedure involving isotonic Percoll gradient centrifugation (38). HSC, which are enriched in the cell fraction banded at the top of the Percoll gradient (density ≤ 1.05g/cm3), were collected. The purity of the resulting HSC was verified by fluorescent microscopic observation of cellular UV emission at wavelength 350 nm.

KC and LSEC. Both KC and LSEC were isolated from NPLC preparations with the use of fluorescence-activated cell sorter (FACS; MoFlo/DakoCytomation, Carpinteria, CA). A mouse anti-rat CD163 monoclonal antibody (ED2-PE; AbD Serotec, Raleigh, NC) was used to label hepatic macrophages (29). A mouse anti-rat CD31 monoclonal (MCA1334-FITC, Serotec) was used to label endothelia (15). The purity of the sorted cells was verified by flow cytometry following cell sorting.

Quantitative Real-time PCR

Quantitative amplification of the cDNA templates was carried out using a QuantiTect SYBR Green PCR kit (Qiagen, Valencia, CA) in a TaqMan ABI PRISM 7300 real-time PCR system (Applied Biosystems, Foster City, CA). The primer pairs used for amplification of rat CD44 genes encoding the standard (E5) and variant (v1 to v10) isoforms were described in a previous publication (41). Other primers used for the study are listed as the following: rat Ki67 gene (forward, ACACAGTGGTAGATGCA ACCAGAGT; reverse, GTGAAATCAGCTGCACCTTCTAGAG), mouse CD44 E5 gene (forward, CAGCCTACTGGAGATCAGGATGA; reverse, GGAGTCCTTGGA TGAGTCTCGA), and mouse Ki67 gene (forward, CCTTTGCTGTCCCCGAAGA; reverse, GGCTTCTCATCTGTTGCTTCCT). Negative control was included in each run in which the template was replaced by an equal volume of water. Amplification of GAPDH mRNA was used as the loading control. The absolute levels of the mRNA were normalized with respect to GAPDH mRNA content. Samples per group were run in triplicate. To exclude nonspecific amplification, the amplified samples were examined in electrophoresis on 2% agarose gel.

HA Treatment of BEC

Freshly isolated BEC from rat livers and an immortalized mouse intrahepatic BEC line (mIBEC) were used for this experiment. The mIBEC was reported retaining the phenotype of mouse BEC and the ability of forming duct-like structures after in vivo injection (13). Six-well culture plates were precoated with HA (0.25 mg/ml, 300 µl/well, and HA potassium salt, Sigma-Aldrich) and air dried overnight. Rat BEC or mIBEC was seeded in the HA-coated plates and cultured in BEC medium containing 1 part of DMEM and 1 part of F12 medium, 1% FBS, and antibiotics (13). The cells were procured at different time points for examination of CD44 and Ki67 gene expression.

Cell Proliferation Assay and Anti-CD44 Blocking

mIBEC (104/well in BEC medium with 1% FBS) were seeded in a 96-well plate precoated with HA (0.25 mg/ml). Control cultures were placed in plates without HA coating. The cholangiocytes were allowed to grow in culture and collected at designated time points from 24 to 96 h. Cell proliferation was determined by using a CellTiter 96 Aqueous One Solution Cell Proliferation Assay, which employs a colorimetric method for determining the number of viable cells (Promega, Madison, WI). To block interaction between cell surface CD44 and HA, an anti-mouse CD44 neutralizing antibody (rat IgG, clone IM7, LEAF (low endotoxin, azide free) purified, without preservative; Biolegend, San Diego, CA) was used to treat the cultured cells (4). The neutralizing antibody was added to the cultures at a concentration of 10 µl/ml medium at 30 min after seeding. A rat IgG (10 µl/ml) was used as isotype control.

RNA Silencing

Small interfering RNA (siRNA) for mouse CD44 was designed according to the sequence of the mouse CD44 gene [NCBI accession number AJ251594 (GenBank)] obtained from the online database of the National Center for Biotechnology Information (NCBI; Bethesda, MD). A sequence, 5'-CCACAUCAG CAGAUCGAUUTT-3' (sense strand complementary to the exon 1 of the mouse CD44 gene), was chosen and verified in a basic local alignment search tool search of the database. The siRNA CD44 and a siRNA scrambled control were synthesized by Invitrogen.

mIBEC at 30–35% confluence were transfected with siRNA CD44 in 5 ml of complete medium in T-25 flasks. Transfections were performed with 200 pmol of siRNA using lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. The cells were then studied for quantitative real-time PCR (qPCR), flow cytometry, and proliferation assay as described above.

Flow Cytometric Antibody Binding Assay

mIBEC were resuspended in cold PBS (pH 7.2) at a concentration of 1 x 107 cells/ml. A sample (100 µl) of cell suspension (1 x 106 cells) were stained with FITC-conjugated anti-mouse CD44 antibody (Biolegend). A mouse IgG2a isotype-FITC (eBioscience, San Diego, CA) was used as isotype-matched control. Flow cytometric analysis was performed in a FACScan (DakoCytomation).

Immunohistochemistry

CD44 protein expression in liver tissue was detected by staining of cryostat sections (6 µm) with a FITC-conjugated anti-CD44 antibody (Millipore, Billerica, MA). Biliary epithelia were stained with a mouse monoclonal anti-CK-7 antibody (Abcam) and followed by a phycoerythrin (PE)-conjugated donkey anti-mouse IgG polyclonal antibody (Abcam). Hepatic distribution of HA was measured by staining of the liver sections with a biotin-conjugated HA binding protein (HABP; Seikagaku America, East Falmouth, MA). Colorization of the stained sections was realized by using a streptavidin-horseradish peroxidase (HRP) kit (Zymed, San Francisco, CA) in which a 3-amino-9-ethylcrbazole substrate for HRP was used as chromogen. Control slides were preincubated with hyaluronidase (50 U/ml) at 37°C overnight and followed by HABP staining. Hepatic fibrosis was demonstrated with Sirius red staining (Sigma-Aldrich).

Statistics Analysis

Results of experimental data were reported as means ± SD. Significance levels were determined by the Mann-Whitney test with Medical Statistic software (MedCalc, Mariakerke, Belgium). Kolmogorov-Smirnov analysis, which was used to determine statistical significance of CD44 antibody binding data detected by flow cytometry, was performed with a Cellquest program (DakoCytomation).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Isolation of NPLC. A total of 18 liver samples, including six from bile duct ligated rats at day 7 (BDL-D7), six from bile duct ligated rats at day 18 (BDL-D18), and six from sham-operated control rats (control), were obtained for the study. The cell separation techniques used in this study yielded fractions of BEC, HSC, LSEC, and KC from rat livers (Supplemental Fig. 1). Supplemental material for this article is available online at the American Journal of Physiology Gastrointestinal and Liver Physiology website. The purity of isolated BEC was ~95% as determined by anti-CK-7 staining by flow cytometry. BEC in primary culture displayed typical morphology of bile duct epithelium. Contaminants of the BEC fraction were mainly hepatocytes, which are CD44 negative (5). The purity of HSC fraction was ~90% as determined by their autofluorescent emission at 328 nm (36). The contaminants in this fraction were also mainly hepatocytes. The purity of CD31+ LSEC was around 98%, and the purity of KC fraction, which is ED2+, was 96% as determined by flow cytometry.

BEC markedly increased CD44 mRNA expression. Primer pairs specific to CD44 E5 gene were used for amplification of CD44 mRNA by qPCR. CD44 mRNA expression was as high as 2.6-fold in the BDL-D7 livers (P < 0.05) and 26-fold in the BDL-D18 livers when compared with the sham control (P < 0.01, Fig. 1A). CD44 expression by BEC, KC, HSC, LSEC isolated from control, BDL-D7, and BDL-D18 livers was also examined. As illustrated in Fig. 1B, CD44 mRNA expressed by BEC from the cholestatic livers increased incrementally, with the highest levels seen in the D18 livers. CD44 expression by BEC isolated from BDL-D7 livers was 17-fold, 19-fold, and 2.5-fold higher than that expressed by KC (P < 0.01), HSC (P < 0.01), and LSEC (P < 0.01) isolated from the same livers. CD44 mRNA expressed by BEC from the BDL-D18 livers was eightfold, eightfold and fivefold higher than that expressed by KC, HSC, and LSEC (P < 0.01, respectively). CD44 mRNA expressed by LSEC increased significantly in BDL-D7 group when compared with sham controls (P < 0.05) but decreased in D18 group. In addition, CD44 mRNA expressed by HSC or KC was significantly upregulated in the BDL-D18 group compared with the control and D7 group (P < 0.05, respectively).


Figure 1
View larger version (12K):
[in this window]
[in a new window]

 
Fig. 1. CD44 expression by nonparenchymal liver cells (NPLC) detected by quantitative real-time PCR (qPCR). A: expression of CD44 mRNA in sham control and cholestatic livers. BDL-D7, BDL rats at day 7; BDL-D18, BDL rats at day 18 B: CD44 expression by NPLC. HSC, hepatic stellate cells; KC, Kupffer cells. C: precursor frequency of CD44 variant exons (V) expressed by biliary epithelial cells (BEC) and cholestatic livers. *P < 0.05; **P < 0.01.

 
To examine whether BEC preferentially express specific CD44 variant isoform(s) in cholestatic livers, primer pairs specific to CD44 variant exon v1 to v10 were employed in qPCR experiments. Precursor frequency of each individual variant exon used by BEC isolated from D18 livers was compared with precursor frequency of CD44 variant exons used in the BDL-D18 livers. As shown in Fig. 1C, the majority of CD44 mRNA expressed in the BDL livers were encoded by variant exons with precursor frequencies of v6 (56.4%), v8 (46.5%), v7 (42.5%), v9 (42.0%), v5 (25.7%), v10 (19.3%), v4 (15.1%), v3 (3.6%), v1 (2.6%), and v2 (0.9%). In contrast, BEC isolated from the same BDL-D18 livers exhibited low frequency of variant exon usage.

Hyaluronan upregulated CD44 and Ki67 gene expression by normal BEC. BEC were isolated from the liver of normal F344 rats (n = 3) and stimulated in primary cultures with HA. Expression of CD44 and Ki67, a proliferation marker, was measured using qPCR (Fig. 2). Levels of CD44 (Fig. 2A) and Ki-67 (Fig. 2B) mRNA were significant increased at 24 and 36 h following HA treatment. There was a strong positive correlation between y (Ki67) and x (CD44) in HA-stimulated cells (correlation coefficient r2 = 0.98) but not in control cells (r2 = 0.77).


Figure 2
View larger version (11K):
[in this window]
[in a new window]

 
Fig. 2. Expression of CD44 and Ki67 genes by BEC in primary cultures detected by qPCR. Expression of CD44 (A) and Ki67 mRNA (B) by BEC. C: correlation plot between y (Ki67) and x (CD44) in hyaluronic acid (HA)-stimulated cells (correlation coefficient r2 = 0.98). *P < 0.05; **P < 0.01.

 
Immunohistological study of the cholestatic livers. Cryostat sections of the livers were stained with Sirius red, CK-7-PE antibody, CD44-FITC antibody, or HABP, respectively (Fig. 3). BDL-D7 livers displayed mild to moderate bile duct proliferation, whereas BDL-D18 livers exhibited cholestatic cirrhosis characterized by intensive bile duct proliferation and portal-portal septum formation. Control livers did not develop cholestatic lesions. Immunofluorescent microscopy revealed strong CD44 staining of the biliary epithelia lining the proliferative bile ducts in the cholestatic livers. CD44 antibody strongly stained biliary epithelia, especially at the basal parts of the epithelia. Some of NPLC lining the sinusoidal lumens were also positive for CD44 antibody. HABP staining showed that normal livers had minimal HA expression, whereas the BDL livers had overall enhanced HA expression. Marked accumulation of HA was present in the interstitial tissue subjacent to the intrahepatic bile ducts and in the fibrotic areas in the portal triads. HABP staining was also present at the necrotic foci of the liver parenchyma.


Figure 3
View larger version (104K):
[in this window]
[in a new window]

 
Fig. 3. Immunohistological demonstration of increased CD44 expression by BEC and accumulation of HA in the cholestatic livers. Sirius red stain: A: sham control liver with no fibrotic lesions; E: portal fibrosis; I: portal-to-portal septum formation. CK-7-phycoerythrin (PE) staining, showing vigorous proliferation of intrahepatic bile ducts in the cholestatic livers (F and J). Bile duct canalicular networks are also CK-7 positive. CD44-FITC staining, showing strong CD44 expression by BEC lining the proliferative intrahepatic bile ducts in the cholestatic livers (G and K). Insert: higher power view. HA binding protein (HABP) stain (D, H, L), showing markedly increased staining of HABP in the connective tissue subjacent to the proliferative bile ducts and in the fibrotic areas in the portal triads. Original magnification, E, I: x100; AD, FH, JL: x200.

 
Hyaluronan-enhanced BEC seeding in cultures. An immortalized mouse BEC line (mIBEC) was used to examine the biological effect of CD44-HA interaction on biliary epithelia. The cells were seeded into six-well plates coated with HA. Microscopic observation showed that the mIBEC attached onto HA-coated wells in about 2 h and exhibited firm adhesion and spouting by 3 h (Fig. 4A1). On the other hand, mIBEC cultured without HA remained in round shape by 3 h, suggesting a minimal cell adhesion (Fig. 4A2). In 24-h cultures, cell density was greater in cultures with HA (Fig. 4A3) than those without HA. Flow-cytometric antibody binding assay showed that HA-stimulated mIBEC expressed significantly higher levels of cell surface CD44 than the cells without HA treatment (Fig. 4B, P < 0.01). Consistent with the flow cytometric data, qPCR revealed a sixfold increase in CD44 mRNA levels in cells under HA-treatment when compared with controls (Fig. 4C).


Figure 4
View larger version (21K):
[in this window]
[in a new window]

 
Fig. 4. Hyaluronan enhanced BEC adhesion and CD44 expression. A: representative microphotographs of mIBEC in cultures. 1: Mouse intrahepatic BEC (mIBEC) stimulated with HA 3 h in culture, exhibiting firm adhering and sprouting. 2: Control mIBEC. 3: In 24-h culture, HA-stimulated mIBEC apparently propagated more rapidly than control mIBEC. 4: Original magnification: x400. B: flow cytometric detection of cell surface CD44. mIBEC stimulated with HA displayed a significant increase in CD44-FITC channel shift. Insert: histogram of Kolmogorov-Smirnov analysis of the flow data. This set of flow cytometric data is representative of 5 individual experiments. C: qPCR detection of CD44 by mIBEC. Key: **P < 0.01.

 
Hyaluronan enhanced BEC proliferation. The effect of HA on BEC proliferation was evaluated in a cell proliferation assay, which qualifies the number of viable cells in culture. As shown in Fig. 5A, significantly higher rates of cell growth were present in cultures with HA at different time points from 24 to 96 h. In addition, mIBEC harvested at 24, 48, and 72 h in the cultures with HA simulation expressed significantly higher levels of CD44 mRNA compared with controls (Fig. 5B). Expression of Ki67, a cell proliferation marker gene, was also significantly upregulated by HA treatment of mIBEC.


Figure 5
View larger version (14K):
[in this window]
[in a new window]

 
Fig. 5. Hyaluronan promoted mIBEC proliferation in association with upregulation of CD44 and Ki67 gene expression. A: results of cell proliferation assay, showing that mIBEC in cultures with HA grew at scales significantly higher than control cells. O.D, optical density. B: CD44 expression by mIBEC detected by qPCR. C: Ki67 expression by mIBEC. **P < 0.01; *P < 0.05.

 
Anti-CD44 antibody antagonized BEC proliferation. A monoclonal anti-mouse CD44 was added to proliferation cultures to block the interaction between CD44 and HA. Cell proliferation was evaluated at 24 and 48 h after initiation of CD44 blocking (Fig. 6). The results show that anti-CD44 significantly reduced the growth rates of mIBEC stimulated with HA for up to 48 h, whereas isotype control incubation exhibited no effect (P < 0.01).


Figure 6
View larger version (9K):
[in this window]
[in a new window]

 
Fig. 6. Anti-CD44 antibody antagonizes BEC proliferation. mIBEC were cultured with (HA+) or without (HA-) HA and treated with anti-CD44 (HA+CD44) or isotype IgG control (HA+iso). The data demonstrate that anti-CD44 treatment significantly reduced growth rates of BEC stimulated with HA for up to 48 h. *P <0.05; **P < 0.01.

 
siRNA CD44 inhibited HA-induced BEC proliferation. mIBEC were transfected with 200 pmol of siRNA CD44 or scrambled control RNA. The effect of CD44 silencing on CD44 expression by mIBEC was examined at 24 and 48 h after transfection. As demonstrated in Fig. 7, the siRNA significantly downregulated CD44 mRNA expression (P < 0.01) and simultaneously suppressed cell surface CD44 as measured with flow cytometry, whereas the scrambled RNA had little effect. Cell proliferation assays demonstrated that siRNA CD44 significantly suppressed the growth of mIBEC treated with HA when compared with the scrambled RNA control (P < 0.05 at 24 h and P < 0.01 at 48 h).


Figure 7
View larger version (17K):
[in this window]
[in a new window]

 
Fig. 7. Small interfering RNA (siRNA) CD44 suppresses BEC proliferation. mIBEC transfected with siRNA CD44 or scrambled RNA were cultured with (HA+) or without (HA-) HA. A: CD44 mRNA levels detected by qPCR, noting 7–8-fold differences between siRNA-treated cells and scrambled control. B: flow cytometric histograms, showing cell surface CD44 tagged with anti-CD44-PE. Light-shaded area: isotype control; open area: siRNA treated; dark-shaded area: scrambled control. C: results of cell proliferation assays, demonstrating that the siRNA significantly decreased the growth rates of mIBEC for up to 48 h. Keys: *P <0.05; **P < 0.01.

 

    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mechanical interruption of the flow by BDL resulted in liver pathology characterized by cholestasis, bile ductular proliferation, portal tract inflammation, and fibrotic septum formation as described previously (6, 7, 21, 34). The cholestatic livers were found to express exceedingly high amounts of adhesion molecule CD44, providing a model to investigate the possible role of CD44-HA interaction in the development of cholestatic liver disease.

CD44 expression was first examined at the mRNA level using qPCR. High levels of CD44 mRNA were found in BEC isolated from the cholestatic livers, which were significantly higher than that expressed by KC, HSC, and LSEC (Fig. 1). BEC CD44 expression continued to increase with prolonged intervals of BDL. The data indicate that proliferating cholangiocytes are a major source of hepatic CD44. qPCR data also show differential CD44 expression among different NPLC. CD44 mRNA levels in CD31+ LSEC significantly increased at D7 but retreated to low levels by D18. On the other hand, CD44 mRNA expression by KC and HSC was significantly augmented during later stages of cholestasis (D18). The dynamic changes in CD44 gene expression reflect alterations of different NPLC in responses to cholestasis, tissue injury, inflammation, and wound healing. CD44 mRNA changes observed in LSEC indicate an early activation and a late downregulation of the gene. The latter may be due to endothelial damage in the advanced cholestatic livers. Low CD44 mRNA expression by LSEC following hepatectomy has been suggested as an indicator of a functional failure of the sinusoidal endothelia (30). Upregulated CD44 expression by KC may represent hepatic macrophage aggregation, whereas high CD44 expression by HSC relates to stellate cell activation and fibrogenesis (16) (31).

With respect to expression of CD44 variant isoforms, CD44 mRNA expressed in the cholestatic livers was complicated with high precursor frequency of exons v6 (56.4%), v8 (46.5%), v7 (42.5%), and v9 (42.0%). The data suggest that CD44v isoforms containing one or several exon transcripts were predominantly expressed by the cholestatic liver tissue, which represents a collection of different types of cells in the livers. Frequent usage of spliced variant isoforms by HSC following BDL has been reported (16). KC expression of CD44v has been linked to hepatic macrophage activation (31). In contrast, BEC isolated from the cholestatic livers exhibited low precursor frequency of variant exon use, indicating a preferential utilization of CD44 standard isoform.

The results of the immunohistological analysis are consistent with the data derived from qPCR. BEC proliferating in the intrahepatic bile ducts were strongly positive for CD44 antibody, whereas CD44 staining on ductal cells of the sham-operated livers was very weak. Intriguingly, cell surface CD44 staining was obviously polarized to the basal part of the BEC. These CD44 molecules are geographically proximate to the periductular matrix, where the prime ligand of CD44, HA, is increasingly present in cholestatic livers (25).

Hepatic expression of extracellular hyaluronan was studied histochemically. HABP staining of the liver sections showed that overall HA expression was increased in the cholestatic livers. HA staining was largely distributed in either necrotic areas of the parenchyma or, more importantly, periductular areas of the portal tracts, which were close to the CD44-expressing biliary epithelia lining the bile ducts. These data suggest that cell surface CD44 molecules present on BEC are in intimate contact with its ligand, HA, accumulating in the periductular connective tissue.

To verify the biological effect of CD44-HA binding on biliary proliferation, cellular proliferation experiments were conducted. An immortalized mouse cholangiocyte line (mIBEC) was stimulated with hyaluronan in cultures (13). In early cell cultures (2–24 h after seeding), HA apparently exhibited stimulating effect on cell adhesion, spouting, and growth (Fig. 4). qPCR detected an increased amount of CD44 mRNA and Ki67 mRNA in mIBEC at 24 h following HA treatment. The data is consistent with the result derived from a similar experiment conducted in primarily cultured BEC (Fig. 2). Cell surface CD44 was also significantly increased in mIBEC stimulated with HA, as detected by flow cytometry. Upregulated expression of CD44 in mIBEC stimulated with HA corresponded with increased cell growth. Moreover, mIBEC proliferation was antagonized by either addition in cultures of anti-CD44 neutralizing antibody (Fig. 6) or transfection of the mIBEC with siRNA CD44 (Fig. 7). SiRNA CD44 significantly downregulated CD44 mRNA expression by mIBEC, leading to a decrease in cell surface CD44 and resulting in suppression of cholangiocyte growth. These results strongly indicate that CD44-HA binding plays a role in biliary cell proliferation. Enhancement of cell proliferation via CD44-HA signaling has been documented in eosinopoiesis, epithelia, and carcinoma cells (9) (26) (12).

Although the present observations are consistent with the hypothesis that extracellular HA can enhance BEC proliferation through interaction with CD44, the mechanism(s) by which adhesion of cell surface CD44 to extracellular hyaluronan leads to biliary proliferation is unknown. Obviously, CD44-HA binding is not a prerequisite for biliary growth since cholangiocyte propagation in culture is independent of HA treatment. Given the fact that HA is the major component of ECM, it is possible that extracellular hyaluronan functions as an anchor (via CD44 binding) to support proper polarization of the growing biliary epithelia, thus facilitating cell proliferation. Hyaluronan anchoring through CD44 has been well documented, especially in vascular endothelia, which facilitates lymphocyte extravasations (10, 18, 22, 23, 32). Furthermore, hyaluronan is a signaling molecule. CD44-HA signaling can propagate cellular processes including cell mitosis and locomotion (9, 17, 24, 26, 35). Thus it is also possible that CD44-HA linkage directly causes BEC proliferation via CD44 downstream signal pathways. A supportive finding of this possibility was the strong correlation (r2 = 0.98) between CD44 and Ki67 gene expression by BEC following HA treatment. Hyaluronan upregulated expression of CD44 and Ki67 genes and promoted BEC proliferation simultaneously. Further investigation directed to identify the mitosis-related signaling cascade downstream of CD44 signaling is warranted.

In summary, this research work has qualified CD44 expression in a rat model of hepatic cholestasis induced by common BDL. BEC were found to express the highest level of CD44 mRNA among four major types of NPLC. CD44+ BEC lining the proliferative bile ducts were geographically associated with extracellular hyaluronan accumulated in the portal tracts, especially in periductular areas. Cholangiocyte propagation was accelerated by HA treatment and was partially antagonized by either anti-CD44 antibodies or siRNA CD44. By enhancing biliary proliferation, CD44-HA interactions may play an important role in the pathogenesis of hepatic cholestasis.


    ACKNOWLEDGMENTS
 
Yao He is a visiting scientist from the First Affiliated Hospital of Zhongshan University, Guangzhou, China. Tomohito Sadahiro is a visiting scientist from Department of Emergency and Critical Care Medicine, Chiba University School of Medicine, Chiba, Japan. Sang Ik Noh is a visiting scientist from Department of Surgery, Seoul Veterans Hospital, Seoul, Korea.


    FOOTNOTES
 

Address for reprint requests and other correspondence: G. Wu, Director of Transplant Immunobiology Laboratory at Comprehensive Transplant Ctr., Cedars-Sinai Medical Center, 8700 Beverly Blvd., Los Angeles, CA 90048 (e-mail: gordon.wu{at}cshs.org)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Alpini G, Lenzi R, Sarkozi L, Tavoloni N. Biliary physiology in rats with bile ductular cell hyperplasia. Evidence for a secretory function of proliferated bile ductules. J Clin Invest 81: 569–578, 1988.[Web of Science][Medline]
  2. Bajorath J. Molecular organization, structural features, and ligand binding characteristics of CD44, a highly variable cell surface glycoprotein with multiple functions. Proteins 39: 103–111, 2000.[CrossRef][Web of Science][Medline]
  3. Bartolazzi A, Nocks A, Aruffo A, Spring F, Stamenkovic I. Glycosylation of CD44 is implicated in CD44-mediated cell adhesion to hyaluronan. J Cell Biol 132: 1199–1208, 1996.[Abstract/Free Full Text]
  4. Camp RL, Scheynius A, Johansson C, Pure E. CD44 is necessary for optimal contact allergic responses but is not required for normal leukocyte extravasation. J Exp Med 178: 497–507, 1993.[Abstract/Free Full Text]
  5. Cruickshank SM, Southgate J, Wyatt JI, Selby PJ, Trejdosiewicz LK. Expression of CD44 on bile ducts in primary sclerosing cholangitis and primary biliary cirrhosis. J Clin Pathol 52: 730–734, 1999.[Abstract]
  6. Desmouliere A, Darby I, Costa AM, Raccurt M, Tuchweber B, Sommer P, Gabbiani G. Extracellular matrix deposition, lysyl oxidase expression, and myofibroblastic differentiation during the initial stages of cholestatic fibrosis in the rat. Lab Invest 76: 765–778, 1997.[Web of Science][Medline]
  7. Dooley S, Hamzavi J, Breitkopf K, Wiercinska E, Said HM, Lorenzen J, Ten Dijke P, Gressner AM. Smad7 prevents activation of hepatic stellate cells and liver fibrosis in rats. Gastroenterology 125: 178–191, 2003.[CrossRef][Web of Science][Medline]
  8. Falleti E, Pirisi M, Fabris C, Bortolotti N, Soardo G, Gonano F, Bartoli E. Circulating standard CD44 isoform in patients with liver disease: relationship with other soluble adhesion molecules and evaluation of diagnostic usefulness. Clin Biochem 30: 69–73, 1997.[CrossRef][Web of Science][Medline]
  9. Furuta K, Zahurak M, Yang XL, Rosada C, Goodman SN, August JT, Hamilton SR. Relationship between CD44 expression and cell proliferation in epithelium and stroma of colorectal neoplasms. Am J Pathol 149: 1147–1155, 1996.[Abstract]
  10. Gal I, Lesley J, Ko W, Gonda A, Stoop R, Hyman R, Mikecz K. Role of the extracellular and cytoplasmic domains of CD44 in the rolling interaction of lymphoid cells with hyaluronan under physiologic flow. J Biol Chem 278: 11150–11158, 2003.[Abstract/Free Full Text]
  11. Goodison S, Urquidi V, Tarin D. CD44 cell adhesion molecules. Mol Pathol 52: 189–196, 1999.[Abstract]
  12. Hamann KJ, Dowling TL, Neeley SP, Grant JA, Leff AR. Hyaluronic acid enhances cell proliferation during eosinopoiesis through the CD44 surface antigen. J Immunol 154: 4073–4080, 1995.[Abstract]
  13. Hreha G, Jefferson DM, Yu CH, Grubman SA, Alsabeh R, Geller SA, Vierling JM. Immortalized intrahepatic mouse biliary epithelial cells: immunologic characterization and immunogenicity. Hepatology 30: 358–371, 1999.[CrossRef][Web of Science][Medline]
  14. Kaneda H, Hashimoto E, Yatsuji S, Tokushige K, Shiratori K. Hyaluronic acid levels can predict severe fibrosis and platelet counts can predict cirrhosis in patients with nonalcoholic fatty liver disease. J Gastroenterol Hepatol 21: 1459–1465, 2006.[Web of Science][Medline]
  15. Katz SC, Pillarisetty VG, Bleier JI, Shah AB, DeMatteo RP. Liver sinusoidal endothelial cells are insufficient to activate T cells. J Immunol 173: 230–235, 2004.[Abstract/Free Full Text]
  16. Kikuchi S, Griffin CT, Wang SS, Bissell DM. Role of CD44 in epithelial wound repair: migration of rat hepatic stellate cells utilizes hyaluronic acid and CD44v6. J Biol Chem 280: 15398–15404, 2005.[Abstract/Free Full Text]
  17. Lee JY, Spicer AP. Hyaluronan: a multifunctional, megaDalton, stealth molecule. Curr Opin Cell Biol 12: 581–586, 2000.[CrossRef][Web of Science][Medline]
  18. Lesley J, Howes N, Perschl A, Hyman R. Hyaluronan binding function of CD44 is transiently activated on T cells during an in vivo immune response. J Exp Med 180: 383–387, 1994.[Abstract/Free Full Text]
  19. Lydatakis H, Hager IP, Kostadelou E, Mpousmpoulas S, Pappas S, Diamantis I. Non-invasive markers to predict the liver fibrosis in non-alcoholic fatty liver disease. Liver Int 26: 864–871, 2006.[CrossRef][Web of Science][Medline]
  20. Mikami T, Saegusa M, Mitomi H, Yanagisawa N, Ichinoe M, Okayasu I. Significant correlations of E-cadherin, catenin, and CD44 variant form expression with carcinoma cell differentiation and prognosis of extrahepatic bile duct carcinomas. Am J Clin Pathol 116: 369–376, 2001.[CrossRef][Web of Science][Medline]
  21. Nakano S, Haratake J, Hashimoto H. Alterations in bile ducts and peribiliary microcirculation in rats after common bile duct ligation. Hepatology 21: 1380–1386, 1995.[Web of Science][Medline]
  22. Nandi A, Estess P, Siegelman MH. Hyaluronan anchoring and regulation on the surface of vascular endothelial cells is mediated through the functionally active form of CD44. J Biol Chem 275: 14939–14948, 2000.[Abstract/Free Full Text]
  23. Nedvetzki S, Golan I, Assayag N, Gonen E, Caspi D, Gladnikoff M, Yayon A, Naor D. A mutation in a CD44 variant of inflammatory cells enhances the mitogenic interaction of FGF with its receptor. J Clin Invest 111: 1211–1220, 2003.[CrossRef][Web of Science][Medline]
  24. Noble PW, McKee CM, Cowman M, Shin HS. Hyaluronan fragments activate an NF-kappa B/I-kappa B alpha autoregulatory loop in murine macrophages. J Exp Med 183: 2373–2378, 1996.[Abstract/Free Full Text]
  25. Nyberg A, Engstrom-Laurent A, Loof L. Serum hyaluronate in primary biliary cirrhosis—a biochemical marker for progressive liver damage. Hepatology 8: 142–146, 1988.[CrossRef][Web of Science][Medline]
  26. Oliferenko S, Kaverina I, Small JV, Huber LA. Hyaluronic acid (HA) binding to CD44 activates Rac1 and induces lamellipodia outgrowth. J Cell Biol 148: 1159–1164, 2000.[Abstract/Free Full Text]
  27. Pares A, Deulofeu R, Gimenez A, Caballeria L, Bruguera M, Caballeria J, Ballesta AM, Rodes J. Serum hyaluronate reflects hepatic fibrogenesis in alcoholic liver disease and is useful as a marker of fibrosis. Hepatology 24: 1399–1403, 1996.[CrossRef][Web of Science][Medline]
  28. Pertoft HSB. Cell separation: Methods and Selected Applications. Orlando, FL: Academic Press, 1987.
  29. Polfliet MM, Fabriek BO, Daniels WP, Dijkstra CD, van den Berg TK. The rat macrophage scavenger receptor CD163: expression, regulation and role in inflammatory mediator production. Immunobiology 211: 419–425, 2006.[CrossRef][Web of Science][Medline]
  30. Saegusa S, Isaji S, Kawarada Y. Changes in serum hyaluronic acid levels and expression of CD44 and CD44 mRNA in hepatic sinusoidal endothelial cells after major hepatectomy in cirrhotic rats. World J Surg 26: 694–699, 2002.[CrossRef][Web of Science][Medline]
  31. Satoh T, Ichida T, Matsuda Y, Sugiyama M, Yonekura K, Ishikawa T, Asakura H. Interaction between hyaluronan and CD44 in the development of dimethylnitrosamine-induced liver cirrhosis. J Gastroenterol Hepatol 15: 402–411, 2000.[CrossRef][Web of Science][Medline]
  32. Screaton GR, Bell MV, Jackson DG, Cornelis FB, Gerth U, Bell JI. Genomic structure of DNA encoding the lymphocyte homing receptor CD44 reveals at least 12 alternatively spliced exons. Proc Natl Acad Sci USA 89: 12160–12164, 1992.[Abstract/Free Full Text]
  33. Sirica AE, Gainey TW. A new rat bile ductular epithelial cell culture model characterized by the appearance of polarized bile ducts in vitro. Hepatology 26: 537–549, 1997.[Web of Science][Medline]
  34. Slott PA, Liu MH, Tavoloni N. Origin, pattern, and mechanism of bile duct proliferation following biliary obstruction in the rat. Gastroenterology 99: 466–477, 1990.[Web of Science][Medline]
  35. Tammi MI, Day AJ, Turley EA. Hyaluronan and homeostasis: a balancing act. J Biol Chem 277: 4581–4584, 2002.[Free Full Text]
  36. Tanaka Y, Mak KM, Lieber CS. Immunohistochemical detection of proliferating lipocytes in regenerating rat liver. J Pathol 160: 129–134, 1990.[CrossRef][Web of Science][Medline]
  37. Urashima S, Tsutsumi M, Ozaki K, Tsuchishima M, Shimanaka K, Ueshima Y, Takase S. Immunohistochemical study of hyaluronate receptor (CD44) in alcoholic liver disease. Alcohol Clin Exp Res 24: 34S–38S, 2000.[Web of Science][Medline]
  38. Vrochides D, Papanikolaou V, Pertoft H, Antoniades AA, Heldin P. Biosynthesis and degradation of hyaluronan by nonparenchymal liver cells during liver regeneration. Hepatology 23: 1650–1655, 1996.[CrossRef][Web of Science][Medline]
  39. Xu B, Broome U, Ericzon BG, Sumitran-Holgersson S. High frequency of autoantibodies in patients with primary sclerosing cholangitis that bind biliary epithelial cells and induce expression of CD44 and production of interleukin 6. Gut 51: 120–127, 2002.[Abstract/Free Full Text]
  40. Yokoyama Y, Hiyama E, Murakami Y, Matsuura Y, Yokoyama T. Lack of CD44 variant 6 expression in advanced extrahepatic bile duct/ampullary carcinoma. Cancer 86: 1691–1699, 1999.[CrossRef][Medline]
  41. Zhu H, Mitsuhashi N, Klein A, Barsky LW, Weinberg K, Barr ML, Demetriou A, Wu GD. The role of the hyaluronan receptor CD44 in mesenchymal stem cell migration in the extracellular matrix. Stem Cells 24: 928–935, 2006.[CrossRef][Web of Science][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Figure
Right arrow All Versions of this Article:
295/2/G305    most recent
ajpgi.90229.2008v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by He, Y.
Right arrow Articles by Klein, A. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by He, Y.
Right arrow Articles by Klein, A. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
Visit Other APS Journals Online
Copyright © 2008 by the American Physiological Society.