Treatment with IL-27 attenuates experimental colitis through the suppression of the development of IL-17-producing T helper cells

Tetsumasa Sasaoka, Masayuki Ito, Junji Yamashita, Kenji Nakajima, Issei Tanaka, Masakuni Narita, Yukio Hara, Kaori Hada, Munehisa Takahashi, Youichi Ohno, Takato Matsuo, Yoshiaki Kaneshiro, Hitoshi Tanaka, Kenji Kaneko

Abstract

Inflammatory bowel disease (IBD) represents a group of chronic inflammatory diseases characterized by inflammation and relapsing gastrointestinal disorders. Recent studies have shown that Th17 cells, which are well known as key mediators of chronic inflammation, have a pivotal role in onset and development of IBD in humans and mice, alike. In recent years, it has been reported that IL-27, which is an IL-12-related heterodimeric cytokine consisting of EBI3 and p28 subunits, act directly on naive T cells to suppress the differentiation of Th17 cells. However, effects of exogenous IL-27 on the IBD are not well elucidated. To clarify the suppressive effect of IL-27 treatment on IBD, we applied the flexible linking method to EBI3 and p28 subunits and generated a single-chain human IL-27 (scIL-27). scIL-27 inhibited xenogenic mouse Th17 cell differentiation in vitro, indicating that scIL-27 also acts in mouse immune systems. In a 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced mouse acute colitis model, subcutaneous scIL-27 treatment significantly improved the colon length, extent of necrosis, and ulceration and thickened epithelium and several pathological scores in a dose-dependent manner. scIL-27 clearly suppressed several inflammatory cytokines, including IL-17, in inflamed colon, except for anti-inflammatory cytokine IL-10. The mesenteric lymph node cells from scIL-27-treated mice also exhibited a reduced inflammatory response and, furthermore, a lower population of Th17 cells than those of PBS-treated mice. Finally, we showed the therapeutic efficacy of scIL-27 on TNBS-induced colitis even after active colitis was established. These results suggest new possible therapeutic approaches for IBD, including disorders such as Crohn's disease and ulcerative colitis.

  • interleukin-27
  • inflammation
  • Th17 cells
  • inflammatory bowel disease
  • therapy

crohn's disease and ulcerative colitis are collectively referred to as inflammatory bowel disease (IBD), which represents a group of chronic inflammatory diseases characterized by inflammation and relapsing gastrointestinal disorders (13, 34). The associated histology with IBD typically includes inflammation and the infiltration of neutrophils and other inflammatory cells in the intestinal mucosa. Although the pathogenesis of the IBD is not completely understood, chronic inflammation is considered to be a result of the disorder and, in context of genetic predisposition, results in an overabundant immune response against intestinal flora. A disorder of intestinal mucosal immunity causes an overexpression of inflammatory cytokines, such as tumor necrosis factor (TNF)-α, IL-1β, and IL-6. These cytokines play an important role in inflammatory response, which induces exacerbation of colitis in IBD patients (43). Recent studies proved that the neutralization of these inflammatory cytokines can improve the established inflammatory response in IBD patients (7).

A specific helper T subset, known as Th17 cells, is characterized by CD4+ effector T cells expressing IL-17A and several other inflammatory cytokines, such as IL-17F, IL-6, IL-21, IL-22, TNF-α, and granulocyte macrophage colony-stimulating factor (35). Th17 cells are known to contribute to the protection of the host against various bacteria and fungi, particularly at mucosal surfaces, given their ability to recruit neutrophils and induce the production of defensins from epithelial cells in the colon (17, 22). In parallel with this, Th17 cells are constitutively present in the intestinal mucosa in humans and mice (4). However, recent studies demonstrated that Th17 cells also play a role as potent mediators of several experimental autoimmune inflammation models for multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, and psoriasis (16). IL-17A, which is primarily produced by Th17 cells, recruits neutrophils and macrophages and induces numerous inflammatory mediators, including TNF-α, iNOS, IL-6, and CXC chemokines IL-8 and macrophage inflammatory protein (MIP)-2 (23). Th17 cells and IL-17A are also known to be involved in promoting the onset and the development of intestinal inflammation both in murine models of IBD (19, 44, 47) and in patients with IBD (11). These findings led us to study Th17 cells as potential targets for inflammation control in IBD.

IL-27 is a heterodimeric cytokine, consisting of EBI3 and p28 subunits, which are structurally related to the IL-12/IL-23 subunits p40 and p35/p19, respectively (33). IL-27 is produced by activated macrophages and dendritic cells and signals via unique cytokine receptor complexes formed by WSX-1 and gp130 (32, 33, 46). The WSX-1/gp130 complex is expressed in a broad range of immune cells, including naive CD4+ T cells, NK cells, mast cells, macrophages, and neutrophils (21, 32, 45). Initial research has revealed a function of IL-27 as a promoter of early phase Th1 differentiation on naive CD4+ T cells (9, 42). IL-27 signaling, through WSX-1/gp130, activates the Th1-specific transcription factor, T-bet, resulting in upregulated IL-12Rβ2 on naive T cells, rendering these cells responsive to the Th1-inducing cytokine IL-12 (27). IL-27 can synergize with IL-12 to increase interferon (IFN)-γ production from naive CD4+ T cells through the transcription factor signal transducer and activator of transcription 1 (33, 39). However, more recent works described IL-27 as an immunosuppressive cytokine because of its ability to suppress Th17-mediated inflammatory responses. Studies with animal models of central nerve inflammation revealed that WSX-1-deficient mice develop a severe autoimmune response mediated by pathogenic Th17 cells, implicating the importance of IL-27 signaling for the suppression of Th17-mediated inflammation (6, 36). Amadi-Obi et al. (2) also established that IL-27 is constitutively expressed in the retina and regulates Th17-mediated responses in the human uveitis and scleritis. Moreover, several studies revealed that IL-27 can induce IL-10, which is known as an anti-inflammatory cytokine, from T cells via the STAT1 signaling pathway and acts as a negative regulator for inflammatory immune responses in mice (5, 15, 38). These reports have implicated the therapeutic potential of IL-27 on Th17-mediated autoimmune inflammatory disorders.

Fitzgerald et al. (14) exhibited the suppressive effect of exogenous IL-27 on the effector phase of experimental autoimmune encephalomyelitis (EAE) and encephalitogenic Th17-mediated responses. Niedbala et al. (30) also demonstrated that short-term treatment of IL-27 at the onset of the disease significantly attenuated collagen-induced arthritis (CIA). Several reports appeared recently suggesting the possible role of IL-27 in IBD (14, 30); however, the physiological effect of exogenously treated IL-27 on IBD mice to suppress the intestinal inflammation has not been reported. Thus, to assess the therapeutic effect of IL-27 on intestinal inflammation, we prepared single-chain human IL-27 (scIL-27) protein generated by the flexible linking of the human EBI3 protein and human p28 polypeptide in CHO cells by using the glutamine synthetase (GS) expression system (8). scIL-27 clearly inhibited the differentiation of both human and mouse Th17 cells from naive CD4+ T cells under Th17-polarizing conditions in vitro. scIL-27 significantly reduced the severity of the 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced acute colitis in mice, which was measured by the lower population and reduced inflammatory responses of Th17 cells in mouse intestinal tissue. Furthermore, scIL-27 treatment successfully suppressed TNBS-induced colitis even after active colitis was already established. These results suggest new possible therapeutic approaches for the treatment of IBD, including disorders such as Crohn's disease and recurrent ulcerative colitis.

MATERIALS AND METHODS

Mice and cell lines.

Mice were purchased from Japan SLC (Shizuoka, Japan), and 8-wk-old male C57/BL6 mice were used in whole experiments. All mice were maintained under specific pathogen-free conditions and were provided with standard laboratory foods. For care and experimental procedures for the mice, we strictly followed the Guidelines for Animal Experiments issued by Nihon Pharmaceutical Co. Ltd. The CHOK1 cell line and the GS expression system were provided by Lonza Biologics (Berkshire, UK). The CHOK1 cells were cultured in Erlenmeyer flasks on an orbital shaker at 135 rpm and maintained in CD-CHO medium (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. All experimental procedures were conducted in compliance with the approval of the Ethical Committee for Animal Experiments of Nihon Pharmaceutical Co. Ltd.

Reagents.

For mouse Th17 cell differentiation, recombinant mouse IL-6 and transforming growth factor (TGF)-β were purchased from Peprotech (Rocky Hill, NJ). Monoclonal antibodies to TCR-β (H57–597), CD28 (38.51), IL-4 (11B11), IFN-γ (XMG1.2), and IL-2 (JES6–1A12) were all from Biolegend (San Diego, CA). For intracellular cytokine staining, FITC-conjugated anti-CD4 (RM4–5) and phycoerythrin (PE)-conjugated anti-IL-17A (TC11–18H10) antibodies were obtained from BD Biosciences (Franklin Lakes, NJ).

Expression and purification of scIL-27.

As previously described, human scIL-27 was generated by linking the EBI3 protein to the p28 polypeptide through the flexible (GGGGS)3 linker (33). Human EBI3 and p28 genes that were optimized for the codon usage in CHO cells were purchased from Invitrogen. EBI3 was fused with a (GGGGS)3 linker followed by the coding sequence of the 5′-portion of p28 mature chain, which was amplified by PCR using the following primers: 5′-primer 5′-TTAAGCTTGCCGCCACCATG-3′ and 3′-primer 5′- CCTGGAGGTCTTGGAAACGATCCGCCACCGCCAGAGCCACCTCCGCCTGAACCGCCTCCACCTTTACCGAGGGACATTG-3′. A Hind III restriction site in the primer sequence is shown in italic and the (GGGGS)3 linker is underlined. p28 cDNA fused to the sequence of (GGGGS)3 linker was also amplified using following primers: 5′-primer 5′-CAATGTCCCTCGGTAAAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGTTTCCAAGACCTCCAGG-3′ and 3′-primer 5′-TTGAATTCTCAGGGTTGTG-3′. An EcoR I restriction site in the primer is shown in italic, and the (GGGGS)3 linker is underlined. To amplify only the correctly ligated DNA fragment, both PCR products were mixed as a template, and an additional PCR was performed using EBI3 5′- and p28 3′-primers. All PCR reactions were carried out with KOD -Plus- DNA polymerase (Toyobo, Osaka, Japan). The PCR product encoding scIL-27 was then cloned into the pCR4 cloning vector (Invitrogen). The sequence was confirmed, and the DNA fragment was directly subcloned into the pEE12.4 expression vector with Hind III and EcoR I sites to construct the scIL-27 expression vector. The GS expression vector pEE12.4 carries the GS gene, and its product catalyzes the formation of glutamine from glutamate and ammonia (8). CHOK1 cells were transfected with the scIL-27 expression vector and cultured in the glutamine-free CD-CHO medium in the presence of the GS inhibitor methionine sulfoximine (Sigma, St. Louis, MO), at a concentration of 50 μM, followed by adaptations for suspension cultures in Erlenmeyer flasks on an orbital shaker at 37°C.

For the expression of scIL-27, the GS-CHO cells overexpressing scIL-27 were seeded at a density of 2 × 105 cells/ml in a 15-liter bioreactor with a 10-liter working volume (Bio Master D type; Able, Tokyo, Japan). The bioreactor was maintained at 37°C and pH 7.1, and the stirring speed was set at 60 rpm. After 6 days of fermentation, the supernatants were harvested and directly loaded on an UNOSphere S (Bio-Rad, Hercules, CA) column preequilibrated with 20 mM phosphate buffer (pH 7.0). After being loaded, the column was washed with 0.3 M NaCl, and proteins were eluted with 20 mM phosphate buffer containing 1.0 M NaCl. Eluted proteins were diluted two times with distilled water and applied on a ceramic hydroxyapatite column type I (Bio-Rad) preequilibrated with 10 mM phosphate buffer containing 0.5 M NaCl (pH 7.0). After being loaded, the column was washed one time with equilibrium buffer and 50 mM phosphate buffer (without NaCl), and proteins were eluted with 0.16 M phosphate buffer (pH 7.2). Finally, eluted proteins were diluted with PBS and loaded on a PBS preequilibrated Heparin Sepharose FF column (GE healthcare, Piscataway, NJ). After the column was washed with 1.8× PBS, scIL-27 protein was eluted by 6× PBS. The eluent chloride ion concentration was measured by the coulometric titration method using a CL-7 chloride counter (Hiranuma, Ibaraki, Japan) and diluted with distilled water to adjust PBS density to obtain purified scIL-27.

Th17 cell differentiation.

Naive CD4+ T cells were purified from lymph nodes of C57BL/6 mice with the CD4+/CD62L+ T Cell Isolation kit II and Auto-MACS Cell Sorter (Miltenyi Biotec, Gradbach, Germany). Naive CD4+ T cells were cultured at a density of 106 cells/ml in IMDM medium (Invitrogen) supplemented with heat-inactivated 10% FBS, 10 mM HEPES, 1 mM sodium pyruvate, 1% nonessential amino acid solution, 100 U/ml of penicillin, 100 μg/ml of streptomycin, 2 mM of l-glutamine, and 50 μM 2-mercaptoethanol and were stimulated with immobilized anti-TCRβ (3 μg/ml) and soluble anti-CD28 (2 μg/ml) antibodies in the presence of recombinant TGF-β (3 ng/ml) and IL-6 (10 ng/ml), and anti-IL-4 (10 μg/ml), anti-IFN-γ (10 μg/ml), and anti-IL-2 (10 μg/ml) antibodies for 5 days. In some cases, scIL-27 was also added as indicated. On days 2 and 4, cells were transferred to a new culture plate, and the same medium was added. On day 5, the supernatants were harvested and analyzed for IL-17A secretion by ELISA (Invitrogen), and cells were further subjected to intracellular cytokine staining.

Intracellular cytokine staining.

For intracellular cytokine staining, cells were treated with 5 μg/ml of brefeldin A (Sigma) for 4 h and were surface-stained with FITC-conjugated anti-mouse CD4 antibody. Cells were then fixed with 1% paraformaldehyde, made permeable with 0.5% saponin in Hanks' buffered salt solution containing 0.1% BSA and 0.1% NaN3 [fluorescence-activated cell sorter (FACS) buffer], and stained intracellularly with PE-conjugated anti-mouse IL-17A antibody. Cells were washed two times with FACS buffer, and flow cytometric analysis was performed on Cytomics FC500 (Beckman Coulter, Fullerton, CA) or FACSCalibur (BD Biosciences) and analyzed using FlowJo software (Tree Star, San Carlos, CA).

Colitis induction and scIL-27 treatment.

Mice were continuously treated with PBS or scIL-27 at a dose of 0.2, 1, or 5 μg/day throughout the experiments by subcutaneously implanted osmotic pumps (Durent, Cupertino, CA). TNBS-induced colitis was induced by rectal administration of the TNBS solution in mice 6 h after the implantation of osmotic pumps. On day 0, mice were anesthetized, and a silicon catheter was inserted intrarectally, 4 cm distal to the anus. TNBS (100 mg/kg) dissolved in 50% ethanol was injected in the colonic lumen via a catheter. Control mice were administered 50% ethanol alone using the same technique. Mice were carefully held in a vertical posture for 10 min after the TNBS administration to ensure the distribution of the TNBS throughout the entire colon and cecum. To assess the therapeutic efficacy of scIL-27, osmotic pumps were implanted in mice after 3 days of the TNBS administration. Dextran sodium sulfate (DSS)-induced colitis was also induced in mice by giving drinking water containing 2.5% DSS during the experimental periods. We confirmed that water consumption was comparable between the different groups. For the colitis severity assessment, body weight, stool consistency, and rectal bleeding were examined daily during the experiments to assess the disease activity of colitis. The disease activity index (DAI) score of colitis was determined using a scoring system previously described (25). On day 4, mice were killed with carbon dioxide gas. The colons and the mesenteric lymph nodes (mLNs) were isolated for further analysis. The macroscopic colonic damage was assessed by applying the macroscopic scoring system described previously (41). For histological studies, colonic tissue located precisely 4 cm above the anus was resected from the mice in all groups at necropsy. The colonic tissues were fixed in 10% phosphate-buffered formalin (Wako Chemicals, Osaka, Japan) and embedded in paraffin. Sections (4 μm) were prepared and stained with hematoxylin-eosin. Tissue damages were semiquantitatively scored following microscopic scoring criteria previously described (3). Neutrophil infiltrations were also graded according to a degree of neutrophil infiltrations by the following criteria: 0, negative; 1, minimal; 2, mild; 3, moderate; and 4, marked. The averages of each group were represented as the infiltration index.

Real time-quantitative PCR.

Colonic tissue located precisely 3 cm above the anus was isolated from the mice of each group at necropsy. Total RNAs were extracted with the RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. First-strand cDNAs were prepared for each RNA sample using Superscript III reverse transcriptase with oligo(dT) and random primers (Invitrogen). The transcripts were quantified by real time-quantitative PCR (RT-qPCR) analysis with the ABI 7500 Real-Time PCR System and SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) using the corresponding primer pairs for mouse TNF-α, IL-1β, IL-6, IL-17A, and β-actin [Supplemental Table S1 (Supplemental data for this article may be found on the American Journal of Physiology: Gastrointestinal and Liver Physiology website.)]. For each sample, mRNA abundance was normalized by the amount of β-actin.

Isolation and culture of mLN cells.

At necropsy, mLNs were isolated and dissociated into single cell suspension. mLN cells (8 × 105 cells/ml) were cultured for 48 h in RPMI 1640 medium supplemented with 10% heat-inactivated FBS, 100 U/ml of penicillin, and 100 μg/ml streptomycin in the presence or absence of 2 μg/ml of concanavalin A (Con A; Sigma). The culture supernatants were harvested and subjected to measure the cytokine secretion by ELISA. Con A-stimulated mLN cells were also restimulated with 50 ng/ml PMA and 500 ng/ml ionomycin (Sigma) for 4 h, and subjected to intracellular cytokine staining.

Statistical analysis.

All statistical analysis was performed using the SAS program (SAS Institute, Cary, NC). The statistical significance of differences between groups was determined using parametric ANOVA tests followed by Dunnett's multiple-comparison tests for body weight change, colon length, and colon weight. The static analyses of mRNA expression, cytokine secretion, DAI score, macroscopic score, microscopic score, and infiltration index were performed using Kruskal-Wallis and Steel's multiple-comparison tests. P values <0.05 were considered to be statistically significant.

RESULTS

Cross reactivity of human scIL-27 against mouse Th17 cell differentiation in vitro.

IL-27 is known to suppress Th17-mediated responses in central nerve inflammation models (6, 36). Therefore, IL-27 is considered a potent inhibitor of Th17 cells. Although Th17 cells are also known to confer the pathology of colitis models (11, 19, 42, 44), the suppressive effect of exogenous IL-27 treatment for intestinal inflammation remains unclear. To assess whether IL-27 can suppress intestinal inflammation in vivo, we generated IL-27 heterodimer as scIL-27, which is a fusion protein of the EBI3 protein to the p28 polypeptide, processed by the application of the flexible linking method. This allowed convenient expression and purification of IL-27 as a functional monomeric cytokine as described previously (33). We produced scIL-27 with the GS expression system, which is considered to be one of the most powerful systems for the production of recombinant protein in mammalian cells (8). The final concentration of the scIL-27 was 50 mg/l in the supernatant of scIL-27-expressing CHO cells. scIL-27 was further purified by cation-exchange and a ceramic hydroxyapatite column followed by heparin affinity column chromatography to give a final yield of ∼5 mg/l culture supernatant (data not shown). To test the bioactivity of scIL-27, we cultured human CD4+ naive T cells isolated from healthy adult donors and differentiated them into Th17 cells in the absence or presence of scIL-27 in vitro. scIL-27 potently inhibited IL-17A production as well as the percentages of IL-17A-expressing CD4+ T cells, which represent Th17 cells. This inhibition was cancelled by the addition of anti-IL-27 antibody, suggesting that no other possible contaminant(s) in the scIL-27 supernatant may affect the results (Supplemental Fig. S1).

To assess the therapeutic application of scIL-27 in vivo, we elucidated the cross reactivity of human scIL-27 against xenogenic mouse cells. Mouse naive CD4+ T cells were differentiated into Th17 cells in vitro and confirmed that scIL-27 clearly reduced IL-17A production in a scIL-27 dose-dependent manner (Fig. 1A). FACS analysis also revealed that the population of Th17 cells was decreased by scIL-27 (Fig. 1B). These results clearly demonstrated that scIL-27 retains the nature of IL-27 and has cross reactivity against mouse Th17 cell differentiation.

Fig. 1.

Cross reactivity of human single-chain IL-27 (scIL-27) against xenogenic mouse Th17 cells. A: mouse naive CD4+ T cells were cultured under Th17-polarizing conditions or with anti-CD3 antibody stimulation alone in the presence or absence of scIL-27 for 5 days. Culture supernatants were harvested and assayed for the production of IL-17A by ELISA. B: mouse naive CD4+ T cells were cultured under Th17-polarizing conditions or with anti-CD3 antibody stimulation alone in the presence or absence of scIL-27 for 5 days. Cells were treated with brefeldin A, PMA, and ionomycin for 4 h before harvest. After being stained for the surface CD4, cells were fixed, permeabilized, stained for intracellular IL-17A, and analyzed with flow cytometry. All plots are gated on live cells. Nos. represent the percentages of IL-17A-expressing CD4+ cells. Each column and bar represents the mean ± SD of triplicate determinations. **P < 0.01 and *P < 0.05 compared with Th17-polarizing scIL-27(-).

Treatment with scIL-27 ameliorates the severity of TNBS-induced murine colitis.

To investigate the suppressive effect of IL-27 treatment on the intestinal inflammation in vivo, a murine TNBS-induced acute colitis model was used, which mimics Crohn's disease by intracolonic administration of TNBS, treating them with scIL-27. To achieve constant delivery of scIL-27 throughout the experimental periods, we subcutaneously implanted osmotic pumps that contained either scIL-27 or PBS alone. We confirmed that the scIL-27-treated normal mice showed no apparent symptoms or histological changes, implicating that scIL-27 exhibits very little toxicity and high tolerability in mice (data not shown). The vehicle-administered control mice did not develop any colitis-like symptoms and stayed healthy, whereas TNBS-administered mice showed severe colitis characterized by sustained weight loss, a markedly increased DAI score, a shortened colon length, and an increased colon weight-to-length ratio. In contrast, scIL-27-treated mice exhibited reduced severity of colitis, accompanied by rapid recovery of body weight, reduced DAI score, and improvement of colonic length and weight-to-length ratio (Fig. 2). These improvements were induced by a scIL-27 dose-dependent manner.

Fig. 2.

Treatment with scIL-27 attenuates the severity of 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced murine colitis. Colitis was induced in male C57/BL6 mice using TNBS as described in materials and methods. At day 4, mice were killed, and the colons were isolated for further analysis. A: body weight changes of each group after colitis induction. B: disease activity index (DAI) score of each group after colitis induction. C: typical colon morphology of each group. D: colon length of each group after necropsy. E: colon weight-to-length ratio of each group after necropsy. Data represent 1 of 3 independent experiments. Each column and bar represents the mean ± SE (n = 6–7 experiments). **P < 0.01 and *P < 0.05 compared with PBS-treated group.

In macroscopic assessments of colons, TNBS-administered mice showed striking hyperemia, necrosis, ulceration, and inflammation compared with the vehicle-administered control mice. On the other hand, scIL-27-treated mice showed reduction of macroscopic scores, with the colons showing a major improvement of colitis-associated hyperemia and ulceration (Fig. 3A and Supplemental Fig. S2). We also evaluated the severity of colonic inflammation and ulceration by performing histological examinations. The scIL-27-treated mice showed a reduced severity of transmural inflammation that was characterized by ulceration, loss of goblet cells, and tissue disruption throughout the colon compared with the colon of PBS-treated mice (Fig. 3, B and C). scIL-27 treatment also reduced the degree of the neutrophil infiltration (Fig. 3D). These observations demonstrated that IL-27 treatment reduces the severity of TNBS-induced colitis.

Fig. 3.

Treatment with scIL-27 suppresses colonic damages in colitis-induced mice. Colitis was induced in male C57/BL6 mice using TNBS as described in materials and methods. Colon tissue located precisely 4 cm above the anus was isolated from the mice of each group at necropsy. A: macroscopic score of each group. B: microscopic score of each group. C: hematoxylin-eosin staining was performed on sections of the colon tissue. Typical histological pictures of each group are shown. All images are at the same magnification (×160). D: neutrophil infiltration index score of each group. Data represent 1 of 3 independent experiments. Each column represents the mean ± SE (n = 6–7 experiments). **P < 0.01 and *P < 0.05 compared with PBS-treated group.

Reduced expression of inflammatory cytokines in inflamed colon in scIL-27-treated mice.

We confirmed IL-27 treatment improved colon tissue damages in TNBS-induced murine colitis through histological examinations. Next, we evaluated the production of several inflammatory cytokines that are reported to be involved in the pathology of TNBS-induced colitis. We isolated colons and assessed the cytokine mRNA expression in tissue homogenates on day 4 by RT-qPCR. Of the TNBS-administered mice group, we observed an upregulated mRNA expression of all cytokines examined, including IL-1β, IL-6, TNF-α, IL-10, IFN-γ, and IL-17A. Interestingly, we found that all cytokines were suppressed to the comparable level of the vehicle control mice group in the colon tissue obtained from scIL-27-treated mice, except for the anti-inflammatory cytokine IL-10 (Fig. 4). IL-27 is known to suppress the development of Th17 cells and downregulate the expression of IL-17A (2, 6). Therefore, we also stained IL-17A in colons with immunofluorescence. As expected, excessive infiltration of IL-17A-expressing cells was observed within the inflammatory colon mucosa, intestinal epithelia, and lamina propria from colitis-induced mice. However, IL-27-treated mice showed a significantly decreased number of IL-17A-expressing cells (Supplemental Fig. S3). These results suggested that scIL-27 treatment improved TNBS-induced colon inflammation, possibly because of the inhibition of proinflammatory cytokines, including IL-17A.

Fig. 4.

Treatment with scIL-27 inhibits inflammatory cytokine production in colon tissue. Colitis was induced in male C57/BL6 mice using TNBS as described in materials and methods. Colon tissue, located precisely 3 cm above the anus, was isolated from the mice of each group at necropsy. Colon tissue of each group (control, PBS, or scIL-27; 5 μg/day) was homogenized and assayed for the expression of indicated cytokine mRNAs by real time-quantitative PCR (RT-qPCR). Data represent 1 of 3 independent experiments. Each column represents the mean ± SE (n = 7 experiments). **P < 0.01 and *P < 0.05 compared with the PBS-treated group.

Treatment with scIL-27 suppresses Th17-mediated inflammatory responses in colon tissue.

We next investigated the effect of the treatment with scIL-27 on Th17 cells in mLNs. We isolated mLNs from colitis-induced mice and stimulated mLN cells with Con A in vitro. Notably, mLN cells from IL-27-treated mice showed a reduction of IL-17A and IL-6 secretion compared with those of PBS-treated mice. However, there was no significant difference in IL-10 secretion by scIL-27 treatments (Fig. 5A). Importantly, mLN cells from scIL-27-treated mice showed significantly lower percentages of Th17 cells (Fig. 5B). These data suggest that treatment with scIL-27 decreases Th17 cells and Th17-associated cytokine production through suppression of Th17 cell development in the mLNs.

Fig. 5.

Treatment with scIL-27 inhibits Th17-mediated responses of mesenteric lymph node (mLN) cells. Colitis was induced in male C57/BL6 mice using TNBS as described in materials and methods. mLNs were isolated from each group (control, PBS, or scIL-27; 5 μg/day) at necropsy. mLN cells were cultured in the presence of concanavalin A (Con A, 2 μg/ml) for 48 h. A: culture supernatants were harvested and assayed for cytokine productions by ELISA. IFN-γ, interferon-γ. Each column and bar represents the mean ± SD of triplicate determinations. B: cells were treated with brefeldin A (5 μg/ml), PMA (50 ng/ml), and ionomycin (500 ng/ml) for 4 h before harvest. After being stained for CD4, cells were fixed, permeabilized, stained for intracellular IL-17A, and analyzed by flow cytometry. All plots are gated on live CD4+ cells. Nos. represent the percentages of IL-17A-expressing CD4+ cells. **P < 0.01 and *P < 0.05 compared with the PBS-treated group.

scIL-27 treatment reduces the severity of DSS-induced colitis.

Given the efficacy of scIL-27 on TNBS-induced colitis models, we sought to examine whether scIL-27 treatment suppresses another colitis model. DSS-induced colitis is known to be a well-established animal model for ulcerative colitis, which is thought to be caused mainly by innate immune mechanisms (42). Using a DSS-induced murine colitis model, we treated the mice with scIL-27 throughout the experimental periods. As shown in Fig. 6, scIL-27 moderately ameliorated the severity of colitis induced by DSS administration, accompanied by improvement of body weight loss, DAI score, colon morphology and length, and colon weight-to-length ratio. This finding indicates the broad therapeutic efficacy of scIL-27 on colon inflammation.

Fig. 6.

Treatment with scIL-27 attenuates the severity of Dextran sodium sulfate (DSS)-induced colitis. Colitis was induced in male C57/BL6 mice by feeding water containing 2.5% DSS. Mice were treated subcutaneously with scIL-27 (5 μg/day) or PBS constantly throughout the periods using osmotic pumps as described in materials and methods. At day 8, mice were killed, and the colons were isolated for further analysis. A: body weight changes of each group after colitis induction. B: DAI score of each group after colitis induction. C: typical colon morphology of each group. D: colon length of each group after necropsy. E: colon weight-to-length ratio of each group after necropsy. Data represent the DAI scores of each group after colitis induction. Data represent 1 of 3 independent experiments. Each column and bar represents the mean ± SE (n = 6 experiments). **P < 0.01 and *P < 0.05 compared with the PBS-treated group.

Therapeutic efficacy of scIL-27 on established TNBS-induced colitis.

Finally, we wanted to determine if scIL-27 treatment shows therapeutic efficacy during later phases of the disease when acute colitis was fully established. Thus we started scIL-27 treatment 3 days after TNBS administration, at a time when mice were already losing body weight and showing severe mucosal inflammation. As shown in Fig. 7, scIL-27 treatment significantly reduced colitis severity in the next day of the treatment and almost completely recovered within 4 days after scIL-27 treatment started. This indicates that scIL-27 can suppress gastrointestinal disorders where active colitis is already established.

Fig. 7.

Late treatment with scIL-27 cures mice of established TNBS-induced colitis. Colitis was induced in male C57/BL6 mice using TNBS as described in materials and methods. Three days after TNBS administration, mice were subcutaneously treated with scIL-27 (5 μg/day) or PBS alone throughout the indicated periods. Data represent the DAI scores of each group after colitis induction. Data represent 1 of 3 independent experiments. Each column and bar represents the mean ± SE (n = 4–11 experiments). **P < 0.01 and *P < 0.05 compared with the PBS-treated group.

DISCUSSION

A unique subset of T cells, named Th17 cells, are linked to the development of the pathology noted in models of multiple sclerosis, rheumatoid arthritis, and IBD (16, 19, 23, 44, 47). Although the exacerbation of Th17-mediated responses is associated with autoimmunity, Th17 cells also contribute to the maintenance of barrier function and to the defense against infectious pathogens in the colon (17, 22). In these situations, Th17 cells do not induce autoimmunity. This implicates that mechanisms exist to regulate appropriate Th17-mediated responses in the immune system. There is now evidence that IFN-γ and IL-4 expressed by other T helper cells is required for the suppression of Th17-mediated immune responses (18, 31). Recently, IL-27 is also known to involve the inhibition of Th17-mediated autoimmune inflammation (2, 5, 6, 15, 36, 38). Furthermore, Leon et al. (25) showed that the IL-27 expression was significantly elevated in the intestinal tissue in patients with IBD. Li et al. (26) also indicated that the polymorphisms in the IL-27 gene promoter region are associated with the susceptibility to IBD in a Korean population; these polymorphisms indicate that up- or downregulated IL-27 expression level will affect gut immune homeostasis in humans. Moreover, Troy et al. (40) demonstrated that WSX-1-deficient mice exhibit an increased population of Th17 cells, and IL-27 is required for controlling the homeostasis of the T cell pools in the gut-associated lymphoid tissue. These novel findings imply that IL-27 is constitutively expressed, and its expression is elevated in the inflamed tissue to suppress the excess inflammation in the colon. It seems apparent that IL-27 is involved in the pathology in IBD patients. In line with these considerations, the treatment with exogenous IL-27 may inhibit intestinal inflammation in IBD. However, the therapeutic effect of exogenous IL-27 treatment in intestinal inflammation has not been examined.

In this report, we produced recombinant human IL-27 as a single-chain cytokine (scIL-27) and tested for its suppressive effect for the acute intestinal inflammation using the TNBS-induced acute colitis model. We produced scIL-27 with the GS expression system, one of the most powerful systems for the production of recombinant biologics with mammalian cells. After 6 days of fermentation, the scIL-27 concentration reached 50 mg/l in the culture supernatants of the scIL-27-overexpressing GS-CHO cells. First, we evaluated the bioactivities of scIL-27 by monitoring the development of Th17 cells from naive CD4+ T cells in vitro. scIL-27 potently inhibited the differentiation of human Th17 cells, as well as xenogenic mouse Th17 cells from naive CD4+ T cells (Fig. 1 and Supplemental Fig. S1). These observations indicated that scIL-27 retains the nature of the bioactivity of IL-27 and has the cross-reactivity of scIL-27 on the mouse immune system. Some previous reports suggested that the mechanism of IL-27 on Th17 development is due to the suppression of RORγt, a master regulator of the differentiation of Th17 cells (12, 37). Therefore, it is also possible that the suppressive effect of scIL-27 on Th17 differentiation is mediated by downregulation of RORγt in our in vitro assays. To confirm if this phenomenon is also true in our experiments, further study needs to be performed in the future.

To evaluate the therapeutic potential of scIL-27 on IBD, we used TNBS and DSS-induced murine acute colitis models. Subcutaneous scIL-27 treatment with the osmotic pump infusion significantly attenuated the severity of TNBS-induced gastrointestinal disorders in a dose-dependent manner (Figs. 2 and 3 and Supplemental Fig. S2). RT-qPCR analysis also demonstrated that the inhibition of colitis by scIL-27 treatment accompanied the reduction in expression of several inflammatory cytokines involved in the pathology of IBD, and importantly IL-17A, which is known to be a key mediator of chronic inflammation (Fig. 4). Moreover, scIL-27-treated mice exhibited a lower population of IL-17A-expressing cells and Th17 cells in colon tissue or mLNs (Fig. 5B and data not shown). These observations appear to be responsible for the suppression of Th17 cell development in the intestinal tissue by scIL-27. These results also correspond to previous reports that demonstrate the suppressive effects of IL-27 on several autoimmune disease models, such as EAE and CIA (14, 30).

TNBS-induced colitis and DSS-induced colitis are known as experimental models for human Crohn's disease and ulcerative colitis, respectively (44). scIL-27 treatment improved the DAI scores of both TNBS-induced colitis and DSS-induced colitis, as shown in Figs. 6 and 2B. Although it is believed that innate immunity, but not adoptive immunity, plays important roles in DSS-induced colitis, there is now growing evidence that Th17-associated cytokines also contribute to cause DSS-induced colitis (1). Our results suggest that scIL-27 treatment has broad suppressive efficacy on both colitis models through inhibition of Th17-mediated immune responses.

In the previous report, IL-27 showed differential effects on naive vs. activated CD4+ T cells, and IL-27 had little or no effect on precommitted Th17 cells to the inflammation, contrasting its potent suppressive effect on Th17 development (12). In this view, it could be considered that IL-27 has a limited efficacy under conditions where chronic Th17-mediated inflammatory responses have already developed. However, as shown in Fig. 7, we demonstrated the suppression of acute colitis by scIL-27 treatment even after active colitis was already established. It would be anticipated that sustained Th17 cell differentiation occurs in the inflamed tissue, and IL-27 can inhibit Th17-mediated responses by suppressing the turnover of Th17 cells after certain treatment periods of the inflammation with scIL-27. To clarify the detailed therapeutic potential of IL-27, further studies are required on the effects of long-term scIL-27 treatment for chronic colitis models, such as SAMP1/YitFc mice or TCR-α chain-deficient mice (28, 29).

IL-27 induces IL-10, which is known as an immunosuppressive cytokine, from T cells (15, 38). Recently, IL-27 promotes the differentiation of regulatory T cell type I (Tr1) cells, which express IL-10 (5). IL-10-deficient mice spontaneously exhibit chronic colitis, and, therefore, IL-10 is also thought to play a critical role in the suppression of intestinal inflammation (24). In the TNBS-induced murine colitis model, we observed the reduction of inflammatory cytokines, including IL-1β, IL-6, TNF-α, IL-17A, and IFN-γ by scIL-27 treatment (Fig. 4). Interestingly, of the cytokines examined, only IL-10 expression was not changed by scIL-27 treatment in the inflamed colon (Fig. 4). In addition, equivalent IL-10 secretion was observed in activated mLN cells from both PBS- and scIL-27-treated mice (Fig. 5A). This would suggest the increment of IL-10-producing cells, possibly Tr1 cells, by scIL-27 treatment. In addition, we also observed the reduction of mLN cells from scIL-27-treated mice compared with that of PBS-treated mice (data not shown). These observations may be the result of a reduction of T cells, but the percentage of IL-10-producing T cells was increased in the colon from scIL-27-treated mice. Recently, it is thought that the immunosuppressive effect of IL-27 is attributed to mainly three factors: first, the direct inhibition of the development and the activity of Th17 cells; second, the inhibition of IL-2 production from naive T cells; and third, the induction of IL-10 (46). The therapeutic effect of scIL-27 on intestinal inflammation is considered to be a result of the synergy of these three factors of the nature of IL-27.

IL-12 family cytokines, IL-12, IL-23, and IL-27, are involved in multiple immune reactions using the overlapping subunits as a situation demands. Particularly, IL-12 family cytokines play critical roles in the regulation of the T cell development. More recently, another new IL-12 family cytokine was identified as IL-35, which drives naive CD4+ T cells into regulatory T cells and suppresses the development of Th17 cells (10). IL-35 is a heterodimeric cytokine that was composed with a p35 polypeptide and EBI3 subunit. Although the functional receptor for IL-35 has not been identified, it is possible that IL-27 and IL-35 share the same signal transduction pathways and functional receptor subunit, since IL-27 and IL-35 share EBI3 subunits. So far, IL-12, which is composed of p35 and p40 subunits, is not known to have immunosuppressive activities like IL-27 and IL-35. The EBI3 subunit may have a pivotal role in the immunosuppressive effect of IL-27 and IL-35 rather than IL-27/p28 and IL-35/p35 subunits. Furthermore, it seems many commonalities exist between IL-27 and IL-35 in their immunosuppressive nature, such as the suppression of Th17 development. Thus recombinant IL-35 may also have potential for therapeutic applications of several inflammatory immune diseases, including IBD.

In summary, we demonstrate for the first time that the exogenous IL-27 treatment inhibits Th17-mediated inflammatory responses to attenuate autoimmune gastrointestinal disorders even after active colitis already established itself. Although further basic and applicable clinical research is required to evaluate the utility in clinical practice, our findings offer the new therapeutic approach, “the IL-27 therapy,” to manage IBD, such as Crohn's disease and recurrent ulcerative colitis.

DISCLOSURES

No conflicts of interest are declared by the authors.

ACKNOWLEDGMENTS

We thank Dr. Hiroshi Miyazaki and Steven Christofakis for helpful comments and critical reading of the manuscript.

REFERENCES

  1. 1.
  2. 2.
  3. 3.
  4. 4.
  5. 5.
  6. 6.
  7. 7.
  8. 8.
  9. 9.
  10. 10.
  11. 11.
  12. 12.
  13. 13.
  14. 14.
  15. 15.
  16. 16.
  17. 17.
  18. 18.
  19. 19.
  20. 20.
  21. 21.
  22. 22.
  23. 23.
  24. 24.
  25. 25.
  26. 26.
  27. 27.
  28. 28.
  29. 29.
  30. 30.
  31. 31.
  32. 32.
  33. 33.
  34. 34.
  35. 35.
  36. 36.
  37. 37.
  38. 38.
  39. 39.
  40. 40.
  41. 41.
  42. 42.
  43. 43.
  44. 44.
  45. 45.
  46. 46.
  47. 47.
View Abstract